ID: 1139508997

View in Genome Browser
Species Human (GRCh38)
Location 16:67415892-67415914
Sequence AGCCCCCTTCCTTAATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139508993_1139508997 15 Left 1139508993 16:67415854-67415876 CCTGAAATCACTTTAGTCATGTA 0: 1
1: 0
2: 0
3: 9
4: 192
Right 1139508997 16:67415892-67415914 AGCCCCCTTCCTTAATGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 111
1139508990_1139508997 25 Left 1139508990 16:67415844-67415866 CCTAACCCGACCTGAAATCACTT 0: 1
1: 0
2: 2
3: 10
4: 189
Right 1139508997 16:67415892-67415914 AGCCCCCTTCCTTAATGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 111
1139508992_1139508997 19 Left 1139508992 16:67415850-67415872 CCGACCTGAAATCACTTTAGTCA 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1139508997 16:67415892-67415914 AGCCCCCTTCCTTAATGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 111
1139508991_1139508997 20 Left 1139508991 16:67415849-67415871 CCCGACCTGAAATCACTTTAGTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1139508997 16:67415892-67415914 AGCCCCCTTCCTTAATGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139508997 Original CRISPR AGCCCCCTTCCTTAATGCTC TGG Intronic