ID: 1139508991

View in Genome Browser
Species Human (GRCh38)
Location 16:67415849-67415871
Sequence GACTAAAGTGATTTCAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139508991_1139509003 27 Left 1139508991 16:67415849-67415871 CCCGACCTGAAATCACTTTAGTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1139509003 16:67415899-67415921 TTCCTTAATGCTCTGGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 136
1139508991_1139508998 21 Left 1139508991 16:67415849-67415871 CCCGACCTGAAATCACTTTAGTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1139508998 16:67415893-67415915 GCCCCCTTCCTTAATGCTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 151
1139508991_1139508997 20 Left 1139508991 16:67415849-67415871 CCCGACCTGAAATCACTTTAGTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1139508997 16:67415892-67415914 AGCCCCCTTCCTTAATGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139508991 Original CRISPR GACTAAAGTGATTTCAGGTC GGG (reversed) Intronic