ID: 1139528155

View in Genome Browser
Species Human (GRCh38)
Location 16:67528989-67529011
Sequence CGGCGCCGCCCGGTGGGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139528140_1139528155 18 Left 1139528140 16:67528948-67528970 CCGGGCGGGGAGCAGGCGCGGAG 0: 1
1: 0
2: 2
3: 46
4: 322
Right 1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139528155 Original CRISPR CGGCGCCGCCCGGTGGGTCC GGG Intronic
900088679 1:909987-910009 CGGCGCGGCCGGGCTGGTCCTGG + Intergenic
900475797 1:2875817-2875839 CTGGGCCTCCCAGTGGGTCCTGG + Intergenic
901065097 1:6490652-6490674 CGGCGCCGCCCGGCTGGGACCGG + Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
902677581 1:18019528-18019550 CGGTGCCATCCTGTGGGTCCTGG + Intergenic
903280789 1:22248781-22248803 AGCAGCAGCCCGGTGGGTCCTGG - Intergenic
905685175 1:39902346-39902368 CGGCGCACCCCGCTGGGTTCAGG + Intergenic
906214262 1:44030177-44030199 CGGCACCGCCCGCAGCGTCCCGG + Intronic
906321506 1:44820310-44820332 CGGCGCCGCCCACGGGGTGCGGG - Intronic
906525286 1:46489992-46490014 CTGATCCGCCCAGTGGGTCCGGG - Intergenic
907258317 1:53196977-53196999 CGGGGCCCCGCGGTTGGTCCGGG + Exonic
913209449 1:116570855-116570877 CCGCGCCGGCCGGCGGGTACTGG - Intronic
1062860785 10:807631-807653 CAGGGCCGCCCGGTGGGGTCAGG - Exonic
1062901090 10:1147585-1147607 CAGCGCTGCCTGGTGGGCCCTGG + Intergenic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064443047 10:15370864-15370886 CGGCGGCGGCGGGAGGGTCCCGG - Intronic
1067436931 10:46284901-46284923 CGCCGCCGCCCTCTGGCTCCTGG + Intergenic
1067484568 10:46635630-46635652 CGCCGCCGCGCGGTCGGTTCCGG - Intergenic
1067610191 10:47706017-47706039 CGCCGCCGCGCGGTCGGTTCCGG + Intergenic
1069024213 10:63521935-63521957 CGGCACCGCCCTGCGGGCCCGGG + Intronic
1073122541 10:101131513-101131535 CCGGGCCCCCCGGTGGGGCCAGG + Exonic
1078326125 11:10382652-10382674 CGGCTCCTCCCGGTGAGTCTCGG + Intronic
1083432647 11:62622187-62622209 CGTCACCACCCGGTGGTTCCCGG - Intergenic
1084154055 11:67303969-67303991 CGGGGCCTCCCGGTGGGGCGTGG + Intronic
1084225363 11:67711783-67711805 AGGCGCCGCCCGCGGGGCCCAGG - Intergenic
1084263180 11:67991630-67991652 AGGCGCCGCCCGCAGGGCCCAGG - Exonic
1084810218 11:71607491-71607513 AGGCGCCGCCCGCGGGGACCAGG + Intergenic
1086080837 11:82901077-82901099 CGTCGCAGACCGCTGGGTCCAGG + Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091613981 12:2035148-2035170 CGGCGCCCCGCGGAGGGCCCGGG - Intronic
1096413175 12:51391626-51391648 CCGCGCCGCGGGGTGGCTCCCGG + Intronic
1096622684 12:52874327-52874349 CGGCGCCGCCCTGGGGCCCCCGG - Intergenic
1098288503 12:68933171-68933193 CGCGGCCGCCCGGCGGGGCCGGG + Exonic
1103856449 12:123973524-123973546 CCGCGCAGCCTGGCGGGTCCCGG + Exonic
1106157351 13:27171363-27171385 GGGCGCCGCCTGGTGGGCCAGGG - Intronic
1106809978 13:33350088-33350110 CCGCGCCTCCCGGTGGGTGTGGG - Intronic
1112507029 13:99981543-99981565 CGGCGCTGCTCGGTGCGGCCGGG + Intergenic
1113846382 13:113394045-113394067 CGGCGGCTCCCGGCGGCTCCCGG + Intergenic
1116862157 14:50003428-50003450 AGGCGCCGCCGGGTGGGCCGCGG + Intronic
1117424473 14:55580413-55580435 CGGCGCCGGCCGCGGGGTCCTGG + Intronic
1118841906 14:69519805-69519827 TGGAGCCTCCAGGTGGGTCCAGG + Intronic
1121595245 14:95157304-95157326 CGGCGGCGCCGGGCGGCTCCGGG - Intronic
1121645882 14:95516732-95516754 CGGGGCCACCGGGCGGGTCCCGG - Intronic
1122151875 14:99730171-99730193 CGGCGCCGCCCGCTCGGCCTGGG - Intergenic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1122975411 14:105168834-105168856 CCGCGCCGCGGGGTGGGGCCGGG + Intergenic
1123041008 14:105490244-105490266 AGGCGCAGCCCGAGGGGTCCCGG - Intronic
1128078164 15:64841370-64841392 CGGCCCCGCCCAGAGGTTCCAGG + Intergenic
1129150367 15:73684449-73684471 CGGCGCGGCGCGGTGAGTGCTGG + Exonic
1129387283 15:75202842-75202864 CGGCGCCGCCGGGAGGGGCTTGG + Intronic
1130564234 15:84980986-84981008 GGGCGCCGCGCGCCGGGTCCCGG - Intronic
1132573676 16:655243-655265 CTGCGTCTCCCGGTGGGTCAGGG + Intronic
1132970060 16:2682813-2682835 CGGGCCAGCCCGGAGGGTCCTGG + Intronic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1134149692 16:11796577-11796599 GGGCGCCGCCCGGGAGGACCGGG - Intronic
1134644418 16:15854973-15854995 CACCGCAGCCCGGTTGGTCCTGG - Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136573047 16:31108353-31108375 CGGCAGCGCCCGCTGGGTCCTGG - Intronic
1138252108 16:55509331-55509353 CGGCTCCGCGAGGCGGGTCCAGG + Exonic
1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG + Intronic
1139664940 16:68448633-68448655 CGGCCCCGCCCGCAGGTTCCTGG + Exonic
1141482018 16:84313142-84313164 CGCCCCCGCCAGGTAGGTCCTGG + Exonic
1141727562 16:85799775-85799797 CGGCGCCGCCAGGCCGGGCCGGG + Exonic
1142055970 16:87996256-87996278 CTGAGACGCCAGGTGGGTCCCGG - Intronic
1142213062 16:88817542-88817564 CGGCACTGCCCGGTGGGTCCCGG - Intronic
1143639880 17:8189847-8189869 CGGCGCCCCCCTGCGGCTCCCGG + Exonic
1144519595 17:15945081-15945103 GGGCCCCGACCCGTGGGTCCCGG + Exonic
1146012122 17:29204519-29204541 CGGCCCCGGCCGGCGGCTCCAGG + Intergenic
1148755967 17:49973096-49973118 GGGCGCCGCTCGGAGGGTTCCGG - Exonic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1151749141 17:76027016-76027038 CGCCGCCGCCAGGTGGCTCAAGG + Intronic
1152049175 17:77959046-77959068 CGGCGCGTCCCGGCAGGTCCAGG - Intergenic
1152357028 17:79812494-79812516 CGGCCCGGCCCGCTGGGGCCTGG + Intergenic
1152924278 17:83080218-83080240 CAGCGCGGCCGGGTGGGTCCCGG + Intronic
1153636518 18:7117729-7117751 CGCCGCCACTCGGTGGGTCTGGG + Exonic
1156253823 18:35376958-35376980 CGGCGCGGCGCGGTGGGCGCGGG - Intronic
1158137583 18:54224181-54224203 CGGCGCCCCCCGGCGGGAGCCGG - Exonic
1160512116 18:79458474-79458496 CGGCTCCGGGCGGCGGGTCCTGG + Intronic
1160544288 18:79642316-79642338 AGGCCCCGCCCCGTGGGTTCTGG - Intergenic
1160691433 19:462048-462070 CGGCGCCGCCCGCGGGGCCGGGG + Intergenic
1160791607 19:926073-926095 CGGCACAGCCCCGTGGGTCGGGG + Intronic
1160808919 19:1004623-1004645 CCGGGGCGCCCCGTGGGTCCCGG - Exonic
1161063728 19:2227620-2227642 CGGCGCCGCCAGGCGTGTGCGGG - Intronic
1161072672 19:2270450-2270472 CGGCCTCGCCCGGCGCGTCCCGG - Intronic
1161072886 19:2271150-2271172 CGGCGCCGCCCGAGGAGTCGGGG + Intronic
1161473445 19:4472585-4472607 CGGCCCCGCCCTGGGGGTCTGGG + Intronic
1161977054 19:7612764-7612786 CAGCCCCGCCCGGCGAGTCCCGG + Exonic
1162741773 19:12777727-12777749 CCGCGCCCCCTGGTGGGCCCGGG - Intronic
1163012280 19:14433566-14433588 CGGCGCCGTCCGGTCGCCCCGGG - Intronic
1164595871 19:29530348-29530370 CGGAGCCCCCCGGGGCGTCCCGG - Intronic
1168459091 19:56538885-56538907 CGGCGCGGCCCAGTGGATGCCGG + Intergenic
927920776 2:26970709-26970731 CGGCTCCGGCCGGCGGCTCCGGG - Exonic
935149071 2:100417522-100417544 CGCCGCGGCCCGTCGGGTCCCGG + Exonic
936525157 2:113236463-113236485 CCGGGCCGCCAGGTGGGCCCAGG - Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942277869 2:174335988-174336010 CGGCTGCTCCCGGGGGGTCCTGG - Intronic
942314048 2:174682437-174682459 CGGGGCCGCCCCGTGGGGCTCGG - Intronic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1168750775 20:279487-279509 CTGCGCCGCCCGGGAGCTCCGGG + Intronic
1168878165 20:1185288-1185310 CGGCGCAGCCCGGAGGGCGCGGG + Intronic
1173606605 20:44336330-44336352 CTGCGCCGCCAGGTGGGCCAGGG + Intergenic
1176090976 20:63318513-63318535 TGGCACCGCCCAGTGGGTCCTGG - Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1176261908 20:64186270-64186292 CAGCGCCGCCCTCTGGGTGCCGG + Intronic
1179495046 21:41766428-41766450 CGCAGCGCCCCGGTGGGTCCCGG + Intronic
1179605585 21:42513683-42513705 CGCCCCCGCCCGGTGGCCCCGGG + Intronic
1184545593 22:45164696-45164718 CGCCGCAGCCCGGTGGGGCCCGG - Intronic
1184557382 22:45240730-45240752 CGGCGCCGCCCGCAGGCTCGGGG + Intronic
1184673383 22:46027468-46027490 CTGCGCCGCCCGGCGTGTCCGGG - Intergenic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1184976473 22:48065972-48065994 CTCCGCTGCCCGGTGGCTCCTGG + Intergenic
1185055214 22:48575720-48575742 CGGCACCGTCCGGTGGGGACCGG + Intronic
1185232734 22:49692832-49692854 CTGCACAGCCAGGTGGGTCCAGG + Intergenic
1185250415 22:49798885-49798907 GGGCTGCACCCGGTGGGTCCTGG - Intronic
1185313859 22:50170531-50170553 CGGAGCCCCCCGCTCGGTCCCGG + Intergenic
1185329265 22:50244900-50244922 GGGCTCAGCCGGGTGGGTCCCGG + Intronic
950291843 3:11791076-11791098 TGGGGCCACCCTGTGGGTCCAGG - Intronic
964622612 3:158732293-158732315 TGGCGGCGCCCGCGGGGTCCGGG - Exonic
967859604 3:194141297-194141319 CGGGGCGGCCCGGGGGTTCCAGG + Intergenic
968582976 4:1403489-1403511 CTGCACCTCCCGGTGGGCCCTGG + Exonic
968959078 4:3733864-3733886 CAGCACTGCCCGGTGGCTCCAGG - Intergenic
969732166 4:8963875-8963897 AGGCGCCGCCCGCGGGGCCCAGG + Intergenic
970456336 4:16226956-16226978 CGGCGCCGCCCGCCAGGTCTTGG + Intronic
973996829 4:56467300-56467322 CGGCCCCGCACCGTGGGACCAGG + Exonic
978741780 4:112145512-112145534 CGGCGCTGCCTGGTGCGTCGCGG + Exonic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
989571619 5:42951188-42951210 CGCCGCCGCCCGGTAACTCCAGG + Intergenic
991216896 5:64165993-64166015 CGGCGCCTCTCGGAGGGACCTGG + Intronic
992812965 5:80408015-80408037 CTGCGCTGCCCGGTGGGGCGGGG + Exonic
1002098041 5:176843718-176843740 GGGCGCAGCCCGGTGGGTCAGGG - Intronic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1006259219 6:32854116-32854138 CGGCGCCGCCAGGAGGCGCCTGG - Intronic
1006916851 6:37600281-37600303 CAGCCCCACCAGGTGGGTCCTGG - Intergenic
1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG + Intergenic
1011762822 6:90586890-90586912 TCGCGGCGCCCGGTGGGGCCGGG + Exonic
1016439005 6:144064529-144064551 CAGCTCCGGCCGGCGGGTCCGGG + Intronic
1018727890 6:166627482-166627504 CAGCGCCGCCCTGTGGTTCCAGG + Intronic
1018942660 6:168319656-168319678 CGGCGCCGCTCGTGGGGTTCGGG - Exonic
1019279591 7:193104-193126 CGGCGCCGCCTCGCGGGTCAAGG - Exonic
1021717026 7:23469860-23469882 CGGAGCCACCCGGTGGGCCTGGG + Intronic
1022494337 7:30843798-30843820 TGGTGCAGCCCAGTGGGTCCTGG + Intronic
1034509051 7:151519675-151519697 CGCCGCCGCGCGGTCGGTTCCGG - Exonic
1034911524 7:155002547-155002569 CGAGGCGGCCCGGTGGGTCGGGG + Intronic
1035600185 8:892710-892732 CTGCCCCGCCTGGTGGTTCCCGG - Intergenic
1037835368 8:22212201-22212223 CGGCTCCCCACGGTGGCTCCTGG - Exonic
1039591906 8:38756928-38756950 CCTCTCCGCCCGCTGGGTCCGGG - Intronic
1041051560 8:53939626-53939648 GGGCGGCGCCTGGTGTGTCCTGG - Exonic
1041689889 8:60678665-60678687 CGGCGCGGCCCGGAGGGAGCTGG + Intergenic
1041792596 8:61714160-61714182 AGGCGGCGCGCGGTGGGACCTGG + Intronic
1049774698 8:144398914-144398936 GGGCGCCTCCTGGTGGGACCTGG - Intronic
1053151942 9:35749128-35749150 CGGAGCCGGCCGGCGGGACCTGG - Exonic
1053157541 9:35791517-35791539 CGGCGCCGGAGGGTGGGGCCGGG + Intergenic
1056732450 9:89178035-89178057 CGGCGCCCCCCGAGGGGGCCTGG + Exonic
1057076583 9:92141339-92141361 CGGCGCAGCCCGCCGGGACCGGG + Intergenic
1057245424 9:93451353-93451375 CGCCTCCGCCCGGTGGTTCTCGG - Intronic
1057448674 9:95137451-95137473 CGGGGCCTGCCGGTGGGTCCTGG - Intronic
1061726903 9:132587093-132587115 CGGAGCTGCCCGGGGGGTCTCGG + Intronic
1061879379 9:133561137-133561159 CGGAGCCTGCCGGTGGGGCCTGG + Intronic
1062412490 9:136432089-136432111 GGGCGCCAGCCGGTGGGGCCGGG + Intronic
1062461868 9:136665706-136665728 CGGGGCCGCCAGGTGGGGCGGGG + Intronic
1062656340 9:137605976-137605998 CGGCGGCGCCGGGGAGGTCCGGG + Intronic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1203792730 EBV:160294-160316 CGGCACCGCCAGGTGGTTACAGG + Intergenic
1187281374 X:17860785-17860807 CGGCGCCGGCCGGCGGGGCGGGG - Intronic
1189317117 X:40064129-40064151 CGGCTCCCCCCGGGGGCTCCAGG + Intronic
1191025460 X:55908730-55908752 CGGCCCCGCCCCGTCGGCCCAGG + Intergenic
1193339890 X:80335368-80335390 CGGCCCCGCCCCCTCGGTCCAGG - Intergenic