ID: 1139513737

View in Genome Browser
Species Human (GRCh38)
Location 16:67441425-67441447
Sequence CTAGCTGGAGTCGCCGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139513737_1139513746 4 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513746 16:67441452-67441474 AGTCAGGCCCGGTGAGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 315
1139513737_1139513747 5 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513747 16:67441453-67441475 GTCAGGCCCGGTGAGGGCATGGG 0: 1
1: 0
2: 0
3: 22
4: 182
1139513737_1139513751 14 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513751 16:67441462-67441484 GGTGAGGGCATGGGTGAGGCTGG 0: 1
1: 0
2: 4
3: 108
4: 842
1139513737_1139513748 10 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513748 16:67441458-67441480 GCCCGGTGAGGGCATGGGTGAGG 0: 1
1: 0
2: 2
3: 25
4: 308
1139513737_1139513742 -7 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513742 16:67441441-67441463 CAGCTAGAACCAGTCAGGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 175
1139513737_1139513752 17 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513752 16:67441465-67441487 GAGGGCATGGGTGAGGCTGGCGG 0: 1
1: 0
2: 8
3: 116
4: 937
1139513737_1139513743 -2 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513743 16:67441446-67441468 AGAACCAGTCAGGCCCGGTGAGG 0: 1
1: 0
2: 3
3: 31
4: 257
1139513737_1139513744 -1 Left 1139513737 16:67441425-67441447 CCCTCGCCGGCGACTCCAGCTAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139513744 16:67441447-67441469 GAACCAGTCAGGCCCGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139513737 Original CRISPR CTAGCTGGAGTCGCCGGCGA GGG (reversed) Intronic
903070245 1:20723622-20723644 CTACCTGGAGATGCCAGCGAAGG + Exonic
903189345 1:21648094-21648116 CTAGCTGGAGCCGCTGTCCAAGG - Intronic
907913236 1:58845437-58845459 CTAACTGGAGTGGCCAGGGAAGG - Intergenic
912356510 1:109058409-109058431 CCAGCTGGAGTCACAGGCCAGGG + Intergenic
923993867 1:239469947-239469969 CTGGCTGGAGTCTCAGGTGAAGG + Intronic
1080515710 11:33017530-33017552 CTAGCTGCAGTGGACGGAGAGGG + Intronic
1084424910 11:69079296-69079318 CGGGCTGGAGTCGCTGGCCAGGG - Intronic
1092403315 12:8196447-8196469 CTATCTGGAGTGGCAGGAGAGGG - Intergenic
1102027344 12:109720954-109720976 CTGGCTGGAGTAGCCAGGGAGGG + Intronic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1114567186 14:23641361-23641383 CACGCTGGAGTCGCTGGAGAAGG - Intronic
1124506557 15:30281596-30281618 CTAGCTGGGGTCTCAGGTGAAGG + Intergenic
1124737000 15:32257040-32257062 CTAGCTGGGGTCTCAGGTGAAGG - Intergenic
1132146502 15:99432766-99432788 CTGGCTGGAGTGGCTGGGGAAGG + Intergenic
1139513737 16:67441425-67441447 CTAGCTGGAGTCGCCGGCGAGGG - Intronic
1140501012 16:75433438-75433460 CTAGCTGCCGTCGCCGCCGCCGG - Exonic
1141529096 16:84633838-84633860 GGAGCTGGAGTCGCGGGGGAGGG + Intergenic
1147971341 17:44220197-44220219 CTAGCAGGCTTCGCCGGCGAGGG + Intronic
1149495954 17:57117616-57117638 CTAGCTGGAGTCGGCTTAGAGGG + Intronic
1151977297 17:77490027-77490049 CTAGCTGGAGTCCCAGCCAAAGG - Intronic
1153316687 18:3729297-3729319 CGAGCTGGAGTCGCAGGCCGTGG - Exonic
1161342984 19:3752937-3752959 CTGGCTGTAGGCGGCGGCGAAGG + Exonic
1166190559 19:41173859-41173881 ATGGCAGGAGTGGCCGGCGATGG + Intergenic
927481431 2:23457110-23457132 CTAGCTCCAGTCCCCGGCGTCGG - Intronic
941666430 2:168247560-168247582 CTAGCTGGCTTCGGCGGGGACGG - Exonic
947748682 2:232522185-232522207 CCAGCTGGGGTCCCCGGCGCTGG + Intronic
961743141 3:129046421-129046443 CGAGCTGGAGTCGCGGGTGCAGG - Intergenic
969554898 4:7900580-7900602 CTACTTGGAGTCGCTGGCGTGGG - Intronic
974299263 4:60042480-60042502 CCAGCTGGAGCCGCCGGCCCAGG - Intergenic
984425176 4:179574064-179574086 CTAGCTGGGCTCACCGGTGAAGG + Intergenic
1000770109 5:165342303-165342325 CTGGCTGGGGTCGCCGTCGTGGG - Intergenic
1003142632 6:3484374-3484396 AGAGCTGGAGAGGCCGGCGATGG - Intergenic
1007108528 6:39299609-39299631 CCAGCTGGAGACGCCAGGGAGGG - Exonic
1021101770 7:16592457-16592479 CTAGCTGGAGACTCCACCGAAGG - Intergenic
1022285995 7:28956638-28956660 CTAGCTGGGGTGGCCTGGGATGG - Exonic
1029551685 7:101239999-101240021 CTACCTGGAGTCGCAGGGCAAGG + Intronic
1036865147 8:12389983-12390005 CTATCTGGAGTGGCAGGAGAGGG - Intergenic
1040038706 8:42896284-42896306 CTGTCCGGAGTCGCCGGCGACGG - Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1061517274 9:131097016-131097038 CTACCTGGAGTCGGAGGCGACGG - Intronic
1189652337 X:43203733-43203755 CAAGCTGGAATCGCCTGAGATGG - Intergenic
1193205961 X:78747687-78747709 CGAGCTGGAGCCGACGGCCAGGG - Intronic
1200123880 X:153804157-153804179 CAAGTTGGAGTTGCCGGCCATGG + Exonic