ID: 1139511355

View in Genome Browser
Species Human (GRCh38)
Location 16:67430284-67430306
Sequence GGCCAGAGGGACGTCGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139511355_1139511369 2 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511369 16:67430309-67430331 GCTCTTGGGGTTGGCGGGGGTGG No data
1139511355_1139511371 16 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511371 16:67430323-67430345 CGGGGGTGGGCCATAAGTAATGG No data
1139511355_1139511364 -4 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511364 16:67430303-67430325 GGCCTGGCTCTTGGGGTTGGCGG No data
1139511355_1139511363 -7 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511363 16:67430300-67430322 TCTGGCCTGGCTCTTGGGGTTGG No data
1139511355_1139511372 17 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511372 16:67430324-67430346 GGGGGTGGGCCATAAGTAATGGG No data
1139511355_1139511367 -2 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511367 16:67430305-67430327 CCTGGCTCTTGGGGTTGGCGGGG No data
1139511355_1139511370 3 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511370 16:67430310-67430332 CTCTTGGGGTTGGCGGGGGTGGG No data
1139511355_1139511374 26 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511374 16:67430333-67430355 CCATAAGTAATGGGAGACCTAGG No data
1139511355_1139511368 -1 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511368 16:67430306-67430328 CTGGCTCTTGGGGTTGGCGGGGG No data
1139511355_1139511365 -3 Left 1139511355 16:67430284-67430306 CCTTCACCGACGTCCCTCTGGCC No data
Right 1139511365 16:67430304-67430326 GCCTGGCTCTTGGGGTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139511355 Original CRISPR GGCCAGAGGGACGTCGGTGA AGG (reversed) Intergenic
No off target data available for this crispr