ID: 1139516280

View in Genome Browser
Species Human (GRCh38)
Location 16:67454169-67454191
Sequence CTGTGGGAGTGGAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 1, 1: 0, 2: 13, 3: 91, 4: 818}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139516273_1139516280 10 Left 1139516273 16:67454136-67454158 CCGAGGCACATGAAATACAAGAG 0: 1
1: 0
2: 0
3: 15
4: 266
Right 1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG 0: 1
1: 0
2: 13
3: 91
4: 818
1139516272_1139516280 11 Left 1139516272 16:67454135-67454157 CCCGAGGCACATGAAATACAAGA 0: 1
1: 0
2: 0
3: 22
4: 251
Right 1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG 0: 1
1: 0
2: 13
3: 91
4: 818
1139516271_1139516280 12 Left 1139516271 16:67454134-67454156 CCCCGAGGCACATGAAATACAAG 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG 0: 1
1: 0
2: 13
3: 91
4: 818
1139516270_1139516280 20 Left 1139516270 16:67454126-67454148 CCAACACACCCCGAGGCACATGA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG 0: 1
1: 0
2: 13
3: 91
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139516280 Original CRISPR CTGTGGGAGTGGAGTGGAGA GGG Intronic
900212351 1:1462345-1462367 CTGTGGGTGCTGAGTGGACAGGG + Intronic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
901032108 1:6313148-6313170 CTGGGGGACAGGGGTGGAGAAGG + Intronic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
901533531 1:9868075-9868097 CTGTGGACTGGGAGTGGAGAGGG - Intronic
901668449 1:10839629-10839651 CTGTGGGGTGGGAGTGGAGGTGG + Intergenic
901819623 1:11819297-11819319 CAGTGGGACTGGGCTGGAGAAGG + Intronic
901821750 1:11834790-11834812 CTGTGGGACTGCAGTGGGCAGGG + Intronic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902521866 1:17022802-17022824 CTCTGGGAGTGCAGAGGAAAGGG + Intronic
902578901 1:17396093-17396115 CTGTGGGAGTGGGCTGGGCATGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903917248 1:26773509-26773531 CTGGGGGAGTGGACAGGAGCTGG - Intronic
904618368 1:31761781-31761803 GATTAGGAGTGGAGTGGAGAGGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905322885 1:37130274-37130296 ATGTGGGAGTGGATTGGAGTGGG - Intergenic
905689843 1:39934933-39934955 GTGGGAGACTGGAGTGGAGATGG + Intergenic
906224027 1:44106239-44106261 AAGTGGGAGTGGAATGGAGATGG - Intergenic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
906492728 1:46280594-46280616 CTATGGGAGTGAGGTAGAGATGG - Intronic
906542677 1:46599973-46599995 TTGTGGGAGGGGAGAGGAGTTGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907437743 1:54460180-54460202 GGGAGGGAGTGGAGTGGACAAGG + Intergenic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
907518402 1:55007715-55007737 GGATGGGAGTGGAGTGGGGAGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908162354 1:61422795-61422817 ATGAGGGAGTGGGGTGGAGAGGG - Intronic
908360932 1:63367791-63367813 CCCTGGGAGTGGAGCGGAGCTGG - Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909561803 1:77016076-77016098 ATGAGGGGGAGGAGTGGAGAAGG - Intronic
911951547 1:104179343-104179365 GGCTGGGAGTGGAGTGGGGAGGG + Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912552417 1:110492714-110492736 CTGTGGGGGTGAAATGGAGCAGG + Intergenic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
912898724 1:113623820-113623842 CGGTGAGAGGGAAGTGGAGATGG - Intronic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913207383 1:116552831-116552853 ATGTGGGAGTAGAGTGGAGCTGG + Intronic
914492110 1:148158800-148158822 CTGGGGGAGTGGGGCGGGGAGGG - Intergenic
914934496 1:151966576-151966598 CTTGGGGAGAGGTGTGGAGATGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915288861 1:154869646-154869668 CGGTGGGAGAGGAGTGCAGCAGG + Exonic
915913401 1:159928057-159928079 GGGTGGGAGTGGAGCAGAGAAGG + Intronic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916585151 1:166143714-166143736 CTAAGGAAGTGGGGTGGAGAGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917650486 1:177071859-177071881 CTGAGAAAGTGGAGTGTAGAGGG + Intronic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917732665 1:177891740-177891762 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
917739948 1:177952404-177952426 CTGTGGGCTTGGCGTGGAGGAGG - Intronic
917797314 1:178541751-178541773 CTGTTGGCCTGGGGTGGAGAGGG + Intronic
918070527 1:181130758-181130780 CTGAAGGAGTGCAGTGGAGGAGG + Intergenic
919798589 1:201336976-201336998 CTGTCGGAGTGGAATGGCCAGGG + Intergenic
919798993 1:201339578-201339600 CTGGGGCAGTGGAGTGCAGTGGG - Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920245971 1:204587862-204587884 TGGTGGGAGTTGACTGGAGAAGG - Intergenic
920647974 1:207817126-207817148 GTGTGGGAGAAGAATGGAGAAGG + Intergenic
921194991 1:212747189-212747211 CTGTGGGAGAGGACTGCACAAGG - Intronic
921409093 1:214815353-214815375 CTGTGGGAGTGTAGTAGAAGTGG - Intergenic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922061962 1:222101367-222101389 CTGAAGGAGTGGAGCGGAGGTGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922796918 1:228344819-228344841 CTGTGGAAGTAGGGTGGAGCTGG - Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923219868 1:231883374-231883396 AAGTGGTAGTGGTGTGGAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923533805 1:234832565-234832587 CTGAGTGACTGGAGTGGAGCTGG - Intergenic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
923629397 1:235640004-235640026 CTGTGGGAGGGGAGCAGTGAGGG + Intronic
923978957 1:239298413-239298435 CAGGGGGACTGGAGTGGGGAGGG - Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924240073 1:242031901-242031923 AAGTGGGAGGGGAGTGGTGAGGG + Intergenic
924261916 1:242240330-242240352 TTGGGGGAGAGCAGTGGAGATGG - Intronic
1062928951 10:1339959-1339981 CTGGGGGTGGGCAGTGGAGAGGG + Intronic
1063374400 10:5545385-5545407 CTGTGTGTGTCCAGTGGAGAAGG + Intergenic
1063462338 10:6222653-6222675 GTGTGGGAGCGGAGTGGGGAGGG + Intronic
1063971499 10:11384350-11384372 CTGTGGCAAGGCAGTGGAGAAGG + Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065204548 10:23344335-23344357 CGGGAGGAGGGGAGTGGAGAGGG + Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1068460494 10:57322262-57322284 CTGTGGGAGGGGACCGGAGGGGG - Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069086862 10:64150669-64150691 CTATGGGAGTGGTGTGGAGATGG + Intergenic
1069346463 10:67476424-67476446 GTCTGGGAGTGGGGTGGAGAGGG - Intronic
1069688050 10:70331737-70331759 CGTTGGGAGTGGAATGGAGTGGG - Intronic
1070604873 10:77891672-77891694 CTGTGGGAGTGATGTGTAGCGGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070794348 10:79208084-79208106 TGGTGGGGGTGGAGTGGAGGTGG + Intronic
1070966204 10:80532827-80532849 CTCTGGCACTGGTGTGGAGAGGG - Exonic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1072156689 10:92730208-92730230 CTGGGGGAGTGGGGTGGGGGTGG + Intergenic
1072234138 10:93438652-93438674 CTGTGGGAGTAAAGTGGAGGAGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072967765 10:99989262-99989284 GACTTGGAGTGGAGTGGAGATGG + Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073125743 10:101147747-101147769 TTGAGGGAGTGAAGTGAAGATGG - Intergenic
1073330760 10:102668724-102668746 CTGTGGGCGTGGGTTGGGGAGGG + Intergenic
1074058883 10:109946827-109946849 GAGTGAGAGTGGAGTGGAGAAGG + Intronic
1074565479 10:114573677-114573699 GGGTGGGAGTGGACTAGAGATGG - Intronic
1075517174 10:123118360-123118382 CTGGTGGAGGGGAGTGGAGGAGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076294722 10:129375527-129375549 GTGAGGGAGTGGCCTGGAGAGGG - Intergenic
1076544016 10:131231850-131231872 ATGTGGGAGTCTGGTGGAGAGGG + Intronic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1077247926 11:1548152-1548174 CGGAGGGAGTGGGGTGGGGAGGG + Intergenic
1077281975 11:1749898-1749920 CTCTGGGAGTGAACTGGAGTGGG - Intronic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077504217 11:2922674-2922696 CTGTGTGGGTTGAGTGGAGTGGG + Intronic
1078170898 11:8928543-8928565 CTGTGGGAGGAGGGTGGAGGTGG - Intronic
1078637314 11:13064230-13064252 CAGTGGTAGGGGAGTGGAAAGGG - Intergenic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079279798 11:19076899-19076921 CTGGGGCAGGGGAGAGGAGATGG - Intergenic
1079627993 11:22638957-22638979 GTGAGGTAGTGGAGTGGAGTTGG - Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080685447 11:34511544-34511566 CTGTGGGAGTGAGGCAGAGATGG + Exonic
1080885796 11:36366916-36366938 CTGTGGGAGAAGGGAGGAGAAGG - Intronic
1081992974 11:47347538-47347560 GGATGGGAGTGGAGTGGGGAGGG + Intronic
1082960532 11:58914913-58914935 CTGTGGGAGTGCAGTGGATGTGG + Intronic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084662519 11:70554542-70554564 CTGGGGGAGGGGGGAGGAGAGGG - Intronic
1085024474 11:73228580-73228602 CAGTGGGAGGGGATTGGACATGG - Intronic
1085061427 11:73450659-73450681 TGGGGGGAGGGGAGTGGAGAAGG - Intronic
1085344505 11:75759358-75759380 CGGTGGGAGAGGAGTGGAGGCGG + Intergenic
1085682350 11:78588814-78588836 CTATGTCAGTGGAGTGGAGGTGG + Intergenic
1086371891 11:86163430-86163452 CTATGGGAGCAGAGTGGAGGAGG + Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086436169 11:86782885-86782907 CTTGGGGTGGGGAGTGGAGAAGG + Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086942669 11:92814703-92814725 CTGTTGGAGTGTAGGGGACAAGG + Intronic
1087207528 11:95412482-95412504 TTGGGGGAGTGGGGCGGAGATGG + Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088847079 11:113677680-113677702 CTCTGGGAGAGGCGTGGAGGAGG - Intergenic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089114815 11:116086160-116086182 CTGTGGAAGTGGACTTGAGTGGG + Intergenic
1089377800 11:118007097-118007119 GTGGGGGTGGGGAGTGGAGAAGG - Intergenic
1089458416 11:118639043-118639065 AAGTGGGAGGGGAGTGCAGAAGG + Intronic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1090234008 11:125133112-125133134 TTGGGGCAGTGGAGCGGAGATGG + Intergenic
1091034984 11:132224739-132224761 TAGTGGGAGTGGAGAAGAGAGGG + Intronic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092337951 12:7650513-7650535 TTGTGGGAGGTAAGTGGAGAAGG - Intronic
1093244192 12:16715155-16715177 GTGTGGGAGAGGAGTGGAGAGGG + Intergenic
1094058820 12:26292141-26292163 GAGTGGCAGTGGAGTGGAGTGGG - Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094660609 12:32466952-32466974 CTCTGGGAGTAGGGTGGTGAAGG - Intronic
1095169745 12:39020097-39020119 CTGTGGGCCTGGGGTGGTGATGG + Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095470676 12:42533844-42533866 GTGTGGGAGGGGAGTTGTGAGGG - Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095966517 12:47870736-47870758 CTGTGACAGTGCAGTGGAGATGG - Intronic
1096081680 12:48837486-48837508 GTGTGGGAGAGAAGTGAAGATGG + Intronic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096523143 12:52195269-52195291 GGGTGGGAGTGACGTGGAGAAGG - Intergenic
1096572379 12:52531103-52531125 TTCTTGGAGGGGAGTGGAGAGGG - Intergenic
1096760404 12:53836880-53836902 TGGTGGGATTGGGGTGGAGAGGG + Intergenic
1096765466 12:53885121-53885143 GGGTGGGAGTGGTGAGGAGAGGG + Intergenic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097268663 12:57760682-57760704 TTGAGGGAGTAGAGTGGATAGGG + Intergenic
1097500369 12:60393310-60393332 CAGGGCGAGTGGAGTGGTGAAGG - Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1099236972 12:80093584-80093606 CTGTTGGAGTGGAGTATATAGGG + Intergenic
1099243571 12:80167250-80167272 CCGTGGGAGTGGTGGGGAGGTGG + Intergenic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100794338 12:98164482-98164504 CTGGGGGAGGGGACTGGAGATGG - Intergenic
1101308641 12:103555878-103555900 GTGTGGAAGTGGAGTGGGGTGGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101371439 12:104135016-104135038 GGGTGGGAGTGGATTGGTGAAGG - Intronic
1101535595 12:105613546-105613568 CTGGGATAGTGGTGTGGAGAGGG - Intergenic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101911310 12:108862062-108862084 CTGATGGGGTGGAGTGGACAAGG + Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102676531 12:114663276-114663298 TGGTGGCAGTGGAGAGGAGAGGG + Intergenic
1102760479 12:115380627-115380649 ATGGGGGAGTGAAGTGGAGAAGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1104407069 12:128526715-128526737 AGGTGGGATTTGAGTGGAGAAGG + Intronic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104463031 12:128970387-128970409 GTCCGGGAGTGCAGTGGAGATGG - Intronic
1104601420 12:130156386-130156408 CTGGGGGAGTGGAATGGTGTCGG + Intergenic
1104647173 12:130505654-130505676 TAGTGGGAGGGGAGTGGAGGGGG - Intronic
1105210514 13:18254342-18254364 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105882303 13:24615465-24615487 GGGTGGAAGTGGAGTGGAGAGGG + Intergenic
1106934345 13:34701879-34701901 CCCTGTGAGTGAAGTGGAGAGGG - Intergenic
1107013680 13:35692197-35692219 CTGTGTGAGAGGGGAGGAGAAGG + Intergenic
1107158543 13:37198196-37198218 GCCTGGGGGTGGAGTGGAGAGGG + Intergenic
1107469055 13:40675023-40675045 CTGGGGAAGTAGGGTGGAGAAGG + Intergenic
1107534989 13:41320521-41320543 CTGGGGGAGGGGAATGGTGAGGG - Intronic
1108416876 13:50206550-50206572 CTGTAGGAATGGTGTTGAGAGGG + Intronic
1108514105 13:51181638-51181660 TGGTGGCAGTGGAGTGGGGAGGG - Intergenic
1108648289 13:52451385-52451407 GTGGGGGAGTGGAGTGGCGTGGG - Intergenic
1108682852 13:52794253-52794275 ATATTGGAGTGGAGGGGAGATGG - Intergenic
1109702968 13:66050444-66050466 ATGTGGGAGAAAAGTGGAGAGGG + Intergenic
1110362415 13:74642661-74642683 CTTTGTTAGTGGAGTGGAGTGGG + Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1111781497 13:92731960-92731982 TTGTGTGAGGGGAGTAGAGATGG + Intronic
1112094433 13:96116531-96116553 GTTTGGGAATGGAGTGGGGATGG - Intronic
1112260707 13:97875442-97875464 CTGGGAGAGTGGGGTGGAGCCGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115091532 14:29582845-29582867 CTGCAGGAGAGTAGTGGAGAGGG + Intronic
1116958150 14:50944554-50944576 CGGTGGGAGTGCAGCGGGGACGG - Exonic
1117160990 14:52989495-52989517 TTGTTGGAGGGGAGTGGGGATGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117568550 14:57021973-57021995 CTTTGGGAGTACAGTGCAGAAGG - Intergenic
1117799683 14:59430379-59430401 ATGTGGGAGGGAAGTGGAAATGG + Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118592288 14:67410732-67410754 CTTTGGGAGGGGAATGAAGAGGG - Intronic
1119192384 14:72691800-72691822 CTGTGCGAGCGGACAGGAGAAGG + Intronic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1119657322 14:76426252-76426274 GGGAGGGAGTGGAGTGGGGAAGG + Intronic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1120174255 14:81276785-81276807 CTGTGTGATGGGAGTGGTGATGG - Intronic
1120253905 14:82093516-82093538 CTGTGTGAGTTAAGTGGAGTAGG + Intergenic
1120671828 14:87371471-87371493 CTGTGTGAGTGGAGTCTTGAAGG + Intergenic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1121981666 14:98459926-98459948 ATGTGGGAGTGAAGTGGGGTAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122211837 14:100178565-100178587 CTGGGGAAGGGGAGTGGAGCAGG + Intergenic
1122226039 14:100280441-100280463 TTTTGGTAGTGGAGTTGAGAGGG + Exonic
1122463532 14:101915824-101915846 CTGGGGGAGTGTGCTGGAGATGG + Intronic
1122679933 14:103451895-103451917 CTGCGGGAGAGGAGAGGACACGG - Intronic
1122710424 14:103652821-103652843 CTTTGTTAGTGGAGTGGAGGTGG + Intronic
1124218149 15:27826425-27826447 CTGTGGGAGTGTAGTGGTTGAGG - Intronic
1124552366 15:30693382-30693404 CTGGGGTAGTGGTGTGGAGGTGG - Intronic
1124678873 15:31712284-31712306 CTGGGGTAGTGGTGTGGAGGTGG + Intronic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125686719 15:41567944-41567966 CTGTGAGAGGGGAGTGGTAAGGG + Intronic
1125968228 15:43891343-43891365 CTGTTAGATGGGAGTGGAGAAGG + Intronic
1126107398 15:45155705-45155727 CTTGGGCAGTGGAGTGGAGAGGG + Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127039919 15:54963276-54963298 CTGCGGGAGTGAGGTGCAGATGG - Intergenic
1127251951 15:57247979-57248001 CTGTGGGGGTGGGGTGGTGGGGG - Intronic
1127381640 15:58435474-58435496 GGGTGGGAGTGGGGTGGGGAGGG + Intronic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128056252 15:64702384-64702406 CTGGGAGAGGGGTGTGGAGAGGG + Intronic
1128072832 15:64807989-64808011 CTGCGGGGGAGGAGTGGAGATGG + Intergenic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128306709 15:66603705-66603727 CTCTGGGGGTGGGGTGGGGATGG + Intronic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1128817021 15:70617850-70617872 TGGTGGGAGTGGGGTGGAGTAGG - Intergenic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129506661 15:76087190-76087212 CTTTGGAAGTGGTGTGGAGAAGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130300473 15:82676644-82676666 TTGTGGGAGAGGAGTGAAGATGG + Intronic
1130715419 15:86329211-86329233 GCCTGGGAGTGAAGTGGAGAGGG - Intronic
1131096250 15:89655762-89655784 CTGTGTGAGTGGCGTGCAGGAGG - Intergenic
1131783066 15:95881090-95881112 GTGTGTGCGTGGAGTGGAGGGGG + Intergenic
1131983502 15:98018220-98018242 ATGTTGGAGAGGTGTGGAGAAGG - Intergenic
1132106072 15:99063708-99063730 CTGTGGAAGAGGACTGGAAAGGG - Intergenic
1132271816 15:100533022-100533044 GTGTGGAAGCGGAGTGGAGCGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133156873 16:3881455-3881477 CTGTGAGAGCGGGGTGGCGAGGG + Intergenic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1133928265 16:10211270-10211292 CTGAGGCACTGGAGTGGAGGAGG + Intergenic
1133978590 16:10617576-10617598 CTGTGAGAGTGTAGGGGTGAAGG - Intergenic
1134042825 16:11081312-11081334 AGATGGGAGTAGAGTGGAGAGGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1138350190 16:56342209-56342231 GTGTGGGCCTGGAGTGGGGAAGG + Intronic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138591511 16:58001648-58001670 GTCTGGGGGTGGAGTGGGGAGGG + Intronic
1138605833 16:58088231-58088253 GGGTGGGAGTGGGGTGGAGTAGG + Intergenic
1138684319 16:58711387-58711409 CCATGGGAATGGAGTGGAAAGGG - Intronic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139894159 16:70274732-70274754 GTGGGGGAGTGGAGTGGGGGTGG + Intronic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1141678277 16:85529175-85529197 GTGTGGGACTGGAGTGGGGGTGG + Intergenic
1141687334 16:85577821-85577843 CTGGAGGACTGGAGTGGAAAAGG - Intergenic
1141837804 16:86554111-86554133 ATGTGGAAGGGGATTGGAGAGGG - Intronic
1141871466 16:86789347-86789369 CTGAGAGAGTGAAGTGGAGTGGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1141979320 16:87540271-87540293 TTGGTGGAGAGGAGTGGAGAAGG - Intergenic
1142184384 16:88687440-88687462 CTGTGGGCCGGGGGTGGAGAAGG + Intergenic
1142188291 16:88705302-88705324 CTGAGGTGGTGGAGTGGAGGGGG - Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144159003 17:12538694-12538716 AGGTGGGAGTGGAGTGTGGATGG + Intergenic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1144754275 17:17669810-17669832 CTGTGGGATGGGGGTGGGGAGGG - Intergenic
1144885703 17:18458470-18458492 CTGAGGAATTGGAGTTGAGATGG + Intergenic
1144979349 17:19158948-19158970 ATGTGGAAGTGCAGAGGAGAAGG - Exonic
1144988873 17:19219284-19219306 ATGTGGAAGTGCAGAGGAGAAGG + Exonic
1145146510 17:20485901-20485923 CTGAGGAATTGGAGTTGAGATGG - Intergenic
1145187347 17:20806386-20806408 CTCTGAGAGCAGAGTGGAGATGG + Intergenic
1145191466 17:20844013-20844035 CTGCGGGAGGGGCGTGGAGCGGG - Intronic
1145320530 17:21764709-21764731 CTGTGGGAGGGGAATAGAGGTGG - Intergenic
1145707797 17:26938309-26938331 GAATGGGAGTGGAGTGGAGTGGG + Intergenic
1145973023 17:28968019-28968041 CTGTGGGAGGGGAGTTGACTTGG + Intronic
1146034193 17:29391110-29391132 ATGTGGGAGTGGGGTGGGGGAGG + Intronic
1146419934 17:32674157-32674179 GTGTGGGGGTGGAGTGGAAACGG + Intronic
1146667121 17:34712619-34712641 CTTAGGAAGTGGAGTGGAGCAGG - Intergenic
1146682165 17:34816212-34816234 CTGTTGCAGTGGGGTGGGGAGGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147137912 17:38444682-38444704 CTGAGGAGGTGCAGTGGAGAAGG + Intronic
1147317277 17:39626985-39627007 CTGAGGGAGGGAGGTGGAGAAGG + Exonic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1148150426 17:45393762-45393784 CTGTGGGAGGGAAGATGAGAGGG + Intergenic
1148877219 17:50696724-50696746 GTGAAGCAGTGGAGTGGAGAAGG - Intronic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1150308290 17:64105456-64105478 CTGTTGGAGTGGAGGTGTGATGG - Intronic
1150717493 17:67584211-67584233 GAGTGGGAGTGGAATGGAGTGGG - Intronic
1151215662 17:72575011-72575033 CTGGGGGAGGAGATTGGAGAGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1151596661 17:75082158-75082180 CTTTGGGGGTGGAATGGAGTGGG - Intergenic
1151843683 17:76636233-76636255 GTATGGGGGTGGGGTGGAGAGGG - Intronic
1151857793 17:76735771-76735793 CTGTGGGCGTGTATTGGAGCAGG - Exonic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1151972804 17:77467512-77467534 CGGTGGGAGGGGAGTGGAGTGGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1155375396 18:25151632-25151654 CTAAGGGAGTGGGGTGCAGAGGG - Intronic
1155380607 18:25218221-25218243 TTCTGGCAGTGGTGTGGAGATGG + Intronic
1155620788 18:27776927-27776949 GTTTGGGAGTGCAGTGGAGAAGG - Intergenic
1155749871 18:29408599-29408621 GGTTGGGAGTGGAGTGGAGGTGG - Intergenic
1156006780 18:32451588-32451610 TTGTGGGAATGTAGTGGAGCAGG - Intronic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156271846 18:35542393-35542415 CTGTGGCAGTGGGGTGGGGGTGG + Intergenic
1156676495 18:39532591-39532613 CTGTGGGAGTGGTTAGGACAAGG - Intergenic
1156866070 18:41890184-41890206 CTGTGGAAATGGACTGGAGTGGG - Intergenic
1157523229 18:48359793-48359815 CTCTGGGAGGGCAGTGCAGAAGG + Intronic
1157795534 18:50570924-50570946 GTGTGGGAGTGGGGTGGTGGCGG + Intronic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158843303 18:61411829-61411851 CTTTGGGACTTGGGTGGAGAGGG + Intronic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159415129 18:68137314-68137336 CTGTGGGGGTGTGGTGGACAAGG - Intergenic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1159783045 18:72681516-72681538 GAGTGGGAGAGAAGTGGAGAGGG - Intergenic
1159943429 18:74426176-74426198 CTGAGGGTGGGAAGTGGAGAGGG - Intergenic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1160353134 18:78201976-78201998 CTGAGGGAGTGGGGAGGAGGAGG - Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1161051363 19:2165386-2165408 CGGTGCGAGTGGATGGGAGAGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162087093 19:8255503-8255525 ATGTGGGCCTGCAGTGGAGAGGG + Intronic
1162323632 19:9985811-9985833 CTGGGGGTGGGGGGTGGAGATGG - Intronic
1163318360 19:16556797-16556819 CTCTTGGAGTGCAGTGGAGATGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1165186911 19:34030626-34030648 ATGGGGGTGGGGAGTGGAGAGGG + Intergenic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166747777 19:45149899-45149921 ATGGGGGAAGGGAGTGGAGAAGG + Exonic
1167106924 19:47435880-47435902 TTGTGGGAGGAAAGTGGAGAGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1167480236 19:49725868-49725890 ATGTGGGAGGGGAGTTAAGAAGG - Intergenic
1167516009 19:49923588-49923610 GTGTGGGAGCGCTGTGGAGATGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167721362 19:51182591-51182613 CTGTGGGAGCCCAGCGGAGAGGG - Intergenic
1167763614 19:51464179-51464201 CTGTGGGAGCCCAGCGGAGAGGG + Intergenic
1167784753 19:51627736-51627758 CTGTGGGAGGGCTGTGGGGAGGG + Exonic
1167849114 19:52188693-52188715 CTGAGGGAGTTGAATGGGGATGG - Intergenic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168272159 19:55255853-55255875 CTGTGGAAGCGGCGTGGAGCAGG - Intronic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925337356 2:3108134-3108156 AAGTGGAAGTGGAGCGGAGAGGG - Intergenic
925420145 2:3704368-3704390 GTGGGGGAGGGGTGTGGAGAGGG + Intronic
925420161 2:3704402-3704424 GTGGGGGAGGGGTGTGGAGAGGG + Intronic
925420172 2:3704427-3704449 GTGGGGGAGGGGTGTGGAGAGGG + Intronic
925420183 2:3704452-3704474 ATGGGGGAGGGGTGTGGAGAGGG + Intronic
925420234 2:3704566-3704588 ATGGGGGAGGGGTGTGGAGAGGG + Intronic
925420250 2:3704600-3704622 GTGGGGGAGGGGTGTGGAGAGGG + Intronic
925420261 2:3704625-3704647 GTGGGGGAGGGGTGTGGAGAGGG + Intronic
925420272 2:3704650-3704672 ATGGGGGAGGGGTGTGGAGAGGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926584540 2:14671911-14671933 CTGTAAGGGTGGAGTGGGGAAGG - Intergenic
926634526 2:15165661-15165683 CGGTGGGAGTGGGGTGGACAGGG + Intergenic
927240458 2:20916056-20916078 AGGTGGGTGTGGAGTGGGGAGGG + Intergenic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927927980 2:27026392-27026414 ATGTGGGAGTGGAGCAGGGAGGG - Exonic
928022585 2:27715930-27715952 GTGTGGGAGAGGAGTGGATCCGG - Intergenic
928292993 2:30056325-30056347 TTGTGGGAAGGGAGTAGAGAGGG - Intergenic
928404649 2:31005272-31005294 GTGGGGGTGGGGAGTGGAGATGG + Intronic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929745755 2:44656599-44656621 CTGTCATAGTGGAATGGAGAAGG - Intronic
930892195 2:56403481-56403503 ATGCAGGAGTGGAGTGGTGAGGG - Intergenic
931287605 2:60845830-60845852 CTGTGCCAATGGAGTGGAGAGGG - Intergenic
931463802 2:62469937-62469959 CCCTGGGACTGGAGTGGGGATGG - Intergenic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932416907 2:71579083-71579105 CAGGGGGTGTGGGGTGGAGAGGG - Intronic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
935202118 2:100866162-100866184 CTGTGGCAGAGGAGTTGAGGGGG + Intronic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935985407 2:108667723-108667745 AGGTGGGAGTGGGGTGGAGGGGG - Intronic
936137836 2:109911372-109911394 AGGTGGGAGTGGGGTGGAGGGGG - Intergenic
936206861 2:110460113-110460135 AGGTGGGAGTGGGGTGGAGGGGG + Intronic
936258579 2:110937502-110937524 GATTGGGAGTGGAGAGGAGAAGG - Intronic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937091468 2:119209252-119209274 CTGGGGGAGTGAAGTGGAGAAGG - Intergenic
937106943 2:119324717-119324739 CTGCAGGAGGGGAGTCGAGAGGG - Intronic
937399550 2:121570186-121570208 CTTTGGGAGTTGGGTGGGGAGGG - Intronic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937957071 2:127427493-127427515 GAGTGGGAGTGGAGAGGTGAAGG - Intronic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938661018 2:133487467-133487489 CTATGGTAGTGGCCTGGAGACGG - Intronic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
940122469 2:150282083-150282105 GTGTGGGCGTGGAGTGGATCAGG - Intergenic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
941647830 2:168060131-168060153 TTGTTGGAGTGGGGTGGAAAGGG - Intronic
942930625 2:181488354-181488376 CTTTAGGAGTGGAGTGCTGAGGG - Intronic
943033788 2:182716156-182716178 CTGCGGCGGTGGGGTGGAGAGGG - Intronic
943101871 2:183496627-183496649 TAGTGGAAGTGGAATGGAGATGG + Intergenic
943308636 2:186299098-186299120 CAGTGGGAGGGGAGTGGTCATGG + Intergenic
943445149 2:187975931-187975953 CTGGGGGAGTGAAGTGGTGGTGG + Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
944904319 2:204247278-204247300 TTATGGGAGTGGGGTGGGGAGGG + Intergenic
945208999 2:207363127-207363149 CTGTGGGGGTGAAGTGGGGAGGG - Intergenic
945495012 2:210499238-210499260 GCCTGGGAGTGGAGTGGAGAGGG + Intronic
945687744 2:212992823-212992845 CTATGGGAGTGGTCTGGAAATGG - Intergenic
945723507 2:213447617-213447639 CTGAGGGAGAGGAGTGGCGGTGG - Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947232512 2:227902424-227902446 CTGGGGGAGGGGAGTGGGAAGGG + Intronic
947286347 2:228519762-228519784 CTGTGGTGGTGGGGTGGAGGTGG - Intergenic
947498647 2:230656934-230656956 CAGTGGGAGTGGCCTGGAGGGGG + Intergenic
947911068 2:233801316-233801338 GGGTGGGGGTGGGGTGGAGAGGG + Intronic
947926384 2:233925831-233925853 CTTTGGGAGACGAGGGGAGAGGG + Intronic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948929440 2:241122700-241122722 CTGTGGGGGGGGAGTGGCGCCGG - Intronic
1169859049 20:10132604-10132626 CTGTGGGGGTGGTGTGGGGGAGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170898770 20:20439609-20439631 CTGGGGGAGTGGGCTGGGGAGGG + Intronic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1170944555 20:20879517-20879539 CTTTGGGAGGTGAGTGGAGCAGG + Intergenic
1171072364 20:22085554-22085576 CTGTGGGAGTGCAATAGGGAAGG - Intergenic
1171291657 20:23986032-23986054 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1171330377 20:24332193-24332215 ATGTGGGAGGGGAATGGTGATGG + Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172594807 20:36143368-36143390 CAGAGAGAGTGGAATGGAGAGGG + Intronic
1172656787 20:36542567-36542589 CTGTGGCAGTGGAGTGGGAAAGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173104741 20:40123268-40123290 CTGGGAGAGTGGATTGGACATGG - Intergenic
1173146039 20:40525146-40525168 CTAAGGAAGTGGAGTGGGGAGGG - Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173864026 20:46302903-46302925 TTGTGGGAGTGGAATGGACAGGG - Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174672858 20:52324144-52324166 CTGTGGGAGGGATGTGAAGACGG + Intergenic
1175237914 20:57526124-57526146 CTGGGGGAGGGGAATGGATAAGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176301137 21:5099576-5099598 CCCTGGGAGTGGAGAGGAAACGG + Intergenic
1177158930 21:17527310-17527332 GTGTGCTAGTGGAGTGGGGAAGG + Intronic
1177512965 21:22113999-22114021 CTGTGGGGGTTGGGTGGTGAGGG + Intergenic
1178487750 21:33029711-33029733 CTGGGGGAGGGTAGTGGAGATGG - Intergenic
1178815509 21:35925587-35925609 CTGGGTGAGGGGAGTGGTGAGGG - Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179442947 21:41408346-41408368 CTGAGGGAGTACAGTAGAGATGG - Exonic
1179855892 21:44162322-44162344 CCCTGGGAGTGGAGAGGAAACGG - Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1179921966 21:44512333-44512355 CTGTGGGGGTGGGGTGGGGTGGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180765741 22:18345061-18345083 GTGGGGGACTGGGGTGGAGAGGG + Intergenic
1180780569 22:18517317-18517339 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1180813288 22:18774638-18774660 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181199463 22:21208954-21208976 GTGGGGGACTGGGGTGGAGAGGG - Intronic
1181400293 22:22646903-22646925 ATGGGGGACTGGGGTGGAGAGGG + Intronic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181544215 22:23591925-23591947 CTGGGGGAGGGGTGTGGAGGGGG + Intergenic
1181649069 22:24248888-24248910 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181702271 22:24628001-24628023 GTGGGGGACTGGGGTGGAGAGGG + Intronic
1181719631 22:24763836-24763858 CTGTGGGAGCGGAGTCCAAAGGG - Intronic
1181783163 22:25207406-25207428 CTGTGGGAGAGGCGTGCTGAAGG + Intergenic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183034432 22:35130477-35130499 CTTTAGGGGTGGTGTGGAGAGGG + Intergenic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184368479 22:44067900-44067922 CCGTGGGAGTGGAGTGTTGGGGG + Intronic
1185143448 22:49116780-49116802 CTGTGGAAGAGGACTTGAGAAGG + Intergenic
1203227363 22_KI270731v1_random:85952-85974 GTGGGGGACTGGGGTGGAGAGGG + Intergenic
1203263390 22_KI270734v1_random:320-342 GTGGGGGACTGGGGTGGAGAGGG - Intergenic
949365156 3:3272599-3272621 CTGGGGGAGTGCAGAGGAGGGGG + Intergenic
949790603 3:7787846-7787868 GAGTTAGAGTGGAGTGGAGATGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950689546 3:14644775-14644797 CTGTGGGAGAGGGGTGGATGGGG + Intergenic
950709748 3:14805784-14805806 TTGTGGGGGTAGAGTGGGGAGGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951028401 3:17853920-17853942 TTGGGGGAGGGGAGTAGAGATGG - Intronic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
951193956 3:19803702-19803724 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
952064281 3:29549087-29549109 ATGTGAGGGTGGAATGGAGAGGG - Intronic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953976922 3:47389017-47389039 GTGGGGGAGTGGAGTGGGAATGG - Intronic
954132804 3:48568856-48568878 CTGTGGGAGTGACCAGGAGAGGG + Intronic
954485963 3:50851446-50851468 TCCTGGGCGTGGAGTGGAGAAGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
955758899 3:62256999-62257021 TTATGGGAGTGGAATGGGGAGGG + Intronic
955972117 3:64445795-64445817 CTGGGGTAGGGGAGTGGAGATGG + Intergenic
955982285 3:64539289-64539311 CAGTGGCTGTGGGGTGGAGAAGG + Exonic
956541528 3:70345119-70345141 CTGTGGTAATGGATTAGAGATGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957935594 3:86937541-86937563 CTTTTGGAGTGGATTGTAGATGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
959888500 3:111528453-111528475 CTGAGGGAGAGGAGTGGTGGTGG - Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960003844 3:112761880-112761902 CTGGGGTAGTGGAATGGAGTAGG - Intronic
960615080 3:119589143-119589165 CTGTGGGAGGAGTGAGGAGAAGG - Exonic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960844983 3:121996842-121996864 CTGTAAGAGTGGAGAGGGGATGG - Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961516407 3:127440205-127440227 ATGTGGGGGTGGGGTGGGGAAGG - Intergenic
961626313 3:128266319-128266341 CTGAGTGAGGGAAGTGGAGAGGG + Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961867749 3:129966395-129966417 CTGTGGGGCTGGCGTGGAGCTGG - Intergenic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964271697 3:154963738-154963760 CTTGGGGAGTGGGATGGAGAGGG - Intergenic
965298577 3:166979911-166979933 GGGTGGGGGTGGTGTGGAGATGG + Intergenic
965430029 3:168574855-168574877 CTGTGGAAGTAGATTTGAGAAGG + Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966847222 3:184140057-184140079 CTGTGGAAGGGAAGTGGAGTGGG - Intronic
967214480 3:187198931-187198953 CTGTGGGGGCTGAGTGGGGAGGG + Intronic
967390088 3:188947099-188947121 GTGTGGGAGTGGGGTGGGGGTGG + Intergenic
968282970 3:197490787-197490809 AAGTGGGATGGGAGTGGAGAGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968632983 4:1661727-1661749 CGGTGGGAGGGGAGTGGGCACGG - Intronic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
969167699 4:5331067-5331089 CTATGGGAGTGGAGGGGAAGGGG - Intronic
969178887 4:5422219-5422241 CAGTGGGAGTTTAGTGGGGAAGG + Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
969282108 4:6177743-6177765 CATTGGGGGTGGAGTGGAGGAGG - Intronic
969478599 4:7434979-7435001 CTGTGGGAGTGGCCAGGAGGTGG - Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
970110525 4:12632619-12632641 CTGTGAGAGTGGAGTTGTGGAGG - Intergenic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
971198839 4:24493639-24493661 CTGGGGGACTGCAGTGGAAAAGG + Intergenic
971324315 4:25631648-25631670 ATGTGGGATTGGATTGGAGGGGG + Intergenic
971324323 4:25631671-25631693 ATGTGGGATTGGATTGGAGGGGG + Intergenic
971721790 4:30255003-30255025 CTGTGGGATTGGAGTGGTAGAGG + Intergenic
972007043 4:34122563-34122585 AGGTGGGAGTGGTGTGGAGCAGG - Intergenic
972316947 4:37935619-37935641 CTGGTGGAGTGAATTGGAGAGGG - Intronic
972578901 4:40377752-40377774 CTGCGGGATTGGAGTAGAGGAGG - Intergenic
973033391 4:45373205-45373227 ATGTGGGAGTGGGGTGGTGGTGG - Intergenic
973628819 4:52799186-52799208 CTGTGCTACTGGAGAGGAGAAGG + Intergenic
973879367 4:55253829-55253851 TGGTGGGAGTGGGTTGGAGAGGG - Intergenic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
977482220 4:97593237-97593259 CTGTGGGAGAAGAGTGGGGGTGG - Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980091492 4:128447608-128447630 CTGAGGGGGTGGTGTGGAGGTGG + Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
980651873 4:135727192-135727214 CTGTGGTAGAGGCATGGAGATGG - Intergenic
981045485 4:140261319-140261341 CTGTTGGAGTGGTGGGGTGATGG - Intronic
981369339 4:143940876-143940898 TTGTGGGGGTGGAGTGGGGGAGG + Intergenic
981379079 4:144050818-144050840 TTGTGGGGGTGGAGTGGGGGAGG + Intergenic
981555791 4:145992012-145992034 AATTGGGAGTGGAGTGGGGAAGG - Intergenic
982093728 4:151901511-151901533 CTGGGGGAGAGGGGTAGAGATGG - Intergenic
982805946 4:159762648-159762670 ATTAGGGAGTGGAGTGGAGACGG - Intergenic
982829755 4:160044599-160044621 CTGTTGTACTGGAGTGGAGTAGG + Intergenic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
983474288 4:168195692-168195714 GTATGGGCATGGAGTGGAGAGGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985593327 5:776372-776394 CTGAGGGAGTGGAGGGGATCAGG + Intergenic
985763171 5:1762281-1762303 CTGTGGGAGGCGTGTTGAGAGGG - Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
986585517 5:9312968-9312990 TGGTGGGAGAGGAGTGGAGAGGG + Intronic
987050712 5:14144618-14144640 CTGTGTGGGTGGCGTGGAGGTGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
988334635 5:29890422-29890444 GTGGGGGAGTGGTGTGGAAATGG - Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
989942123 5:50163947-50163969 TTGGGTGAGTGGAGTGGGGAGGG + Intergenic
990957581 5:61359153-61359175 CAGTGGGAGTGGATCAGAGAGGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991493605 5:67207267-67207289 CTGTGTGGGTGCAGTGGAGCTGG + Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992158536 5:73978539-73978561 CCGTGGAAGTGGGGTGGAGATGG + Intergenic
992624685 5:78626494-78626516 CTGGGGGTGGGGCGTGGAGAGGG - Intronic
993170666 5:84415166-84415188 CTGGGAGAGGGGAGTGGAAATGG - Intergenic
993217838 5:85048592-85048614 GCCTGGGAGTGGAGTAGAGAAGG - Intergenic
994877848 5:105448443-105448465 TTGAGGGAGAGGAGTGGGGAGGG + Intergenic
996402079 5:123073521-123073543 TTATGGGATTGGAGTGGAGTGGG - Intergenic
996684953 5:126269777-126269799 CTGTGGGAGAGGAATGAAGGTGG + Intergenic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997387960 5:133488743-133488765 CTGTGGGATGGGAGTGGGTATGG + Intronic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
997870704 5:137502859-137502881 CTGTGGAAGTGGGGTGAAGTGGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
998050371 5:139027621-139027643 ATATGTGAGTGGAGTGGGGAAGG - Intronic
998137545 5:139682069-139682091 CTGTAGGATTGGCTTGGAGAAGG + Intronic
998150560 5:139754952-139754974 GTGTGTGTGTGCAGTGGAGAGGG + Intergenic
998205272 5:140153180-140153202 CTGGGGGAGGGGTGAGGAGATGG - Intergenic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
998883232 5:146666644-146666666 CTATGAAAGTGGAGAGGAGATGG - Intronic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
1000771585 5:165361638-165361660 CTTTGGGAGTGGGGTGAAGGTGG - Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001711804 5:173784773-173784795 CTGTGGGAGATGAGTAGAGATGG + Intergenic
1001803498 5:174563941-174563963 TTGTGGGACTGGAGTGGAGGTGG + Intergenic
1001963562 5:175894917-175894939 CTGTGGGAGTTGTGTGTTGAGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002318827 5:178362938-178362960 CTGTGGGAGTGGATTGCTGTGGG - Intronic
1002318854 5:178363018-178363040 CTGTGGGAGTGGATTGCTGTGGG - Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002321313 5:178377666-178377688 CCATGGGAGTGGCGTGGAGGTGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003322049 6:5060562-5060584 CTATGGGAGTGCTATGGAGATGG - Intergenic
1003564931 6:7214805-7214827 GTGTTGGTGGGGAGTGGAGAAGG - Intronic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004587032 6:17012603-17012625 CTGTGGGATCTGATTGGAGACGG + Intergenic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1005207400 6:23420625-23420647 GTCTAGGAGTGGAGTGGAGAGGG - Intergenic
1005280336 6:24267165-24267187 GTGAGGGTGAGGAGTGGAGATGG + Intronic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1005478671 6:26234156-26234178 AGGGGGGAGTGGGGTGGAGAGGG - Intergenic
1005790113 6:29291176-29291198 CTGTGAGAGTGGACTGGACAAGG - Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007293883 6:40806547-40806569 CTGCGGGAGAGGAGTGGCGAGGG + Intergenic
1007757555 6:44110113-44110135 CTGAGAGACTGGGGTGGAGAGGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008234337 6:49026030-49026052 GTCTGGAAGTGGAGTAGAGAGGG + Intergenic
1008800249 6:55359846-55359868 CTGTGGGAGTGGACTACATAAGG + Intronic
1008838672 6:55869956-55869978 GTGTGGGAGTGGTAAGGAGAGGG + Intronic
1009223211 6:61001987-61002009 GGGTGGGGGGGGAGTGGAGAGGG + Intergenic
1009699758 6:67161046-67161068 CTCTGGTAGGGGAGTGCAGAAGG + Intergenic
1009970054 6:70616173-70616195 GGGTGGGAGTGGAGTGGGGGTGG - Intergenic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010948388 6:82005645-82005667 GCTTGGGTGTGGAGTGGAGAGGG - Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1012263818 6:97117452-97117474 ATGGGGGAGAGGTGTGGAGAGGG - Intronic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012933962 6:105346234-105346256 CTTTGGGCGTAGAGTGGAAAAGG - Intronic
1013998344 6:116335969-116335991 CTGTGGGAGTCTGGTGCAGAAGG + Intronic
1014561485 6:122896240-122896262 TTGTGGGGCTGGAGTGGGGAAGG + Intergenic
1015635434 6:135269844-135269866 CTCTGGGAGTTGAGTGTAGTGGG + Intergenic
1016291916 6:142536529-142536551 CTTTGGGACTGGACTTGAGAGGG - Intergenic
1016376862 6:143430222-143430244 GTGTGCGAGTGGAGTGGAGGGGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017878146 6:158540855-158540877 CTGCGGGAGAGGAGTCGAGGAGG - Intronic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018531514 6:164768837-164768859 GGGTGGGAGAGGAGTGGAGGGGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019125963 6:169840240-169840262 GAGTGGGAGTGGTGTGGAGTGGG - Intergenic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1020076587 7:5262753-5262775 CTGTGGTGGTGGGGTGGAGGGGG - Intergenic
1020154429 7:5710724-5710746 GGGTGGGAGTGGAGTGGAGATGG - Intronic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020356305 7:7279450-7279472 TGGTGGGAATGGAGTGGAGGAGG + Intergenic
1020475087 7:8584702-8584724 CTGGGGGATCGGAATGGAGATGG + Intronic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021189379 7:17602609-17602631 GCCTGGGAGTAGAGTGGAGAGGG - Intergenic
1021697150 7:23286420-23286442 GTTGGAGAGTGGAGTGGAGAGGG - Intergenic
1021840308 7:24717058-24717080 CTGGGGGAGGGGTGTGGTGAGGG - Intronic
1022145384 7:27533455-27533477 CAGGGGGAGGGAAGTGGAGAGGG - Intronic
1022405872 7:30089341-30089363 CTGTGGGGGTGGTCTGGAGTGGG - Intronic
1022937658 7:35196408-35196430 CTGTGGGAGTGCATTGGAATTGG + Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023277714 7:38538431-38538453 GTGTGGAACTGGAGTGGACAAGG + Intronic
1023834325 7:44059478-44059500 CTGGGGGACAGCAGTGGAGAAGG + Intronic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024097140 7:45991260-45991282 CTGAGGGAGAGGAGAGGAGGGGG + Intergenic
1025023688 7:55498988-55499010 GCGTGGGGGTGGAGTGGGGAGGG - Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025940400 7:66072739-66072761 CTGTGGGAGAAGACAGGAGAGGG + Intergenic
1026125613 7:67577113-67577135 ATATGGGAGTGGAGTGGGGCAGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1028372470 7:90109188-90109210 CTGTGGGAGTGCATTGGAATTGG - Intergenic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1028835105 7:95366026-95366048 CAGGGGGAGTGGGGTGGGGAGGG + Intronic
1029084505 7:98000693-98000715 AGGTGGGAGGGGACTGGAGAAGG + Intergenic
1029123849 7:98284477-98284499 CTCTGCGAGGAGAGTGGAGACGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030654168 7:112147995-112148017 CAGTGGGAGTGTGGAGGAGAGGG - Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032978603 7:137254446-137254468 CTTTGGGAGTGGCATAGAGAAGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033483161 7:141761545-141761567 ATGTGGGAGCAGAGTTGAGAGGG + Intronic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034071764 7:148193263-148193285 TGTGGGGAGTGGAGTGGAGATGG - Intronic
1034289859 7:149921263-149921285 CTGTGGGAGAAGAGTCCAGAAGG - Intergenic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034449963 7:151132030-151132052 CTGTGGGATGCAAGTGGAGAGGG + Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035286883 7:157812359-157812381 CAAAGGGAGTGGAGTGGAAAGGG - Intronic
1035291217 7:157840540-157840562 GTGTGGGAGTGGAGAGGGTACGG + Intronic
1036416006 8:8549189-8549211 GTGAGGGAGTGGGGTGGAGGAGG + Intergenic
1037392039 8:18403430-18403452 CTATGGGAGGAGTGTGGAGAAGG - Intergenic
1037561207 8:20076117-20076139 CAGTGTGAGTGGAGTGGATGAGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037836884 8:22219882-22219904 CTTGGGGAGAGGTGTGGAGAAGG - Exonic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1038533824 8:28339590-28339612 GTGTGTGTGTGGAGTGGGGAGGG - Intronic
1039273793 8:35912600-35912622 TTATGGGAGTGGGGTGGAGGTGG + Intergenic
1039440921 8:37594955-37594977 CATTGGGAGGGGCGTGGAGACGG - Intergenic
1040914190 8:52552396-52552418 CTGGGGGACTGGGGTGGGGAAGG - Intronic
1041023873 8:53664983-53665005 CTGTGGGGGTGGGGTGGGGTAGG - Intergenic
1041207322 8:55511943-55511965 GAGGGGGAGTGGAGTGGGGAGGG + Intronic
1041552855 8:59119831-59119853 CGGTGGGAGTGGGGTGGGGCCGG - Intergenic
1042128054 8:65558781-65558803 TGGTGGGAGTGGATTGCAGAAGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043214981 8:77574355-77574377 CTGTGGGCCTGGGGTGGAGGTGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045432214 8:102124394-102124416 CTGCGGGGCTGCAGTGGAGAGGG - Intronic
1045727090 8:105186419-105186441 GCCTGGGGGTGGAGTGGAGATGG + Intronic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046926581 8:119796290-119796312 TTGCTGGAGTGGAGAGGAGAGGG - Intronic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1048251431 8:132869585-132869607 GGGAGAGAGTGGAGTGGAGAAGG - Intronic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1048853750 8:138669157-138669179 CTGTGGCTGCGGAGTGGCGAAGG + Intronic
1049161593 8:141101684-141101706 CAGTGGGAGGGCAGTGGGGAAGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049463230 8:142739659-142739681 CTTTGGGAGCGCAGTGGTGAAGG - Intergenic
1049543205 8:143217984-143218006 GTGTGGGGGTGGTGTGGGGATGG - Intergenic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1050179523 9:2905205-2905227 GGGTGGGAGTGGTCTGGAGAAGG + Intergenic
1050584556 9:7097070-7097092 ATGTGGGAGTGGGATGAAGAAGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051512383 9:17892798-17892820 ATGTGGGAGTGGGGAGGTGATGG - Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052590696 9:30490173-30490195 CTGTACTACTGGAGTGGAGAGGG - Intergenic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053334141 9:37249092-37249114 ATGTGGGAGAGGTGGGGAGATGG + Intronic
1054849423 9:69831560-69831582 CTGTGAGATAGGAGTGGGGAGGG + Intronic
1055818292 9:80232557-80232579 GCCTTGGAGTGGAGTGGAGAGGG + Intergenic
1057014364 9:91638086-91638108 CTGTGGAATTAGAGTTGAGATGG + Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058472185 9:105291504-105291526 CTGTGGGATTGTTTTGGAGATGG + Intronic
1058775055 9:108274711-108274733 CACTGGGAGTGGAGTAGGGAGGG - Intergenic
1058961232 9:109994713-109994735 CTGTGGGTGTGGGGTGGCGGAGG - Intronic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059122494 9:111654686-111654708 CTGTTGGAGGAGTGTGGAGAAGG + Intronic
1059242215 9:112816255-112816277 CTGTGCGGGTGGTGTGGGGATGG + Intronic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059585459 9:115601308-115601330 CTGTGAGAATGGACTGGAGTAGG + Intergenic
1059651230 9:116318206-116318228 CTGAGGGAGGGGCTTGGAGAAGG - Intronic
1060474865 9:123979146-123979168 TGGTTGGAGTGAAGTGGAGAGGG + Intergenic
1061204691 9:129156191-129156213 CTGTGGGAATGTCGTGGACAGGG + Intergenic
1061401966 9:130373393-130373415 TTGTGGGAGCCCAGTGGAGATGG - Intronic
1061875625 9:133542179-133542201 CAGTGGGAGGGCACTGGAGAGGG + Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062169972 9:135129385-135129407 CTGGGGCAGTGGGGTGGGGATGG + Intergenic
1062628919 9:137454971-137454993 CTGTGTGATTGGAGTGGGGGAGG + Intronic
1185621587 X:1453704-1453726 CGGTGCGAGTGGCGTGGGGATGG + Intronic
1185621599 X:1453742-1453764 TGGTGGGAGGGGAGTGGAGATGG + Intronic
1185621614 X:1453780-1453802 TGGTGGGAGGGGCGTGGAGATGG + Intergenic
1185621629 X:1453818-1453840 TGGTGGGAGGGGCGTGGAGATGG + Intergenic
1185621644 X:1453856-1453878 TGGTGGGAGGGGCGTGGAGATGG + Intergenic
1185621659 X:1453894-1453916 TGGTGGGAGGGGCGTGGAGATGG + Intergenic
1185621674 X:1453932-1453954 TGGTGGGAGGGGCGTGGAGATGG + Intergenic
1185621689 X:1453970-1453992 TGGTGGGAGGGGCGTGGAGATGG + Intergenic
1185621756 X:1454131-1454153 TGGTGGGAGGGGCGTGGAGAAGG + Intergenic
1185631094 X:1516286-1516308 TTGTGGGAGAGGGGTGAAGAAGG - Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1187277655 X:17830063-17830085 ATGTGCGAGGGAAGTGGAGAGGG - Intronic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1187471530 X:19574015-19574037 GGGTGGGCTTGGAGTGGAGATGG + Intronic
1187484105 X:19685828-19685850 CTGAGGGAGGGGAGTGGTGATGG - Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188784756 X:34332066-34332088 CTGTGTGTGTTTAGTGGAGATGG - Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1188990405 X:36812042-36812064 ATGTAGGTGTGGAGTGGAAAGGG - Intergenic
1189776484 X:44474484-44474506 CTGTGGGAGTAGAGTGTGGCTGG + Intergenic
1189957391 X:46289139-46289161 CAGTGGGTGTGGACTGGTGATGG + Intergenic
1190184810 X:48224283-48224305 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190197382 X:48331144-48331166 CAGGGGGAGAGGAGAGGAGAGGG + Intergenic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1190404044 X:50068461-50068483 GGGTGGGGGTGGAGTGGAAAAGG - Intronic
1190664123 X:52681554-52681576 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190675299 X:52776868-52776890 CAGGGGGAGAGGAGAGGAGAGGG - Intronic
1190789559 X:53686369-53686391 CTGGGGGAGGGGAGAGGAGGCGG + Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192083990 X:68077002-68077024 GTGTGGGAGTGGCCTGGAGAGGG + Intronic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1192990561 X:76450640-76450662 GTGTGGGAGGGGAGTGGGGGTGG - Intergenic
1194476770 X:94368645-94368667 GTGTGGTAGTGTGGTGGAGAGGG + Intergenic
1195093427 X:101485297-101485319 CTGTGCGTGCGGAGTGGAGGAGG + Intronic
1195201056 X:102550311-102550333 CTTTGGGAGTAGAGTGGGAACGG - Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195660278 X:107371183-107371205 GTGTGCGTGTGGAGTGGGGAGGG - Intergenic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1196791627 X:119469256-119469278 CTCTGGGAGCGGAGTGGGGGCGG + Intronic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1197554984 X:127942084-127942106 CTGTGGGTGGGGAGTGGTGGGGG - Intergenic
1197616530 X:128698291-128698313 CTTTGGGAGAGGAGTGGGTAAGG - Intergenic
1197728598 X:129792601-129792623 TTGGGGGAGAGGAGAGGAGAAGG - Intronic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198086645 X:133288579-133288601 CTGTGGGAGTTGAATTGAGCTGG + Intergenic
1198156057 X:133961906-133961928 CTCTGGGACTTGGGTGGAGAAGG - Intronic
1198715937 X:139558080-139558102 CTGGGGGAGGGGAGTGGCAATGG - Intronic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200084248 X:153595571-153595593 CTGTGGGTGTGGCGTGGGCATGG - Intronic
1200860761 Y:7989266-7989288 CTGTGTGTGTGTAGTGGGGATGG - Intergenic
1201229757 Y:11852773-11852795 CTGTGGGAATGGACTGTTGAAGG - Intergenic