ID: 1139529889

View in Genome Browser
Species Human (GRCh38)
Location 16:67537842-67537864
Sequence GGGCGCCGGGACGCCCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139529872_1139529889 21 Left 1139529872 16:67537798-67537820 CCTTCTCGGCATCGCGCCCAGCT 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG 0: 1
1: 0
2: 4
3: 43
4: 437
1139529875_1139529889 5 Left 1139529875 16:67537814-67537836 CCCAGCTCTGGGAATCCCCCTGC 0: 1
1: 0
2: 2
3: 73
4: 948
Right 1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG 0: 1
1: 0
2: 4
3: 43
4: 437
1139529881_1139529889 -10 Left 1139529881 16:67537829-67537851 CCCCCTGCCTGGAGGGCGCCGGG 0: 1
1: 0
2: 4
3: 25
4: 247
Right 1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG 0: 1
1: 0
2: 4
3: 43
4: 437
1139529876_1139529889 4 Left 1139529876 16:67537815-67537837 CCAGCTCTGGGAATCCCCCTGCC 0: 1
1: 0
2: 4
3: 51
4: 436
Right 1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG 0: 1
1: 0
2: 4
3: 43
4: 437
1139529871_1139529889 22 Left 1139529871 16:67537797-67537819 CCCTTCTCGGCATCGCGCCCAGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG 0: 1
1: 0
2: 4
3: 43
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139529889 Original CRISPR GGGCGCCGGGACGCCCGGGC CGG Intronic
900013695 1:135556-135578 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900043765 1:491539-491561 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900065202 1:726542-726564 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900088678 1:909981-910003 GGGCGGCGGCGCGGCCGGGCTGG + Intergenic
900096055 1:940525-940547 GGGACTCGGGAGGCCCGGGCGGG + Intronic
900102134 1:966435-966457 GGGCTCCGGGACGTCCCGCCCGG - Intergenic
900190110 1:1349600-1349622 GGGCGCCGGGGCGCTCGGGTCGG + Intergenic
900221425 1:1511536-1511558 CGGGGCCGGGGTGCCCGGGCAGG - Intergenic
900240877 1:1616593-1616615 GGGCGACTGGACGGCCGGACAGG + Exonic
900643814 1:3699720-3699742 GGGAGCAGGGATGCTCGGGCGGG + Intronic
901063846 1:6485681-6485703 AGGCGGGGGGTCGCCCGGGCAGG - Intronic
901082073 1:6589145-6589167 GGGCTCCAGGACACCTGGGCCGG - Exonic
901449002 1:9324923-9324945 GGGAGCAGGGACACCCGGCCTGG + Intronic
901551155 1:9997209-9997231 GGGCGGCCGGAGGCTCGGGCCGG - Exonic
901630655 1:10646685-10646707 GGGTGCCGTGAGGCCCTGGCTGG + Intronic
901743148 1:11355613-11355635 GGGCCCCGTGCCCCCCGGGCTGG + Intergenic
903261520 1:22134128-22134150 GGGGGCTGGGACGCCAGCGCAGG + Intronic
903349755 1:22710716-22710738 GGGGGCCGGGACGCGCGCGGGGG + Intergenic
903420920 1:23217411-23217433 GGGCCCCGGGGCGGCGGGGCGGG - Intergenic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
903466420 1:23555060-23555082 CGGCGCTGCGGCGCCCGGGCTGG - Intergenic
903907201 1:26695929-26695951 GGGACCCGGGACGGGCGGGCTGG - Intergenic
904160432 1:28518636-28518658 GTGCGCGCGGCCGCCCGGGCGGG + Intronic
904696831 1:32335832-32335854 GGGCGCCGCGTGTCCCGGGCCGG + Intronic
904775119 1:32901522-32901544 CGGCGCCGGGCGGGCCGGGCGGG - Intergenic
904873041 1:33633727-33633749 GGGAGCTGGGAAGGCCGGGCTGG + Intronic
905066890 1:35192251-35192273 GGCCGCCGGGCCCGCCGGGCGGG + Exonic
905169040 1:36099026-36099048 GGGCCCCAGGCAGCCCGGGCTGG + Exonic
905300763 1:36985003-36985025 GGGCTCCGTGAAGCCCGGGCAGG + Intronic
905345275 1:37307042-37307064 GGACGTCGGGAAGCCCAGGCAGG - Intergenic
905414485 1:37794744-37794766 GGGGGCAGGGCCGCCCGGGGTGG - Intronic
905553021 1:38859335-38859357 GGTAGCGGGGACGCCCGGGAGGG - Intronic
906495501 1:46302100-46302122 GGGCGCCGGGATGAACGGCCGGG - Intronic
907294284 1:53439606-53439628 GGGCGCCGGGGCGAAGGGGCGGG - Intergenic
907444609 1:54499702-54499724 GGGCGCCTGGTCGCCCGGGGAGG + Intergenic
908477722 1:64505739-64505761 GGGCGCCCGGAAGGCGGGGCGGG - Intronic
910449085 1:87328823-87328845 GGGGGCGGGGGCCCCCGGGCGGG + Exonic
914702952 1:150150393-150150415 GGGGACCGGGCCGCCGGGGCGGG - Intronic
917291599 1:173477224-173477246 GGGGGCCGGGCCGCGGGGGCTGG - Intergenic
918040942 1:180913310-180913332 CAGCGCCGGGCCGGCCGGGCGGG + Intronic
918388766 1:184037060-184037082 GGGCCCCGGGCCGCCGCGGCGGG - Intronic
919851176 1:201674065-201674087 GGGCACCTGGACACCTGGGCTGG - Intronic
922025250 1:221743119-221743141 GGGCCCCAGGACGCCCGGCCAGG - Intergenic
922241374 1:223757453-223757475 GAGCGTCGTGAAGCCCGGGCAGG + Intronic
922335836 1:224617486-224617508 GGGACCCGGGACGCCCAGTCGGG - Intronic
922734945 1:227973760-227973782 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
922775812 1:228213807-228213829 GGGAGCCAGGCCGCACGGGCTGG + Intronic
923400886 1:233614586-233614608 GGGGCCCGGGGCGCCGGGGCCGG - Intronic
923684132 1:236142383-236142405 GCGGGCCGGGGCGCGCGGGCCGG + Intergenic
924527230 1:244863571-244863593 GCGCGGCGGGAGGCCCGCGCGGG - Intronic
924561129 1:245156711-245156733 AGGCGCCGGGAGGGCGGGGCCGG + Intronic
1062873918 10:931039-931061 GGGTGCCCGGAAGACCGGGCCGG - Intronic
1063429606 10:5977372-5977394 GGGAGCAGGGGCGCCCGGGCGGG - Intronic
1065186231 10:23173399-23173421 GCGCGCCCGGTCGTCCGGGCGGG - Intergenic
1066406968 10:35127325-35127347 GCGGGCCGGGACCCCGGGGCCGG + Intronic
1066465142 10:35643420-35643442 GGGCTGCGGGCGGCCCGGGCCGG + Intergenic
1066733185 10:38451376-38451398 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1067937488 10:50624041-50624063 GGGGGGCGGGCCGGCCGGGCGGG + Intronic
1068762946 10:60733179-60733201 GGCGGGCGGGAGGCCCGGGCCGG - Intronic
1069158134 10:65054207-65054229 TGGCGCCGGGAGGCCTTGGCTGG - Intergenic
1070328238 10:75401454-75401476 GGGCTCCGGGAGGCGCGGGGCGG + Exonic
1071546786 10:86535638-86535660 GGGGGCGGGGAGGCCCGGGCAGG - Intergenic
1072151941 10:92690552-92690574 AGGCGTCGGGGCGCGCGGGCCGG + Intronic
1072591627 10:96832728-96832750 CGGCGCCGGGGCGCCGGGCCTGG - Intronic
1073137683 10:101228882-101228904 GGGCGCCGGACGGCGCGGGCAGG + Exonic
1073511063 10:104042636-104042658 AGGCACCGGGACCCCGGGGCAGG + Intronic
1074591918 10:114821862-114821884 GGGCGCCGGGACGCGGCGGGCGG - Exonic
1074772435 10:116742635-116742657 GGGCGCCGGGCGGGCCGGGGCGG - Intergenic
1075707494 10:124510395-124510417 GGGGGCCGGGACGCCAGGGCCGG - Intronic
1075771109 10:124936982-124937004 TCTCGCCGGGCCGCCCGGGCTGG + Intergenic
1076683135 10:132185618-132185640 GGGCGCTGGGAAGGCCGGGCGGG - Intergenic
1076734317 10:132451965-132451987 GGGTGCCGGGACCCCTGCGCTGG + Intergenic
1076970039 11:127770-127792 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1077164126 11:1127459-1127481 GGGCTCCTGGTGGCCCGGGCAGG + Intergenic
1077186345 11:1237046-1237068 GGGTGCCAGGGCGTCCGGGCAGG - Exonic
1077194586 11:1272757-1272779 GGGTGCCGGGAAGGCCAGGCCGG + Intergenic
1077214620 11:1390237-1390259 GGGCGCCCGGGCGCGCGGGCAGG - Intronic
1077226930 11:1442690-1442712 GGGTGCCGGGAGGCTCAGGCAGG - Intronic
1077249949 11:1556681-1556703 GAGCCCCGGGACGCGCGGACCGG - Exonic
1078245913 11:9573439-9573461 GGGCGGCGGGGGGCCCGGCCCGG - Intergenic
1079056076 11:17207763-17207785 GGGCCCCGGGGTTCCCGGGCTGG - Intronic
1079626723 11:22625439-22625461 GGCGTCCCGGACGCCCGGGCCGG + Exonic
1080458780 11:32436389-32436411 GGGCGCCAGGATGCTCCGGCCGG - Intergenic
1080588339 11:33700511-33700533 GGGGGCGGGGGCGCCGGGGCGGG + Exonic
1081567583 11:44269636-44269658 GGGCCCTGGGAGGCCAGGGCAGG - Intronic
1081870729 11:46381559-46381581 GGGGGCGGGGACGCCGGGGTCGG + Intronic
1082003719 11:47408565-47408587 GGGCGGCCGGGCGGCCGGGCGGG + Intronic
1083227682 11:61295044-61295066 CGGCGGCGGGTCCCCCGGGCTGG + Exonic
1083885812 11:65572971-65572993 GGGCGCCGGGCCAGCTGGGCGGG + Intronic
1086437923 11:86800282-86800304 TGGCGCCGAGAGGCCCGGACTGG + Exonic
1090780431 11:130002359-130002381 GGGCGACGAGACGCCGAGGCCGG + Intronic
1091740771 12:2959266-2959288 AGGGGCCGGGCCGCCGGGGCGGG - Intergenic
1091888090 12:4031307-4031329 GGGCGCGGGGAGGCGCGGGCGGG - Intergenic
1092843078 12:12561951-12561973 GGTGGCCGGTACGCCCGGGAAGG + Intronic
1094607306 12:31959670-31959692 GGACGGCGGGACGCGCGAGCCGG - Intronic
1096077624 12:48815064-48815086 GGGCGCCTTGACGCTTGGGCGGG + Intronic
1096548283 12:52356273-52356295 GGGCGCCGGGAGGGACGGGAGGG - Intergenic
1096668220 12:53181012-53181034 ACGCGGCGGGACGCGCGGGCAGG - Intronic
1101606064 12:106248183-106248205 GGGGGCCGGGAAGCCGGCGCGGG + Intronic
1102046584 12:109833399-109833421 GGGCGCCGGGCGGGCCGGCCGGG - Intronic
1102278187 12:111598788-111598810 CGGCGGCGGGAGGCCCGGCCTGG - Exonic
1102278277 12:111599158-111599180 GGCCGGAGGGGCGCCCGGGCTGG + Exonic
1103595916 12:122024075-122024097 GGGCCCCGGGGCGGCCGGCCTGG + Intronic
1103649666 12:122422726-122422748 AGGGGCCGGGCCGGCCGGGCCGG - Intergenic
1103779483 12:123389353-123389375 GGGAGCGGGGCCGCCCGGGCCGG - Intronic
1103926545 12:124426584-124426606 GGGGGCCGGGAGGCCAGGCCAGG + Intronic
1105389206 13:19959183-19959205 GGACGGCGGGACGGCGGGGCGGG + Intronic
1105781113 13:23705970-23705992 GGGCCCCGGGACTCCCTGGATGG + Intergenic
1106602572 13:31200268-31200290 GGACGGCGGGACGCGCGCGCCGG - Intronic
1107522267 13:41194606-41194628 GGGCTCTCGGACGGCCGGGCGGG + Intergenic
1108690029 13:52851331-52851353 GGGAGCCGGGGAGCCCGGGAAGG + Intergenic
1112494868 13:99896439-99896461 GGCCGGCGGGACCCCAGGGCGGG - Exonic
1112570407 13:100588669-100588691 GGGCGCCAGGACACCCCGCCTGG + Intronic
1113541793 13:111115194-111115216 GGGCGCGGGGCGGCGCGGGCCGG + Intronic
1113808645 13:113124137-113124159 GGGCCTCGGGAGCCCCGGGCCGG - Intronic
1113949976 13:114066415-114066437 GGGCGAGAGGAGGCCCGGGCAGG + Intronic
1114035863 14:18626805-18626827 GGCCGCTGGCACGTCCGGGCCGG + Intergenic
1116905139 14:50396808-50396830 CGGCGCCGTGAGTCCCGGGCGGG - Intronic
1116950153 14:50872083-50872105 GGGCGCGGTGCCGCCGGGGCGGG + Intronic
1117302304 14:54441477-54441499 GGGCGCCGGGGCGGCTGGGCTGG - Intergenic
1117699192 14:58396205-58396227 GGGGCCCGCGGCGCCCGGGCAGG + Intronic
1118220951 14:63853715-63853737 GGGCGCGGGGACGGGCGGCCCGG + Intronic
1119539327 14:75428276-75428298 GGGCGCCGGGACGGGCGGGGCGG + Intronic
1119618849 14:76116680-76116702 GGGCTCCGGGAAGGCAGGGCAGG + Intergenic
1121115083 14:91337846-91337868 GGGCCCTGGGAAGCCCAGGCAGG + Intronic
1121127609 14:91417970-91417992 GGGCTCCCGGGCTCCCGGGCTGG - Intergenic
1122214297 14:100193097-100193119 GGGCTACGGGACGCGCGGGATGG - Intergenic
1122620822 14:103056926-103056948 GGGCGTGGGGATGCGCGGGCTGG + Intronic
1123036754 14:105474767-105474789 GGGCGCGCGGACAGCCGGGCAGG + Intronic
1123068358 14:105629221-105629243 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123092377 14:105747545-105747567 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123097955 14:105775246-105775268 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1124426890 15:29570415-29570437 GGCCGCCGGGACGCCACCGCGGG - Intronic
1124640138 15:31391951-31391973 GGCAGCCGGGACGGCTGGGCCGG + Intronic
1125535934 15:40441216-40441238 GGGCGCCCGCAGGCCCCGGCCGG - Exonic
1128149786 15:65355644-65355666 GGGGGGCGGGACGCCCGCGTCGG - Intronic
1128322596 15:66703581-66703603 CGGAGCCGGGAGGCCCGGGCTGG + Exonic
1128453874 15:67822195-67822217 GCGCGACGGGCCGCCTGGGCAGG - Intronic
1128454186 15:67823450-67823472 GGGCGCCGGGACCCCGGGCGCGG - Intronic
1128987432 15:72231345-72231367 CGGCGGCGGAACGCGCGGGCAGG + Exonic
1129644649 15:77419599-77419621 GGACGCGGGGAGGCCGGGGCAGG - Intronic
1129948240 15:79560594-79560616 TGGCGCGGGGAGGCGCGGGCCGG + Intergenic
1132275290 15:100558768-100558790 GGGCACTGGGACGTTCGGGCGGG - Intergenic
1132484123 16:181379-181401 GGGCCGCGGGACGCCCCGGGCGG + Intergenic
1132849889 16:2020232-2020254 GGGCTCCGGGGCGCACGGACGGG - Exonic
1132978249 16:2721092-2721114 CGGCTCCGGGAAGGCCGGGCCGG + Intergenic
1132989567 16:2785904-2785926 GGGGGCCGGGATGGCCGGGACGG - Exonic
1133197797 16:4183606-4183628 GGGCGCCAGGAGGCCGAGGCCGG - Intergenic
1133217248 16:4300116-4300138 GAGCTCCGGGAGGCCCAGGCAGG + Intergenic
1134134149 16:11668581-11668603 GGGCGCCGGGGCCCGGGGGCGGG + Intronic
1134172113 16:11976882-11976904 GGGCGCGAGGACGCAGGGGCCGG - Intronic
1135517659 16:23149132-23149154 GGGCCCCGGGGCGTCCGGGCCGG - Exonic
1136141858 16:28293269-28293291 GGCCGCGGGGACGCCGCGGCAGG - Exonic
1136608581 16:31352822-31352844 GGGCGGCGGGAAGGCCAGGCTGG - Intergenic
1137285645 16:47014003-47014025 GGTCTGCGGGACGCGCGGGCGGG - Intergenic
1138503339 16:57462845-57462867 GGGCGCCGGGAGGCCCAAGCCGG + Intronic
1138595302 16:58026367-58026389 GCGCGCCCGGACGGCCGGGCTGG + Exonic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1139544748 16:67644992-67645014 GGGCGACGGGGCGGGCGGGCAGG + Exonic
1139866488 16:70065949-70065971 GGGCGGCGGGGCGGCGGGGCGGG + Intergenic
1141608665 16:85169487-85169509 GGGCGCGCGGGGGCCCGGGCGGG + Intergenic
1141972284 16:87492326-87492348 GGGACCGGGGACGCGCGGGCCGG + Intergenic
1141989478 16:87602241-87602263 GGGGGCGGGGGCGCCCCGGCTGG + Intronic
1142120359 16:88383715-88383737 CGGGGCCAGCACGCCCGGGCGGG - Intergenic
1142176923 16:88649735-88649757 GAGAGCCGGGAGGCCAGGGCGGG + Intronic
1142256401 16:89015747-89015769 GGGTGCAGGGAACCCCGGGCAGG - Intergenic
1142407019 16:89895963-89895985 GGGCACAGGGACGCCAGGGGAGG - Intronic
1142450638 16:90171362-90171384 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1142456924 17:62329-62351 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1142670527 17:1485712-1485734 GGGCGCCAGGCCGGCCGGGCAGG - Intronic
1142757504 17:2024759-2024781 CGGCGCCGGGGCTCCCGGTCTGG - Intronic
1143026620 17:3945028-3945050 GGGCCAGGGGACGCGCGGGCGGG - Intronic
1143053074 17:4142770-4142792 TGGAGCCGCGACGCCCGGGCCGG + Exonic
1143078739 17:4366238-4366260 GGGCGGCGGGGCGCCGGGCCCGG - Intronic
1143165028 17:4893351-4893373 GGGTGCCGGGACACCCCAGCAGG - Intronic
1143390397 17:6556354-6556376 GGGCGCGGGGAGGGCAGGGCCGG - Intronic
1143484015 17:7243100-7243122 GGGCGCCGGGGAGGCGGGGCCGG + Intronic
1144606112 17:16666938-16666960 TGGCGCCGGGAGGCCTTGGCTGG + Intergenic
1145110356 17:20156455-20156477 GGGCGCCGGGGCCGCCGGGCAGG + Intronic
1146271386 17:31487992-31488014 GGGCCCCGGGACTCGGGGGCGGG - Intronic
1146439006 17:32877198-32877220 CGGAGCCGGGAGGCCCGGGCGGG - Intergenic
1147015643 17:37489755-37489777 GGGCGGGGGGACGCGCGGGGCGG - Intergenic
1147184443 17:38705762-38705784 GGGCGGCGGGACCCCGGGGGCGG + Intronic
1147429551 17:40363052-40363074 GGGCGCCGGGAGGGCAGGGCCGG + Exonic
1147754841 17:42761366-42761388 CGGCGCCCCGAGGCCCGGGCGGG + Intronic
1147896621 17:43755645-43755667 GCGCGCCGGGCCGCACTGGCCGG + Exonic
1148128363 17:45248137-45248159 GGGCGCCGGGACCCGCGGGAGGG - Intergenic
1149595418 17:57862120-57862142 GAGAGCCGGGAAGCCTGGGCAGG - Exonic
1149678661 17:58488355-58488377 GGGCGCCGGCAGGAGCGGGCAGG - Exonic
1150675859 17:67245426-67245448 GGGGGCAGGGAGGCCGGGGCAGG - Intronic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1151182861 17:72342563-72342585 GGGTGCAGGGAGACCCGGGCTGG - Intergenic
1151642273 17:75405177-75405199 GGGGCCCGGGAAGCCCAGGCGGG - Exonic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151797056 17:76353505-76353527 GGGCGGTGGGAGGGCCGGGCCGG - Intronic
1152654204 17:81512562-81512584 GGGCGCCGGGGGTCCAGGGCGGG - Exonic
1152718495 17:81911224-81911246 GGCCGCGGGGGCGCCGGGGCCGG - Intronic
1152823753 17:82450635-82450657 GGGTGCCGGGACGCGCGGCACGG + Exonic
1153474952 18:5489081-5489103 GCGCGCGGGGGCGCCCGTGCCGG - Exonic
1154202459 18:12308598-12308620 GGCCGCCGGGGCGCCTGGGGTGG + Intronic
1154501017 18:14998117-14998139 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
1158643105 18:59220029-59220051 GGGCGCTGGGACGCCCGGTCCGG - Intergenic
1158976822 18:62716859-62716881 GGTGGCCGGGACGGCGGGGCTGG - Exonic
1159289348 18:66396076-66396098 GGGCGTGGGGAGGCTCGGGCAGG - Intergenic
1160453038 18:78978801-78978823 GGGCGCGGCGACGACGGGGCCGG + Intergenic
1160631169 18:80247242-80247264 GGGCGCAGGGCCGCCGGGGCGGG + Intronic
1160646837 19:197688-197710 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1160668386 19:344389-344411 GCGCGCCGCGGGGCCCGGGCCGG + Intronic
1160691405 19:461959-461981 AGGGGCCGGGACGCGCTGGCAGG + Intergenic
1160719906 19:592460-592482 GGTCGCCTGGAGGCCTGGGCAGG + Intronic
1160726789 19:620967-620989 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160726800 19:620988-621010 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160811412 19:1014558-1014580 GCGCGCTGGGACGCCCAGGACGG + Intronic
1160919438 19:1512977-1512999 GGGAGCCGGGACGCGCTGCCTGG - Exonic
1160952001 19:1672170-1672192 GGGGGCCCCGACGCCCGGGGAGG - Intergenic
1160967993 19:1754956-1754978 GGCTGCCGGGGCGCACGGGCGGG - Intronic
1160983832 19:1828394-1828416 GGGCCGCGGGGCGCCAGGGCGGG + Exonic
1161051321 19:2165249-2165271 GCGCGCGGGGATGCCCGGCCGGG - Intronic
1161051350 19:2165348-2165370 GAGCGCTGGGGAGCCCGGGCTGG + Intronic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1161156131 19:2732699-2732721 GCCCGCCGGGAGCCCCGGGCCGG - Exonic
1161273990 19:3405132-3405154 TGCCGCCGGGCCGCCTGGGCCGG - Intronic
1161478477 19:4498971-4498993 GGGGGCCTGGGCTCCCGGGCAGG - Intronic
1161642367 19:5432307-5432329 GGGCGCTGGGACCCCCAGGAGGG + Intergenic
1162315599 19:9936454-9936476 CGGCGCAGGGTCGCCCCGGCCGG - Exonic
1162776589 19:12983565-12983587 GTTCGCCGCGGCGCCCGGGCCGG - Intergenic
1162778590 19:12995391-12995413 GGGCGCGGGGAGGGGCGGGCAGG - Intergenic
1162895961 19:13764793-13764815 GGGCGGCGGGGCGGCCGGGTTGG + Intronic
1163102579 19:15107339-15107361 GCGGGCGGGGAGGCCCGGGCGGG + Intergenic
1163597019 19:18226221-18226243 GGTCACCGGGACGCCCGGTGTGG - Intronic
1163607205 19:18281826-18281848 GGGCGGCCGCGCGCCCGGGCCGG + Intergenic
1163725154 19:18919186-18919208 GGGCGCGGGGACGCTGGGGGCGG - Intronic
1163844161 19:19628968-19628990 GAGCTCCGGGAGGGCCGGGCTGG + Intergenic
1164034897 19:21444189-21444211 GCACCTCGGGACGCCCGGGCAGG + Intronic
1164595870 19:29530343-29530365 CTGCGCCGGGACGCCCCGGGGGG + Intronic
1164639262 19:29812362-29812384 GGGCGGCGGGACCCCGGGTCGGG + Intronic
1164693836 19:30228815-30228837 GGGCTCCGGGACTGCCCGGCTGG + Intronic
1165058609 19:33194391-33194413 CGGCCCGGGGACGCCGGGGCCGG + Intronic
1165157073 19:33795555-33795577 GGCTCCAGGGACGCCCGGGCCGG - Intergenic
1165898166 19:39155739-39155761 AGGCGCTGGGACTCCCAGGCTGG - Intronic
1166072224 19:40394233-40394255 GGGCCTCGGGTCGCCGGGGCCGG - Exonic
1166213913 19:41323743-41323765 GGGGGCAGGGACGCTGGGGCAGG - Exonic
1166361641 19:42255031-42255053 GGGCGCCGGGAGCCGCGGCCCGG - Exonic
1167001039 19:46746035-46746057 GGCCGCCGGGACGGCCGGCGGGG - Exonic
925376280 2:3388336-3388358 GGGGGCCGGGGAGCCCGCGCCGG - Exonic
925419832 2:3703347-3703369 GGGCAACGGGGAGCCCGGGCAGG - Intergenic
925419866 2:3703458-3703480 GGGCGACGGGGAACCCGGGCAGG - Intergenic
927714313 2:25342172-25342194 GGGCCCCGGGGCGCCGCGGCGGG + Intronic
929646970 2:43637486-43637508 GGGCGCCGGGAGGAGCGGGAAGG + Intronic
931321343 2:61177310-61177332 GGACGCGGGGACGCGCGGGCGGG - Intergenic
931355851 2:61537507-61537529 GGGCGGCGGCGCGGCCGGGCGGG - Intronic
932496697 2:72149081-72149103 GGGCGGCGGGCGGCCGGGGCGGG - Intergenic
932765248 2:74465144-74465166 GGGCGACGGGACGGCCGGGGCGG - Exonic
933776149 2:85772393-85772415 GGGGGCCGCGGCGGCCGGGCGGG - Intronic
936993947 2:118394228-118394250 GGGTGGCGGGAAGCCCAGGCAGG + Intergenic
937221736 2:120346050-120346072 GGGCGGGCGGAGGCCCGGGCGGG + Intergenic
938500188 2:131828306-131828328 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
942346083 2:175004803-175004825 GGGGGCCTGGGCGCCCGGGGAGG - Intronic
942450818 2:176107102-176107124 TGGCGCCGAGACGCGCGCGCTGG - Intronic
945225607 2:207529478-207529500 GGGGGACGGGCAGCCCGGGCTGG - Intergenic
945891544 2:215436058-215436080 CGGCGCTCGGACGCCCGCGCCGG - Exonic
946354530 2:219176719-219176741 GCGCGCCGGGAGGCCGGGGAGGG + Intronic
946921405 2:224585110-224585132 CGGCGGCGCGACCCCCGGGCAGG + Exonic
947549866 2:231038137-231038159 GGCCGCCTGGACGGCCAGGCAGG - Exonic
947605625 2:231483604-231483626 GCGCGCGGCGAGGCCCGGGCGGG + Intronic
947800952 2:232928249-232928271 CGGGGCGGGGGCGCCCGGGCTGG + Intronic
947834103 2:233163000-233163022 GGGTGCCCGAACCCCCGGGCTGG - Intronic
947860388 2:233354073-233354095 GGGCCTCGGGACGCCAGAGCTGG - Intergenic
948047028 2:234952420-234952442 CGGCGCCCGGAACCCCGGGCCGG - Intronic
948140604 2:235669918-235669940 GGGCGGCGCGGCGCACGGGCCGG + Intronic
948365279 2:237450717-237450739 AGGCGCCGGGCTGCCCGGCCTGG + Intergenic
948767939 2:240233155-240233177 GGGCGCCGGGCAGGCCCGGCCGG - Intergenic
948874668 2:240820252-240820274 GGGCGCGGGGCGGTCCGGGCCGG - Exonic
948893482 2:240917898-240917920 GAGGGCCGGGACCCCAGGGCAGG - Intergenic
1170204697 20:13785302-13785324 GGGCGGCGGGGCGGCGGGGCGGG + Intronic
1171012790 20:21517609-21517631 GGACGCCGGGAGGCCTGCGCAGG + Intergenic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1172662006 20:36574333-36574355 TCGCGCCGGGACCCTCGGGCAGG + Intronic
1173548097 20:43914679-43914701 GGGGGCCCGGGGGCCCGGGCCGG - Intergenic
1173741550 20:45405980-45406002 GGGCGCCGGGCCGGCCGGGCGGG - Intronic
1174042376 20:47709099-47709121 GGGCCCCGGGGCTCCTGGGCTGG + Intronic
1175231542 20:57476713-57476735 GGGCGGGGGGAAGCCCGGACGGG - Intergenic
1175237688 20:57525517-57525539 GGGCGCTGGGAGACCCGGGGGGG + Intronic
1175397329 20:58675364-58675386 GGGCGCCGGGAGGCACGTCCAGG - Intronic
1175911504 20:62407314-62407336 GGGCGCGCGGGCGCGCGGGCAGG - Intergenic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1176173740 20:63708097-63708119 GGGCGCCGGGCCGCTCTAGCCGG + Exonic
1176194522 20:63831126-63831148 GGGCGCCGCGGCCGCCGGGCCGG + Intronic
1176546673 21:8205338-8205360 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1176554568 21:8249528-8249550 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1176565624 21:8388385-8388407 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1176573489 21:8432553-8432575 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1179243739 21:39612779-39612801 AGGCGACGGGACCCCCAGGCCGG - Intronic
1180084986 21:45504496-45504518 GGGGGCCGGGGGGGCCGGGCAGG - Exonic
1180110178 21:45643807-45643829 AGAGGCCGGGAGGCCCGGGCGGG - Exonic
1180459984 22:15553859-15553881 GGCCGCTGGCACGTCCGGGCCGG + Intergenic
1180950653 22:19719073-19719095 GGGCGCCTGGGCGCGCGGGCGGG + Intronic
1181162039 22:20965133-20965155 GGGGGCGGGGAGGCGCGGGCGGG - Exonic
1181299277 22:21867745-21867767 GGGGGCGGGGCCGCGCGGGCCGG + Intergenic
1181956194 22:26589655-26589677 GCGCGCGGGGACCCCCAGGCGGG - Intronic
1182603995 22:31489563-31489585 GGGCGCCGGGGCGCCCGCAGGGG - Exonic
1183411762 22:37659079-37659101 GCGCGTCCGGAGGCCCGGGCAGG - Exonic
1183437733 22:37805060-37805082 GGGAGCAGGAAGGCCCGGGCCGG + Intergenic
1183546257 22:38455974-38455996 GGCAGCCGGGGCTCCCGGGCTGG - Intergenic
1183831472 22:40420483-40420505 GGGCCCAGGGGCGCCCGAGCTGG + Exonic
1183942119 22:41301847-41301869 GGGTTCGGGGACGCCCGGGCCGG + Intronic
1184405637 22:44298937-44298959 GGGAGCCGGGACAACCGGGTGGG + Intronic
1184550136 22:45200079-45200101 GGGCGTTGGGACCCCCGGGGAGG - Intronic
1185167445 22:49270271-49270293 GGGCGCAGGGCTGCCAGGGCTGG + Intergenic
1185343095 22:50300172-50300194 GGGGCCCAGGACGCGCGGGCGGG + Intronic
1203251538 22_KI270733v1_random:121604-121626 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1203259588 22_KI270733v1_random:166686-166708 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
950421514 3:12902391-12902413 GGGAGCCGGGTGGCCCGGGCGGG + Intronic
950450620 3:13063095-13063117 GAGAGCCGGGACTCCTGGGCTGG + Intronic
950518130 3:13480416-13480438 GAGGGCGGGGACGGCCGGGCGGG + Intronic
953399534 3:42600813-42600835 GGGAGCCGCGAGGCCCGGGGCGG + Intronic
953562020 3:43999107-43999129 GCGCGCCGGGCCGCCTGGCCGGG + Intergenic
954442734 3:50530584-50530606 GGGCGCAGGGACGCAGGGACGGG + Intergenic
960586157 3:119322985-119323007 GGGCGCCCGGACCCCGGGGCGGG - Intronic
961929370 3:130517095-130517117 GGGCCCGGGGCCGCCGGGGCGGG + Intergenic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
967849473 3:194071129-194071151 GGGCGCGGGGGCGGCCGGGCAGG + Intergenic
967859638 3:194141376-194141398 GGCCGCAGGGCCGCCAGGGCTGG - Intergenic
967976204 3:195035986-195036008 GGGCGCAGGGCTGCCCGTGCAGG + Intergenic
968092811 3:195909104-195909126 GAGCGCGGCGAGGCCCGGGCCGG - Intronic
968230718 3:197003231-197003253 GGGCGGCGGGGCTCCCGGGGAGG + Exonic
968370844 3:198221834-198221856 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
968611021 4:1556994-1557016 GGCGGCCGAGACTCCCGGGCCGG + Intergenic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
969259137 4:6022615-6022637 GGGAGCCGGGAAGCCACGGCTGG + Intergenic
972396395 4:38663313-38663335 GGGCGACGGGTCCCCCTGGCCGG - Intergenic
972686814 4:41360434-41360456 GGGCGCAGGGACGTGCGGGGCGG + Intronic
975801101 4:78059213-78059235 GGGCTGCGGGAGGCCCGGGGAGG + Intronic
975983585 4:80184239-80184261 GGGCGCCAGCACCCCGGGGCCGG + Intronic
977893987 4:102344465-102344487 AGGCTCCGGGACGCCCACGCGGG + Exonic
979259537 4:118634386-118634408 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
979328835 4:119406239-119406261 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
983940106 4:173529013-173529035 GGGCGCCGGGCCCCCGGGCCTGG - Exonic
984462866 4:180058686-180058708 GGGCGCGGGGCCGGGCGGGCGGG - Intergenic
984639189 4:182144309-182144331 GGCCCGCGGGACGCCCGGCCAGG - Intronic
985517640 5:355131-355153 GGGCACCAGGAGGCCCAGGCTGG - Intronic
985580448 5:693120-693142 GGGCTCAGGGACGCGCGGGGCGG + Intronic
985632462 5:1021297-1021319 GGGGGCCGGGGGGACCGGGCAGG - Intronic
985995854 5:3596436-3596458 GGGTGGCGGGTCGCCCGGGAGGG + Intronic
986330772 5:6714483-6714505 GGGCGCGGGGCCGCGCGGCCCGG - Intergenic
986402809 5:7396110-7396132 GGGCGCGCTGACGCGCGGGCGGG - Intergenic
986733179 5:10649793-10649815 GGGCCCCGGGACCCCAGGGCGGG - Exonic
987108565 5:14664278-14664300 CGGCGGGGGGAAGCCCGGGCAGG + Intergenic
988578009 5:32444853-32444875 GGGCGCGGGGAAGCCCGCGGGGG + Intergenic
992690390 5:79236027-79236049 AGGCGCCGGCGCGCGCGGGCGGG + Intronic
993095184 5:83472559-83472581 GGGCGCCGGGTCGCACTGTCAGG - Intronic
994197277 5:96935236-96935258 CGGCGCCGGATCGCCCGGCCCGG - Intronic
995342255 5:111073031-111073053 GGGCTCCGGGACGCCGCCGCCGG + Intronic
997120092 5:131164897-131164919 GAGCGCCGGCACGCGCCGGCAGG + Intronic
997292436 5:132747558-132747580 CGGCGCCGGGACGCCCGCCTGGG - Exonic
997551653 5:134758633-134758655 GGGCGCCGGGAAGACTGGGCGGG + Intergenic
998861390 5:146447507-146447529 CGGAGCCGGGCGGCCCGGGCCGG + Intronic
999248356 5:150167196-150167218 CTGCGCCAGGAGGCCCGGGCCGG - Exonic
999272030 5:150302381-150302403 GCGCGCCGGGACGCGCGGGCCGG - Exonic
1002091851 5:176810701-176810723 GGGCGCGGGGCCCCGCGGGCGGG - Exonic
1002730078 5:181327390-181327412 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1002896185 6:1381915-1381937 GGGCGCCGGGAGCCGCGAGCAGG + Intergenic
1003942669 6:11044367-11044389 GGGGGCGGGGAGGCGCGGGCGGG - Intergenic
1004426987 6:15513428-15513450 GGGCGCCGGCAGGGCCAGGCGGG - Intronic
1005842891 6:29755791-29755813 GGGAGCCGGGACGCCTGTGTGGG - Intergenic
1006136183 6:31897526-31897548 CGGGGCCGGGGGGCCCGGGCGGG - Intronic
1006337425 6:33427968-33427990 GGGGCCCGGGACGGCCGGGACGG - Intronic
1006472165 6:34235483-34235505 GGGGGCGGGGGCGCCTGGGCGGG - Intergenic
1008952099 6:57172478-57172500 GGGCTCGGGGACGCCGGGCCTGG - Exonic
1012466360 6:99521000-99521022 GGGCGCCAGGAGGCCGGAGCAGG + Intronic
1013637575 6:112043801-112043823 GGGCGCCCGGACCCCAGAGCAGG + Intergenic
1016340859 6:143060604-143060626 GGGTCCCGGGACACCCGGCCAGG - Intronic
1016590019 6:145734827-145734849 GGGCGAAGGGAGCCCCGGGCGGG + Intronic
1016596962 6:145814401-145814423 GGGCGCCCGGACGGCCGACCCGG + Intronic
1016923591 6:149318254-149318276 GGGCTCCGGGGCGTCCGTGCGGG + Intronic
1017073725 6:150599812-150599834 GGGCGCGGGGAGGGGCGGGCCGG + Intergenic
1019279399 7:192564-192586 GGGCGCCGAGAGGCTCGGCCAGG + Intergenic
1019421978 7:954791-954813 GGTCCCCGGGGCGCGCGGGCTGG - Intronic
1019701824 7:2477860-2477882 GGGCCCCAGGACGGCCAGGCAGG - Intergenic
1021231022 7:18086646-18086668 GCGGGCCGGGAGGCGCGGGCCGG - Intergenic
1021950476 7:25769422-25769444 GGGCGCTGGGAGGCCGAGGCGGG - Intergenic
1023400761 7:39792088-39792110 GGGCGCCGGGAGGCAGGAGCTGG - Intergenic
1023400964 7:39792852-39792874 GGTCGCCGGGAGGCCCAAGCTGG - Intergenic
1023875678 7:44285079-44285101 GGGCGCCCTGAAGCCAGGGCAGG - Intronic
1023937162 7:44748525-44748547 CGGGGCCAGGACGCCGGGGCGGG - Intergenic
1024075238 7:45814593-45814615 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1024556386 7:50606442-50606464 GGGCCTCGGGGCTCCCGGGCCGG - Intronic
1024579851 7:50793033-50793055 GGGCGCCGGAGCCCCCGGCCCGG + Intronic
1024579890 7:50793145-50793167 GGGGCCCGGGACGGCCAGGCGGG - Intronic
1024648348 7:51386670-51386692 GGCCGCCGGGAGGCCAGAGCTGG + Intergenic
1024648668 7:51387925-51387947 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025052214 7:55741202-55741224 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025053187 7:55744925-55744947 GGGCGCCGGGAGGCTGGAGCTGG + Intergenic
1025131153 7:56374875-56374897 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178190 7:56812394-56812416 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178624 7:56814136-56814158 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179060 7:56815926-56815948 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179515 7:56817812-56817834 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179965 7:56819650-56819672 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180439 7:56821632-56821654 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180884 7:56823481-56823503 GGCCGCCGGGAGGCCCAAGCTGG + Exonic
1025181756 7:56827059-56827081 GGCCGCCGGGAGGCCCAAGCTGG + Intronic
1025690159 7:63749936-63749958 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690606 7:63751759-63751781 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691056 7:63753582-63753604 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691491 7:63755358-63755380 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691931 7:63757181-63757203 GGCCGCCGGGAGGCCCAAGCTGG - Exonic
1025692379 7:63759004-63759026 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692823 7:63760827-63760849 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693240 7:63762506-63762528 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693683 7:63764329-63764351 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025694162 7:63766316-63766338 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025694179 7:63766379-63766401 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
1029112196 7:98218092-98218114 GGCTGCCGGGCCGCACGGGCAGG - Intronic
1029441079 7:100586889-100586911 GGGTCTCGGGACCCCCGGGCTGG + Intronic
1029927091 7:104329256-104329278 GGACCCCGGGGCGCCCGAGCCGG + Intronic
1030216002 7:107044615-107044637 CGGGGGCGGGGCGCCCGGGCGGG + Intergenic
1030216034 7:107044736-107044758 GCGCGCCGGGAGCCGCGGGCCGG + Exonic
1031008399 7:116499581-116499603 GGGCGGCGGGGCGCCGGGGCGGG + Exonic
1031008407 7:116499601-116499623 GGGGCTCGGGACGGCCGGGCTGG + Exonic
1031317285 7:120273402-120273424 GGGCTGCGGGGCGGCCGGGCGGG - Intergenic
1032020654 7:128405706-128405728 ACGCGCCGCGACCCCCGGGCCGG - Intronic
1032119233 7:129144709-129144731 GGGCGCCTGGCTGGCCGGGCTGG + Intergenic
1032306112 7:130733791-130733813 GGGCGCGGCGCCGCCCGCGCCGG + Exonic
1032344449 7:131106206-131106228 GGGCGGCGGGCCGCCGGAGCCGG - Intergenic
1033186356 7:139230927-139230949 TGGCGCCGGGTCTCCCGTGCTGG - Intronic
1033253118 7:139777571-139777593 GGGCGCGGGGTCGGCGGGGCCGG + Intronic
1034418772 7:150978346-150978368 GGGGGCCGGGAGGCGGGGGCCGG - Intergenic
1034441025 7:151086260-151086282 AGGGGCCGGGGCGCCAGGGCTGG + Intronic
1034441045 7:151086328-151086350 AGGGGCGGGGGCGCCCGGGCCGG + Intronic
1034911484 7:155002421-155002443 GGGCGCCGGGATCCCCAGCCGGG - Intronic
1034911500 7:155002471-155002493 GGGAGCCGAGACGCCCGGCGCGG + Intronic
1034941994 7:155236674-155236696 GGGCGCCGTGAGCCCTGGGCTGG - Intergenic
1037450836 8:19014172-19014194 GGGCGCCGTCTCGCCGGGGCTGG + Intronic
1037799426 8:22024437-22024459 GGGCGCCAGGAGGCCTCGGCGGG + Exonic
1038883581 8:31640008-31640030 GGGGGCCGGGACGCCCGGAGCGG - Intronic
1047215082 8:122869583-122869605 TGTCGCCGGGAGGCCCAGGCAGG + Intronic
1049194523 8:141308121-141308143 GGGCGGCGGGGCGGCCGGGCCGG + Intronic
1049212273 8:141392225-141392247 GGGTCCCGGGACGCGCGGGCAGG - Intronic
1049312885 8:141942795-141942817 GGGCTCAGGGACGCACGGACAGG + Intergenic
1049536776 8:143186182-143186204 GGGAGCCGGGCCGCGCGGGGAGG - Intergenic
1049585665 8:143431332-143431354 GGGCACCGGGAAGCACGGGGCGG + Intergenic
1049645298 8:143733389-143733411 GCGAGTCGGGACGGCCGGGCAGG + Intronic
1049662131 8:143824232-143824254 GGGCCCAGGGACGCACAGGCAGG + Intronic
1049719589 8:144109500-144109522 TGGCGCCGGTGCGCCCGGGCTGG + Exonic
1049792643 8:144479056-144479078 GGGCGCCAAGACGCCCAGGAGGG - Intronic
1057773082 9:97984194-97984216 GGGCGCCTGGAGGCCTGGGCGGG + Intronic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1059208351 9:112487041-112487063 GAGAGCCGGGCAGCCCGGGCTGG - Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060555053 9:124503787-124503809 GAGCGCTGGGGCGCCCGGCCCGG + Intronic
1060770075 9:126326525-126326547 GGGCTCGGGGAGGCCCGGGTGGG + Intergenic
1060966503 9:127714974-127714996 GGGCGCAGCGTGGCCCGGGCTGG - Exonic
1060979861 9:127785825-127785847 GGGAGCCGGGGCGCCGGAGCTGG - Intronic
1060995542 9:127873367-127873389 GGGTGCCTGGACCCCGGGGCCGG + Intronic
1061149080 9:128818779-128818801 CGGCGCCGGGACTGCTGGGCCGG + Exonic
1061262621 9:129488517-129488539 GGGGGCGGGGACGCCGGGACGGG - Intergenic
1061365795 9:130172111-130172133 GGGGGCCGGAGCGCCAGGGCTGG + Intergenic
1061828327 9:133275264-133275286 GGGCGGCGGGCGGCGCGGGCCGG - Intergenic
1061961916 9:133992831-133992853 GGGCGCGGCCACGGCCGGGCGGG + Intergenic
1061976110 9:134068564-134068586 GGGCGTCGGTGCGCGCGGGCAGG + Intergenic
1061989915 9:134153300-134153322 GGGCTCAGGGGCGCCCAGGCTGG - Intronic
1062191013 9:135247852-135247874 AGGCGCCGGGACACCGGTGCTGG + Intergenic
1062230622 9:135479863-135479885 GGGCGCAGGGGCGTCCGGCCGGG - Exonic
1062235463 9:135505792-135505814 GGGGGCTGGCAGGCCCGGGCAGG + Intergenic
1062460143 9:136659548-136659570 GGGGTCCGGGAGGCCCGGGAGGG + Exonic
1062499520 9:136846271-136846293 GGGCTCCGGGGCCCCCGCGCTGG + Exonic
1062549123 9:137077949-137077971 GGGCGCCAGGACTCGGGGGCCGG - Intronic
1062556214 9:137114417-137114439 GGGCGGCGGGACGGCGGGGGCGG + Intronic
1062754493 9:138279904-138279926 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203467940 Un_GL000220v1:104755-104777 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1203475761 Un_GL000220v1:148727-148749 GGGCGTGGGGCTGCCCGGGCCGG + Intergenic
1203578397 Un_KI270745v1:24064-24086 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1187281438 X:17860930-17860952 CGGCGCCCGGAGGCCGGGGCCGG - Intronic
1189320263 X:40083400-40083422 GTGGGCGGGGACGCCCGTGCTGG - Intronic
1190316722 X:49156422-49156444 GGGCGCTGGGGCACGCGGGCGGG + Intergenic
1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG + Exonic
1192723489 X:73724433-73724455 GGGTGCCTGGAGGCCCTGGCTGG + Intergenic
1195216888 X:102712135-102712157 GGGCGGCTGGGGGCCCGGGCAGG - Intergenic
1199699478 X:150364998-150365020 GGCGGCCGGGAAGCCCCGGCGGG - Intronic
1200098149 X:153673741-153673763 GGGCGCGGGGACGCGCGGGGCGG - Intronic
1200119795 X:153784863-153784885 GGGCACAGGGCAGCCCGGGCGGG - Intronic
1200210579 X:154345129-154345151 GGGCGCCGGGCAGCCCGGGGAGG - Intergenic
1200220273 X:154386963-154386985 GGGCGCCGGGCAGCCCGGGGAGG + Intergenic
1200310264 X:155071102-155071124 CGGCGCCCGGGCGCCTGGGCAGG - Exonic