ID: 1139509003

View in Genome Browser
Species Human (GRCh38)
Location 16:67415899-67415921
Sequence TTCCTTAATGCTCTGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139508994_1139509003 -7 Left 1139508994 16:67415883-67415905 CCGCTTCCCAGCCCCCTTCCTTA 0: 1
1: 0
2: 14
3: 128
4: 2307
Right 1139509003 16:67415899-67415921 TTCCTTAATGCTCTGGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 136
1139508992_1139509003 26 Left 1139508992 16:67415850-67415872 CCGACCTGAAATCACTTTAGTCA 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1139509003 16:67415899-67415921 TTCCTTAATGCTCTGGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 136
1139508991_1139509003 27 Left 1139508991 16:67415849-67415871 CCCGACCTGAAATCACTTTAGTC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1139509003 16:67415899-67415921 TTCCTTAATGCTCTGGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 136
1139508993_1139509003 22 Left 1139508993 16:67415854-67415876 CCTGAAATCACTTTAGTCATGTA 0: 1
1: 0
2: 0
3: 9
4: 192
Right 1139509003 16:67415899-67415921 TTCCTTAATGCTCTGGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139509003 Original CRISPR TTCCTTAATGCTCTGGGTTC TGG Intronic