ID: 1139513232

View in Genome Browser
Species Human (GRCh38)
Location 16:67439052-67439074
Sequence CCCACAGTGTGGAAAGAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139513224_1139513232 8 Left 1139513224 16:67439021-67439043 CCAGCTGCGCCAGGCCCTCAGGG 0: 1
1: 1
2: 2
3: 49
4: 346
Right 1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 274
1139513222_1139513232 13 Left 1139513222 16:67439016-67439038 CCGAGCCAGCTGCGCCAGGCCCT 0: 1
1: 0
2: 1
3: 23
4: 288
Right 1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 274
1139513226_1139513232 -1 Left 1139513226 16:67439030-67439052 CCAGGCCCTCAGGGTAGAGCCGC 0: 1
1: 0
2: 0
3: 24
4: 139
Right 1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 274
1139513228_1139513232 -7 Left 1139513228 16:67439036-67439058 CCTCAGGGTAGAGCCGCCCACAG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 274
1139513227_1139513232 -6 Left 1139513227 16:67439035-67439057 CCCTCAGGGTAGAGCCGCCCACA 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 274
1139513221_1139513232 14 Left 1139513221 16:67439015-67439037 CCCGAGCCAGCTGCGCCAGGCCC 0: 1
1: 0
2: 2
3: 42
4: 384
Right 1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139513232 Original CRISPR CCCACAGTGTGGAAAGAGCT TGG Exonic
900704685 1:4072988-4073010 CCCACAAAGTGGAAGGAACTAGG + Intergenic
902490178 1:16775756-16775778 TCAACAATGTGGTAAGAGCTAGG - Intronic
903320738 1:22541662-22541684 CCCACAGCCTGGGCAGAGCTGGG + Intergenic
903744134 1:25575241-25575263 CCAGCACTGTGGAAAGAGCATGG + Intergenic
904114953 1:28154964-28154986 CCAAAAGTGCGGCAAGAGCTTGG + Intronic
905206478 1:36345493-36345515 GACACAGCCTGGAAAGAGCTTGG - Intronic
906046245 1:42832998-42833020 CCCACTCTCTGGAAAAAGCTGGG + Intronic
907421095 1:54348006-54348028 CACACAGTGAGGAAAGGGGTGGG - Intronic
907490415 1:54805713-54805735 CCCAAAGTGGAGAAGGAGCTGGG + Intergenic
909556137 1:76956527-76956549 CCCACAGGAGGGAATGAGCTAGG - Intronic
911192362 1:94960542-94960564 CCCACCATGTGGACATAGCTTGG + Intergenic
911521963 1:98940280-98940302 CTCACATGGTGGAGAGAGCTAGG + Intronic
913067690 1:115271638-115271660 CTCACAGGGTGGAAAGGGCAAGG + Intergenic
915274181 1:154776659-154776681 CCCAGAGTGAGGAAACAGCAGGG - Intronic
915521625 1:156448565-156448587 CCCAGAGGGAGGGAAGAGCTAGG + Intergenic
916818060 1:168372360-168372382 GCCACAGTGAGGGAAGACCTGGG + Intergenic
917973738 1:180225397-180225419 CCCTCAGTGGAGAAAGAGCCTGG + Intergenic
918107965 1:181429400-181429422 TCCACTGTGTGGAGAGAGATTGG - Intronic
919630530 1:199956235-199956257 GCCCCAGTGTGGACAGAGCTGGG - Intergenic
919845709 1:201640866-201640888 CCCACTGTGTGCACAGAGCTGGG + Intronic
921048420 1:211493463-211493485 CCTACAGTGTGGAAATGCCTGGG - Intergenic
922796728 1:228343181-228343203 CTGGCTGTGTGGAAAGAGCTTGG + Intronic
923117160 1:230952288-230952310 GCCATGATGTGGAAAGAGCTGGG + Intronic
923530260 1:234806774-234806796 TCAACAATGTGGTAAGAGCTAGG + Intergenic
924214011 1:241800850-241800872 TGCACAGTGTGGAAAGGGTTGGG - Intronic
1062823653 10:552895-552917 TCCACGGAGTGGACAGAGCTTGG + Intronic
1063033934 10:2266634-2266656 CACCCAGTGGGGAAGGAGCTCGG + Intergenic
1063697374 10:8349867-8349889 CACACCGTGTGGAAAGGGATGGG - Intergenic
1063954746 10:11255641-11255663 GTCACAGTGGGGAGAGAGCTGGG + Intronic
1066370813 10:34816419-34816441 CACATAGTCTGGAAAGGGCTTGG - Intergenic
1067575467 10:47405877-47405899 CCCATAGGGTGAACAGAGCTGGG + Intergenic
1070921169 10:80187308-80187330 CCCACATGGTGGAAAGGGTTGGG - Intronic
1072215994 10:93287696-93287718 CCCACATTCTAGAAAGTGCTAGG + Intergenic
1072830068 10:98648145-98648167 CCCAAAGTGTGCAAAGAGTTAGG - Intronic
1073316504 10:102584841-102584863 CCCAAAGTTTGGAAAGTGTTGGG + Intronic
1074259367 10:111836286-111836308 CAGACAGAATGGAAAGAGCTGGG + Intergenic
1074538271 10:114344562-114344584 GCCAAAGGGTGGAAAGTGCTGGG + Intronic
1075665145 10:124224480-124224502 ACCGCAGCGTGGAAAGAGCCAGG - Intergenic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1076062046 10:127420507-127420529 TACACAGTGTGGCAAGATCTCGG - Intronic
1076203219 10:128574126-128574148 ACAAGAGTGTGGAAAGAGCCCGG + Intergenic
1076904554 10:133355586-133355608 CCCACAGAGTGGAGAGACCAGGG - Intronic
1077453360 11:2663976-2663998 CCCAAAGTGGGCAGAGAGCTTGG - Intronic
1079365417 11:19804920-19804942 CCCAGAGGCTGGAAAGAGGTGGG + Intronic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1080987187 11:37482948-37482970 CTCACAGTGTGGAAAGGGCAAGG - Intergenic
1081196448 11:40167137-40167159 TACACAGTGTGGAAAGTCCTAGG - Intronic
1081738973 11:45424969-45424991 CCCTCACTGTGCAAAGAGGTAGG + Intergenic
1082259949 11:50071168-50071190 GCCACAGTGAGGCAAGAGCTGGG + Intergenic
1084701991 11:70792685-70792707 TCTACTGTGTAGAAAGAGCTTGG + Intronic
1084938687 11:72600957-72600979 CCAACAGCCTGGAAAGAGCTGGG + Intronic
1086295626 11:85364435-85364457 CCCACAGTGACGAAGCAGCTAGG - Intronic
1087122646 11:94590834-94590856 ATCACAGTGAGGAGAGAGCTAGG - Intronic
1087836765 11:102882835-102882857 TCCACACTGTGGAGAGAGCAAGG + Intergenic
1088481584 11:110300526-110300548 TCCACAGTGTGGAAAGGGACCGG + Intergenic
1089124802 11:116169324-116169346 GCCACAGTGTGGAAAAAGATGGG + Intergenic
1090149402 11:124366613-124366635 GACCCATTGTGGAAAGAGCTGGG - Intergenic
1092068485 12:5612966-5612988 CAAACAGTGTGGGAAGAGTTAGG + Intronic
1092095235 12:5836739-5836761 ACCTCAGTGTGAACAGAGCTTGG - Intronic
1092173272 12:6386179-6386201 CTCAGAGGGTGGAAGGAGCTTGG - Intronic
1092977080 12:13755883-13755905 CTCACAGGGTGGAAGGAGCAAGG - Intronic
1094473666 12:30825243-30825265 CCATCAGTTTGGAAAGAGCCAGG + Intergenic
1095196399 12:39323735-39323757 CCAGCAGTGTGTTAAGAGCTGGG - Intronic
1097946829 12:65377934-65377956 ATCACAGTGTGGAAGGAGTTTGG + Intronic
1098171751 12:67753868-67753890 CTCACAGTTTAGGAAGAGCTGGG - Intergenic
1099029772 12:77511863-77511885 TCCACAGTGTGAAAACATCTGGG - Intergenic
1099190055 12:79553268-79553290 TCCACAGTGTGGAAAGGGTCCGG + Intergenic
1099819281 12:87689410-87689432 GCCACAATGTAGAAACAGCTTGG - Intergenic
1100178723 12:92060210-92060232 GCTAAAGTTTGGAAAGAGCTGGG - Intronic
1100276789 12:93078925-93078947 CCCAAAGTCAGGGAAGAGCTTGG + Intergenic
1100810276 12:98330582-98330604 CCCACGGGGTGGAGAGGGCTGGG + Intergenic
1101377207 12:104181691-104181713 TCAAAAGTGTGGAAAGTGCTGGG - Intergenic
1101830681 12:108254020-108254042 CACAGAGTGTGGAGAGAGCTGGG + Intergenic
1104354117 12:128070336-128070358 CCCACACTTTGGAAAGAGGTAGG + Intergenic
1105482912 13:20795595-20795617 GCCACACTCTGGAAAGTGCTAGG + Intronic
1107392858 13:39985246-39985268 CTCACAGTTTTTAAAGAGCTAGG + Intergenic
1108340161 13:49491441-49491463 CCTGCAGTGTGGAAGTAGCTGGG - Intronic
1108412063 13:50159587-50159609 CTCACAGTGTGAGAAGAACTTGG + Intronic
1108489330 13:50964794-50964816 GCACCAGTGTGGAAACAGCTTGG - Intronic
1110439069 13:75507573-75507595 CCCACAATGTGGCAAGCGGTGGG + Intergenic
1112841505 13:103584894-103584916 CTCACAGAGTGGAATGAGCAAGG + Intergenic
1113271421 13:108678967-108678989 CTCACAGGGTGGAAAGGGCAAGG + Intronic
1113752167 13:112784008-112784030 CCCACAGTGGGGCAAGAGCCTGG + Intronic
1114389124 14:22286819-22286841 CTCACACGGTGGAAAGAGCAAGG - Intergenic
1115171429 14:30512184-30512206 CTCACAAGGTGGAAAGAGCAAGG + Intergenic
1115429445 14:33299495-33299517 CCCACCAAGTAGAAAGAGCTGGG + Intronic
1117647553 14:57867236-57867258 CACACAATGTGGAAAATGCTTGG - Intronic
1121004660 14:90482255-90482277 GCCACAATGTGGAAGGAGGTTGG + Intergenic
1121712254 14:96047431-96047453 ACCTCAGTGTAGAAAGAGCTGGG - Intronic
1121828287 14:97028457-97028479 CAGACAGGGTGCAAAGAGCTGGG + Intergenic
1122420544 14:101573799-101573821 GTCACACTGTGGAAAGAGCATGG + Intergenic
1122816320 14:104315948-104315970 CCCAAGGTCTGGAAATAGCTTGG + Intergenic
1125287009 15:38104419-38104441 ACCAGAGTGTGGAAAGGGTTGGG + Intergenic
1125688612 15:41578687-41578709 CCCCAAGTGTGGTAATAGCTGGG - Exonic
1126323824 15:47453517-47453539 CCCACTGAGAAGAAAGAGCTGGG + Intronic
1128683457 15:69667510-69667532 CCCAGCGTGTGGAACCAGCTGGG + Intergenic
1129069056 15:72936158-72936180 ACCAAAGGGAGGAAAGAGCTGGG - Intergenic
1129163982 15:73765052-73765074 CCCACAGTGTGCAAACAGCCTGG + Intergenic
1130844957 15:87735701-87735723 CCAACTGTGTGCAAGGAGCTTGG + Intergenic
1132058149 15:98668129-98668151 CTCACAGGGTGGAGAGAGCAAGG + Intronic
1132088096 15:98924185-98924207 TGCATAGTGTGCAAAGAGCTAGG + Intronic
1132218167 15:100083283-100083305 CCCACAGTGTGCAAGCAGCAGGG + Intronic
1134417149 16:14054107-14054129 CCCTGAGTCAGGAAAGAGCTTGG - Intergenic
1134640373 16:15825183-15825205 CCCAGAGGCTGGAAAGAGGTGGG + Intronic
1134642263 16:15838523-15838545 TTCACAGTGTGGAAATAGCATGG - Intronic
1135244866 16:20846844-20846866 CCTACAGTGGGGAAGTAGCTTGG - Intronic
1136060741 16:27724579-27724601 CCCTGGGTGTGGAAAGACCTCGG - Intronic
1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG + Intergenic
1137595159 16:49718739-49718761 CTCACATGGTGGAAGGAGCTGGG + Intronic
1138052874 16:53799684-53799706 CCCAGAGAGTGAAAAGACCTCGG - Intronic
1139115783 16:63949998-63950020 GCCACAGTGGGGAAGGAGTTAGG + Intergenic
1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG + Exonic
1139967374 16:70753332-70753354 CCCACAGACTGGCAGGAGCTTGG - Intronic
1140265013 16:73412981-73413003 CCCACCGTGTGCAAAGTACTGGG + Intergenic
1140713292 16:77697890-77697912 CCCAGAGGTGGGAAAGAGCTTGG + Intergenic
1140930489 16:79623119-79623141 CCCACAGTGGGAAGGGAGCTGGG + Intergenic
1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG + Intergenic
1142934610 17:3317932-3317954 CTCCCAGTGTGGAGAGAGCGGGG - Intergenic
1144448550 17:15354905-15354927 GCCATGGTGTGGAAAGGGCTGGG + Intergenic
1145009260 17:19358199-19358221 CCTTCAGTGGGGCAAGAGCTTGG - Intronic
1145695224 17:26782140-26782162 CCCACAGAATGGGAAGGGCTAGG - Intergenic
1146073504 17:29706077-29706099 CATACAGTGTGGAAAAAACTGGG - Intronic
1147190401 17:38735114-38735136 CCCCCAAGGTGGGAAGAGCTGGG + Exonic
1150217555 17:63478905-63478927 CCCACAGAGTGGATGTAGCTTGG - Intergenic
1151550520 17:74820079-74820101 CACATAGTGTGGATGGAGCTGGG + Intronic
1151906639 17:77053425-77053447 CCCACAGGGTGCAATGGGCTAGG - Intergenic
1151930382 17:77228278-77228300 CACACAGTGTGGGAAGAGGCTGG + Intergenic
1152054846 17:78016534-78016556 CCAACAGTTTGGAAAGTGTTAGG - Intronic
1152844524 17:82591552-82591574 CCCACACTCTGGAACAAGCTTGG - Intronic
1153748456 18:8204884-8204906 GTCAGAGTGTGGAAAGAGTTTGG + Intronic
1154380294 18:13843548-13843570 CTCACAGTGTGGAAAGGGAGAGG + Intergenic
1154493016 18:14935476-14935498 CCCACCGTAGGGAAGGAGCTTGG - Intergenic
1155716148 18:28946103-28946125 TCCAAAGTGGGTAAAGAGCTTGG + Intergenic
1156285543 18:35691337-35691359 CACACAGTATAGAAAGTGCTTGG + Intronic
1156485925 18:37465597-37465619 CCCACTGTGTGCCCAGAGCTGGG + Intronic
1156622937 18:38874238-38874260 CCCCCTGAGTGGACAGAGCTGGG - Intergenic
1157395480 18:47337558-47337580 CCCAGAGAGAGGAAAGAGCTGGG - Intergenic
1158158452 18:54452168-54452190 CCCACAGTATGGAGAGGGCTTGG + Intergenic
1159753903 18:72339456-72339478 CACACAGTGTGGAAACAGCAGGG + Intergenic
1161261581 19:3340726-3340748 CGGACACCGTGGAAAGAGCTGGG - Intergenic
1161420882 19:4175370-4175392 ATCACAGTGTGGTAAGAGCTTGG + Intronic
1164173345 19:22746580-22746602 CCCCAAGTTTGTAAAGAGCTAGG + Intergenic
1164408549 19:27976932-27976954 ACCACAGTTTGGAATGTGCTGGG - Intergenic
1167001902 19:46750441-46750463 CAGACAGTGTGGCAAGAGCCAGG + Intronic
1167272632 19:48514450-48514472 CTCACAGTTTGGAAAGCTCTAGG - Intergenic
1168097105 19:54122165-54122187 CCAACAGGATGGAAAGAGCCGGG - Intronic
1168432381 19:56291491-56291513 ACCACAGGGTGGGAGGAGCTAGG + Intronic
925398078 2:3551094-3551116 TGCACAGTGTTAAAAGAGCTGGG + Intronic
925752700 2:7104110-7104132 CCCAAAATGTGCCAAGAGCTTGG - Intergenic
926807782 2:16727343-16727365 ACCACTGTGTGGCAAGAGCTGGG + Intergenic
927274942 2:21254729-21254751 CACAGGGTGGGGAAAGAGCTGGG + Intergenic
930299905 2:49602418-49602440 CTCACATTGTGAAAAGAGATTGG + Intergenic
931370880 2:61661425-61661447 TCCAAAGTGTGCAAAGACCTGGG - Intergenic
931770030 2:65489391-65489413 CCCTCAGTGCTGAAAGAGCTTGG - Intergenic
932535569 2:72590521-72590543 CCCTCAATGTGGACAAAGCTAGG - Intronic
934117994 2:88813863-88813885 GCCACAGGGTGGAGAGAGCAGGG - Intergenic
939737428 2:145865829-145865851 CCCACAGTGTGCAAAAAGAGAGG - Intergenic
940036076 2:149313221-149313243 CCCACATTGTTGGAAGAGCTGGG - Intergenic
942191171 2:173471983-173472005 CCCACTGTGTGTAAAGCACTGGG - Intergenic
943111732 2:183615136-183615158 ACCAGACTGTGGAAAAAGCTTGG - Intergenic
943933587 2:193886022-193886044 ACCACAGTTTGGAATGTGCTAGG - Intergenic
946374926 2:219302300-219302322 CCCAGAGTCTTGAAAAAGCTGGG + Exonic
946516467 2:220417081-220417103 CTCAGAGTGTTGAAAGAACTTGG + Intergenic
946701979 2:222424003-222424025 CACGCAGTTTGGAAAGAACTTGG + Intergenic
947634479 2:231673125-231673147 CCCCCAGTATGGAAAGAGAAAGG - Intergenic
948293983 2:236847459-236847481 CCAATAGTGTGGAAAGAGTTGGG - Intergenic
948527515 2:238580723-238580745 CCCAGAGGCTGGAAAGACCTGGG + Intergenic
948830922 2:240597890-240597912 CCCAGAGGGTGGAAGGAGCCAGG + Exonic
1170839020 20:19908788-19908810 TCCACTATTTGGAAAGAGCTGGG + Intronic
1172212922 20:33213640-33213662 CCCTCAGGTGGGAAAGAGCTCGG - Intergenic
1173137836 20:40455970-40455992 CCCACAGTCTGGAAAGGCATGGG + Intergenic
1173666601 20:44767481-44767503 CCCATGGTGTGGAAAGAGAGAGG + Intronic
1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG + Intergenic
1174952502 20:55057978-55058000 GCCACCATGTGGAGAGAGCTGGG - Intergenic
1175160278 20:57003136-57003158 CCAACCGTGTGAAGAGAGCTGGG - Intergenic
1176977801 21:15343240-15343262 CACAGAGTCTGGAAAGAGCTTGG - Intergenic
1177745778 21:25211492-25211514 GCCAAAGTGGAGAAAGAGCTGGG - Intergenic
1178047200 21:28709056-28709078 CTCACATGGTGAAAAGAGCTGGG + Intergenic
1178387206 21:32162413-32162435 CCCACAGAGGGGCAAGAGATGGG - Intergenic
1179609414 21:42540219-42540241 CCCTCACTGTGGACAGACCTAGG - Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181386264 22:22548124-22548146 CCCACAGTGAGGACAGGGGTTGG + Exonic
1182532792 22:30973826-30973848 CCCACAGTGTTAAAATGGCTGGG + Intergenic
1183019346 22:35014738-35014760 CCCAGAATGTGGACAAAGCTGGG + Intergenic
1183281523 22:36935138-36935160 CCCACAGTGTTCAAAGTGCTGGG - Intronic
1183467097 22:37985289-37985311 AGCCCAGTGTGGAAGGAGCTGGG - Intronic
1183478482 22:38050212-38050234 ACCACACTTTGGAAAGAGCCGGG - Intergenic
1183666366 22:39248621-39248643 CCTAAAGGGTGGAAAGAGTTGGG + Intergenic
1183672702 22:39282607-39282629 CCCACAGTGAGGAACGGCCTAGG - Intergenic
950429136 3:12940947-12940969 CCCACAGTGTGCCTAGGGCTGGG - Intronic
950833004 3:15893769-15893791 GCCACACTGTGAAAAGAGATGGG + Intergenic
951263800 3:20543582-20543604 CGCACAGTGTTGGAAGAGATTGG + Intergenic
952030503 3:29136548-29136570 GGGACAGTGGGGAAAGAGCTGGG - Intergenic
954034444 3:47843468-47843490 CCAACAGTGTGGAAAATGCTGGG - Intronic
955003196 3:54945991-54946013 CCTGCTGTTTGGAAAGAGCTAGG - Intronic
959658539 3:108839145-108839167 CTCACAGTGTGCAAATAACTAGG - Intronic
965775629 3:172227372-172227394 TCCACAATGTGGCAAAAGCTAGG + Intronic
966292131 3:178372044-178372066 CCCAGGCTGAGGAAAGAGCTAGG + Intergenic
966866688 3:184262005-184262027 CCCACAGCGCGGGAAGAGCTCGG + Intronic
967200668 3:187069959-187069981 CCCACAAAGTAGAAAGAACTTGG - Intronic
969418834 4:7078004-7078026 CACACAGAGTGGAAAGAGATGGG + Intergenic
969426488 4:7127405-7127427 CCCACAGGGTGAGGAGAGCTGGG + Intergenic
970353870 4:15233359-15233381 GCCTCAGCCTGGAAAGAGCTTGG - Intergenic
970538831 4:17057069-17057091 CCAGCAGTGTGAAAACAGCTGGG + Intergenic
971193379 4:24448563-24448585 CCCACAGTATGGAGGGACCTGGG + Intergenic
971386661 4:26146938-26146960 CCCTGAGTGTGGCACGAGCTTGG + Intergenic
972169405 4:36326816-36326838 CACACACTGTGGCAAGACCTGGG + Intronic
972771674 4:42203214-42203236 CAGAAAGTGGGGAAAGAGCTGGG + Intergenic
977148500 4:93478110-93478132 CCCACTGTTTCTAAAGAGCTAGG - Intronic
980869022 4:138589292-138589314 CTAACAGTGGGGAAAGAGTTAGG - Intergenic
981759103 4:148173871-148173893 CCGACTGTGTGGAGAGGGCTGGG + Intronic
982105410 4:152007783-152007805 CACACAGGGTGGGAAGAGCAAGG + Intergenic
982882309 4:160734797-160734819 CTCACATGGTGGAAAGAGCAAGG - Intergenic
983672325 4:170252515-170252537 CTCACAGGATGGAAAGAGCGAGG - Intergenic
984902966 4:184601040-184601062 CTCACAGTGTAAACAGAGCTCGG + Intergenic
986257340 5:6111152-6111174 CCCACTGTGTGCCAAGATCTGGG + Intergenic
989121977 5:38013910-38013932 ACTACAGCGTGGATAGAGCTGGG + Intergenic
991460179 5:66849656-66849678 CCCACAGGGTGGAAAGAGACAGG - Intronic
991657919 5:68921657-68921679 TCCACAGTGTGGAAAGGGACCGG - Intergenic
992268318 5:75039695-75039717 CCCATGGAGTGGAAAGAGGTGGG - Intergenic
992955248 5:81901639-81901661 CCCCCAGAGTGGAATGAACTCGG + Intergenic
995619598 5:114009787-114009809 AACACATTGTGGATAGAGCTAGG - Intergenic
995921723 5:117322307-117322329 CCCACATGGTGGAAGGAGATAGG - Intergenic
997434298 5:133863222-133863244 CCCAAACTGTGAAAAGAACTGGG + Intergenic
997509435 5:134443450-134443472 GCCACAGTGTGGGAAGATCCTGG + Intergenic
998527537 5:142856431-142856453 CCCACAGTGTTGAAAGAGCAAGG + Intronic
998753127 5:145346642-145346664 CTGACAGTGTAGAAATAGCTGGG - Intergenic
998769515 5:145525970-145525992 CCCACACTGTGCAAGGGGCTGGG + Intronic
999374505 5:151077451-151077473 CCACCAGTGTGGTAAGCGCTTGG - Intronic
1000490679 5:161909431-161909453 CACACAGTGTGTAAGGAGGTGGG - Intergenic
1001237509 5:170042588-170042610 CCCTGAGTTTGAAAAGAGCTTGG - Intronic
1001342376 5:170859742-170859764 CCCACAAGGTGGAAGGATCTTGG + Intergenic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002817850 6:695463-695485 TCCACAGTGTGGAAAGAAACCGG - Intergenic
1002966546 6:1971687-1971709 CCCACAGTGTGGAGAGTGGACGG - Intronic
1003179893 6:3782509-3782531 CTGCCAGTGTGGAAGGAGCTGGG + Intergenic
1003369489 6:5510524-5510546 CCCACCGTGTGCAAAGCCCTGGG - Intronic
1004159800 6:13203568-13203590 CCCACTCTGTGGAAAGAGAGTGG - Intronic
1004266251 6:14150789-14150811 GTCACAGTTTGGAAAGAGCAGGG - Intergenic
1004519450 6:16347848-16347870 TCCACAGTGTGGAAAGGGATCGG - Intronic
1004707129 6:18134902-18134924 CCCACACTGAGGAAGGAGCCTGG + Intronic
1005892942 6:30154617-30154639 CCAACAGTGTGGAACCACCTGGG + Intronic
1006451579 6:34108713-34108735 CCCACAGTGTGCCAGGTGCTGGG + Intronic
1007482589 6:42159779-42159801 CACAGGGTGTGGAAAGACCTGGG + Intronic
1007496178 6:42261475-42261497 CCCAAAGTGTCCAAATAGCTTGG - Intronic
1007989460 6:46239977-46239999 ACCACAGAGGGGAAAGAGGTGGG + Intronic
1008557862 6:52692629-52692651 CCCACACTAATGAAAGAGCTGGG - Intergenic
1008581705 6:52913974-52913996 CCCACACAGTGGAAGGAGATGGG + Intergenic
1011221298 6:85057103-85057125 CTCACAGGGTGGAAAGAGTGAGG + Intergenic
1014832022 6:126113968-126113990 CCCACATTTTGTAAAGAACTGGG - Intergenic
1017124980 6:151056877-151056899 CCCACTGTGTGCCAAGTGCTAGG - Intronic
1017543345 6:155425769-155425791 CCCACACTGTGAGAGGAGCTGGG - Intronic
1019433503 7:1010463-1010485 CACACAGTGTGGGAAGATCCGGG + Intronic
1019900983 7:4020480-4020502 CCACCAGTCTAGAAAGAGCTGGG + Intronic
1020447380 7:8283444-8283466 CCCAAAGTGTGAAAATATCTGGG + Intergenic
1023457782 7:40360458-40360480 CCAACAGTGTGCCAAGCGCTGGG + Intronic
1023570208 7:41564016-41564038 CCCACAGTATTGGAAGTGCTAGG + Intergenic
1024443973 7:49454487-49454509 TCCACAGTGTGGAAAGGGACCGG - Intergenic
1024794881 7:53008548-53008570 CCCACAATGTGGCAAGTGTTGGG - Intergenic
1025195047 7:56926101-56926123 CCCCCAGTGAGGAGAGATCTCGG - Intergenic
1025676905 7:63650842-63650864 CCCCCAGTGAGGAGAGATCTCGG + Intergenic
1025912835 7:65841460-65841482 GCTACAGTGAGGCAAGAGCTGGG - Intergenic
1026029420 7:66776960-66776982 CCCTCAGTGTGGACAGGACTCGG - Intronic
1026236815 7:68534550-68534572 CCCACAGCGTGGAAGGAGACCGG + Intergenic
1029218514 7:98969766-98969788 GCCACTGTGTGGAAAGAGATGGG + Intronic
1030297722 7:107945649-107945671 CCCAAAGTGAGGAAAGAACTGGG - Intronic
1030940291 7:115638596-115638618 GCCACACGGTGGAAGGAGCTTGG - Intergenic
1032673827 7:134109840-134109862 CCCAAAGTGCTGAAAGTGCTGGG + Intergenic
1033507005 7:142013553-142013575 CCCATATTGTGGAAAGACATAGG + Intronic
1033717512 7:144018037-144018059 GCCACAGCGTGGAAAGACCAAGG + Intergenic
1036688666 8:10927770-10927792 CCCAGGGTGTGGGAAGAGCCAGG + Intronic
1037655722 8:20882668-20882690 CCCACTGTGTGGCAGGAGCGAGG + Intergenic
1038270789 8:26073897-26073919 GCCACAATGTGGAAACGGCTGGG - Intergenic
1039260953 8:35771247-35771269 CCCACAGTGAAGAGAGAGCTCGG + Intronic
1039498082 8:37996491-37996513 CCCAGAGCGTGGGAAGTGCTGGG - Intergenic
1039739248 8:40365813-40365835 CACACATTGTGGAAAGGGCAAGG + Intergenic
1041034514 8:53775340-53775362 CCCACAGTGTGGAAGGGGACCGG + Intronic
1042648504 8:71013453-71013475 CCCACAGTGGGGAAGATGCTGGG + Intergenic
1046519262 8:115303315-115303337 CAGAAAGTGTGGACAGAGCTTGG - Intergenic
1046886294 8:119371012-119371034 CTCAGAGAGTGGAAAGAGCAGGG + Intergenic
1047976551 8:130136244-130136266 CTCATAGTGTGTAAAGAGTTGGG - Intronic
1051665440 9:19463811-19463833 TCCACAGACTGGAAAGGGCTGGG + Intergenic
1053188599 9:36039853-36039875 CCCACACTGTAGAAAGAGCTAGG + Intronic
1053507912 9:38660577-38660599 TCCACAGGGTGGACAGAGGTTGG + Intergenic
1054783611 9:69189260-69189282 CCCAAGGGGTGGAAAGACCTAGG + Intronic
1055707426 9:79021263-79021285 CACACAGAGAGGAATGAGCTGGG + Intergenic
1055833441 9:80410261-80410283 CCCACAGTGTTGCTGGAGCTGGG + Intergenic
1056316110 9:85391753-85391775 CTCACAGTGTGAAAAGAAGTTGG - Intergenic
1056826535 9:89879922-89879944 CCCAGGGTGCGGACAGAGCTTGG - Intergenic
1057334558 9:94145728-94145750 CACACAATGTGGAAAGATATGGG + Intergenic
1057720595 9:97528751-97528773 CCCAGAGAGGGGAAAGAACTTGG + Intronic
1058972826 9:110098651-110098673 CTGACAGTTTGCAAAGAGCTTGG - Intronic
1060094419 9:120774915-120774937 CCCAGCGGGTGGAAAGAACTTGG - Intronic
1060531951 9:124352876-124352898 CTCACAGTGTGGAAAGCGGGTGG - Exonic
1061731209 9:132615509-132615531 CCCTCAGTGGGGTCAGAGCTAGG - Intronic
1062231465 9:135484334-135484356 CTCACAGAGTGGAGAGAGTTGGG - Intronic
1062663695 9:137654831-137654853 CCCACAGGGTGGTCAGAGTTTGG + Intronic
1187227973 X:17392240-17392262 GCCACCGTATGGAAAGAGCCTGG + Intronic
1189716304 X:43870328-43870350 CACACAGAGTGGTAAGAGATTGG + Intronic
1192152149 X:68719058-68719080 GCCCCAGGGTGGAAAAAGCTTGG - Intronic
1193131376 X:77923365-77923387 CCTAAAGAGTGGAAAGAGCATGG - Intronic
1195305146 X:103574520-103574542 ACCTCTGTGTGGAAAGATCTTGG - Intergenic
1195550150 X:106159890-106159912 CTCAGAGTGTGGCAAGAGCTAGG + Intergenic
1197639891 X:128955969-128955991 CTCACAGTGGGGATAGAGCAGGG - Intergenic
1198405155 X:136304975-136304997 CACACAGTATGTAAAGTGCTTGG - Exonic
1198897361 X:141470309-141470331 AACACAGTTTGGAAAGTGCTGGG - Intergenic
1201451651 Y:14121919-14121941 CTCACAGGGTGGAAGGAGCAAGG - Intergenic
1202380896 Y:24276126-24276148 GCCACAGTGGGGTGAGAGCTGGG + Intergenic
1202489888 Y:25393999-25394021 GCCACAGTGGGGTGAGAGCTGGG - Intergenic