ID: 1139529931

View in Genome Browser
Species Human (GRCh38)
Location 16:67537970-67537992
Sequence CCCCGCCCCGTGACCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139529924_1139529931 2 Left 1139529924 16:67537945-67537967 CCGCAGGGCTCCGAGCGTGGCCC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 134
1139529922_1139529931 16 Left 1139529922 16:67537931-67537953 CCTGTCGGGCAGCTCCGCAGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 134
1139529917_1139529931 30 Left 1139529917 16:67537917-67537939 CCGCACCGGCTGGGCCTGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 134
1139529925_1139529931 -8 Left 1139529925 16:67537955-67537977 CCGAGCGTGGCCCCGCCCCGCCC 0: 1
1: 2
2: 9
3: 139
4: 951
Right 1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 134
1139529919_1139529931 25 Left 1139529919 16:67537922-67537944 CCGGCTGGGCCTGTCGGGCAGCT 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139529931 Original CRISPR CCCCGCCCCGTGACCTCCTT GGG Intronic
900589190 1:3452243-3452265 CTCCACCCCGTGTGCTCCTTAGG + Intergenic
900679199 1:3907069-3907091 CCCCGCCCCGCGGCCTCTCTTGG + Intergenic
900783151 1:4631045-4631067 CCCAGCCCCGTTTCCTCCTTGGG - Intergenic
902875592 1:19338975-19338997 CCCCACCCCGCGGCCTCCGTGGG + Exonic
903767412 1:25743679-25743701 CTCTGCCCCGTGACGTCCCTGGG - Intronic
904030806 1:27532398-27532420 CCCCTCCCCGAAACCTCCTCTGG + Intergenic
905749660 1:40451025-40451047 ACCCGCTCCGTGGCCGCCTTTGG - Exonic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906161599 1:43653282-43653304 CCCTGCCCGATGAGCTCCTTGGG - Exonic
906533789 1:46539995-46540017 CCCAGCCCCCTGTCCTCCATGGG + Intergenic
908380624 1:63593900-63593922 CCCAGCCCGGCGACCTCCGTCGG - Intronic
908477637 1:64505544-64505566 CCCCGCCCCGCCCCCTCCTCTGG + Intronic
1063130404 10:3172816-3172838 CCCCGCCCCGCGCCCTGCGTCGG - Exonic
1063971955 10:11387324-11387346 CCCAGCCCCGTCCCCTCCTAAGG - Intergenic
1065343022 10:24723781-24723803 CCCCGCCCCACGCCCTCCTGCGG - Intergenic
1067545978 10:47193034-47193056 CCCCGCCCCTGCACTTCCTTAGG - Intergenic
1070843288 10:79502840-79502862 CTCCAAGCCGTGACCTCCTTGGG - Intergenic
1070967102 10:80536393-80536415 CCCTGCCCCGTGCCCTCTTGTGG + Intergenic
1071546747 10:86535502-86535524 CCACGCCTCGGGACGTCCTTGGG - Intergenic
1071600929 10:86958394-86958416 TCCTGCCCCGTGCCCTCCATGGG - Intronic
1074165793 10:110872452-110872474 CCCCGCCCCCTGCCCTCCCTGGG + Intronic
1075719856 10:124578287-124578309 ACACGCCCCGTGACCACCTCAGG + Intronic
1076256642 10:129031714-129031736 CTCCCCCCCGTGGCCTCCTGGGG - Intergenic
1076307479 10:129475195-129475217 CCCCACCCCGTGACCCTCATAGG - Intronic
1076934314 10:133557197-133557219 CCCAGCCCAGTGCCCTCCTGGGG - Intronic
1079773644 11:24496825-24496847 CCCCGCCCCGCGCCATCCTGGGG + Intergenic
1080749435 11:35138986-35139008 CCCCGCCCCGTGCTCTGCTGAGG - Intronic
1084336146 11:68459259-68459281 GACCGCGCCGTGACCTCCTGTGG + Intergenic
1084518515 11:69649085-69649107 CCCTGCCCCGTGTTATCCTTTGG + Intronic
1084601735 11:70149840-70149862 CCCTACCCCAGGACCTCCTTGGG + Intronic
1086408157 11:86517185-86517207 CACAGCCCGGTGACCTGCTTTGG + Intronic
1092231687 12:6779123-6779145 GCCGGCCCAGTGACCTCCGTTGG - Intergenic
1096154578 12:49334869-49334891 ACCTGCCCCGAGACCTGCTTTGG - Intronic
1096687834 12:53300437-53300459 CCCTGGCCTGGGACCTCCTTTGG + Intronic
1100679810 12:96907181-96907203 CCTCGCCCCGTGACGTCACTCGG + Intergenic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104947918 12:132425209-132425231 CCCGGCCATGTGACCTGCTTTGG - Intergenic
1114134721 14:19834617-19834639 CCCTGCCCCCTGACATCATTTGG + Intergenic
1115490201 14:33951131-33951153 CTCCGCCCCGGGACCGCCTCCGG + Intronic
1121798067 14:96752185-96752207 CCCAGCCCCATGACTTGCTTTGG - Intergenic
1122120224 14:99549341-99549363 CCCCCAGCAGTGACCTCCTTGGG + Intronic
1122205914 14:100147878-100147900 CTCCGCCCCGTCACCTCCTGAGG + Intronic
1123577776 15:21690191-21690213 CCCTGCCCCCTGACATCATTTGG + Intergenic
1123614400 15:22132672-22132694 CCCTGCCCCCTGACATCATTTGG + Intergenic
1124825641 15:33092428-33092450 CCCTGCCACGTGACTTCCTTTGG + Intronic
1125957402 15:43799943-43799965 CCCAGCCCCGGCACCTCCCTGGG - Exonic
1128429299 15:67575354-67575376 CCCCGCCCCGCCACCTCCATGGG - Intronic
1128736302 15:70055861-70055883 CCCCGGCCCTTCACTTCCTTGGG - Intronic
1202986645 15_KI270727v1_random:424436-424458 CCCTGCCCCCTGACATCATTTGG + Intergenic
1132710197 16:1262996-1263018 CCCGGCTCCCTGACCTCCTTTGG - Intergenic
1133328965 16:4959286-4959308 CCCTGCCTGGTGACCTCCATTGG + Exonic
1135740562 16:24971829-24971851 CCAGGCCACTTGACCTCCTTCGG - Intronic
1136146066 16:28317422-28317444 CCCCGCTCCCTGACCTGCTGTGG + Exonic
1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG + Intronic
1141087798 16:81109096-81109118 CCCCGCCCCGTGCCATCCCTTGG - Intergenic
1141638620 16:85328813-85328835 CCCCGCCCCGGGGCCTCCCGCGG + Intergenic
1142000535 16:87661732-87661754 CCCCGCCCCGTGGCGGCCTGCGG - Intronic
1142106444 16:88306111-88306133 CCCTGCCTTGTGACTTCCTTAGG - Intergenic
1142260248 16:89039509-89039531 CCCTGCCCCGTGGCCTCCTTGGG + Intergenic
1143298816 17:5893513-5893535 CCCCTCCCCTTGAGCTGCTTTGG - Intronic
1144394860 17:14834215-14834237 CCCCCACCCGTCACCACCTTGGG + Intergenic
1146183262 17:30710035-30710057 CCGCGCCCCGGGAGCTCCGTGGG - Intergenic
1146341113 17:32020800-32020822 CCAGGTCCCGTGACTTCCTTGGG + Intronic
1153465412 18:5382569-5382591 CCCCACCCCGCCACCTCCTTTGG + Intergenic
1154173318 18:12066767-12066789 CCCCACCCCCTGACGTCCTGGGG + Intergenic
1160798088 19:954902-954924 CCACGCCGCCTGACCTCCCTGGG - Intronic
1161629163 19:5343227-5343249 CCCAGCCCAGTGACCTGTTTGGG + Intergenic
1161774734 19:6254121-6254143 CCCCACCCCCTGACCTCTTAGGG + Intronic
1163329717 19:16628440-16628462 CCCCGCCCCGTGACCTGGACGGG - Intronic
1163635283 19:18434503-18434525 CCCCACCCCCTGACGTCCTGGGG - Exonic
1167119359 19:47507471-47507493 CCCTGCCTCGTGAGGTCCTTCGG - Intronic
1167215571 19:48162244-48162266 CCCAGCCCTGTGACATACTTTGG + Exonic
925113005 2:1352367-1352389 CTCTGCCCCCTGAGCTCCTTTGG + Intronic
928369489 2:30730916-30730938 CCCCGCCCCGTACCCTGCTTGGG - Intronic
931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG + Intergenic
934556050 2:95287538-95287560 CCCCGCCCCCGGAGCCCCTTGGG + Intronic
934983736 2:98869317-98869339 CTGTGCCCCGTGAGCTCCTTGGG + Intronic
936537432 2:113323142-113323164 CCCAGCCCCCTGCCCTGCTTGGG - Intergenic
946095488 2:217270762-217270784 CCCTGGGCCGTGACCTCCTGGGG - Intergenic
1171040537 20:21758557-21758579 CACCGCCCCTTTTCCTCCTTAGG - Intergenic
1173861653 20:46287802-46287824 CCCCGCCCCTTCACCTGCTGGGG + Intronic
1175215246 20:57389182-57389204 CCCCGCCCCCGGGCCCCCTTGGG - Intergenic
1176389495 21:6156320-6156342 CCCTGCCCAGGGACCTCCTATGG - Intergenic
1176549373 21:8214695-8214717 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1176557266 21:8258918-8258940 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1176568301 21:8397729-8397751 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1176576208 21:8441953-8441975 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1179733973 21:43381918-43381940 CCCTGCCCAGGGACCTCCTATGG + Intergenic
1180859504 22:19069225-19069247 ACCCTCCCTGTGACCTCCCTTGG - Intronic
1182049110 22:27299629-27299651 CCCCGCCCTGTGAGCTCTGTGGG - Intergenic
1184459183 22:44627590-44627612 CCCTGCTCCGTCACCTCCCTGGG + Intergenic
1184468683 22:44683565-44683587 CCCCAGCCCCTGCCCTCCTTCGG - Intronic
1184649530 22:45913220-45913242 CCCCTCCCCCTGCCCGCCTTGGG - Intergenic
1203254258 22_KI270733v1_random:131011-131033 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1203262314 22_KI270733v1_random:176090-176112 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
952316755 3:32238657-32238679 CCCCGCCCCCTCCCCTCCTCCGG + Exonic
953883972 3:46705292-46705314 CCCTGCCAGGTGGCCTCCTTTGG - Intronic
953931908 3:47009799-47009821 CCCTGGCCCGTGACCCCCTCTGG + Intergenic
955406173 3:58627079-58627101 CCTCGCCCCGGGAGCCCCTTGGG - Exonic
959062223 3:101626008-101626030 TCCCACCCCCTGACCTCCTGGGG - Intergenic
961394575 3:126578207-126578229 CACAGCCCCGGGTCCTCCTTAGG - Intronic
961531552 3:127543424-127543446 GCCCGCCCCTTCACTTCCTTTGG - Intergenic
964720497 3:159764299-159764321 TCCCGCCCCCAGGCCTCCTTGGG + Intronic
966574766 3:181487987-181488009 CCTCGGCCCCTGTCCTCCTTTGG + Intergenic
968001318 3:195208826-195208848 CCTCGCCCAGTGACCTCCCGGGG - Intronic
968548000 4:1208329-1208351 CCCTGCCCTGTGCCCTGCTTGGG + Intronic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
978348351 4:107795636-107795658 ACCCACCACGTGACCTGCTTTGG - Intergenic
979670021 4:123352005-123352027 CCCCGGCCAGCGACCTCCCTTGG - Intergenic
990376213 5:55173339-55173361 CCCCGCCCCGCCACCGCCTCCGG + Intergenic
992106393 5:73451813-73451835 CCAAGCCCAGGGACCTCCTTAGG + Intergenic
993520044 5:88889411-88889433 CCCCGCCCCTTCAGCTCCGTCGG - Intronic
997975371 5:138438937-138438959 CCCCGCCCCGGCACCTGCTGTGG - Intergenic
998461750 5:142314898-142314920 CCCCGCCCCGGGTCCGCTTTGGG + Exonic
1001134799 5:169093444-169093466 CCCTGCCCCAGGACCTCATTGGG - Intronic
1007394645 6:41570533-41570555 CCCCGCCCTCTGCCCTCCTAGGG - Intronic
1012927039 6:105278228-105278250 CCCCGCCCCGTGGCCCGCCTTGG + Exonic
1017725817 6:157275182-157275204 CCCGGCCCCGGGTCCTCCCTCGG - Intergenic
1018731221 6:166652658-166652680 TCCCACCCGGTGACCTGCTTGGG + Intronic
1019562158 7:1664603-1664625 CCCTGTCCCGGGACCTCCTCCGG + Intergenic
1024554707 7:50593354-50593376 CCCTTCCCCTTGACCACCTTAGG - Intronic
1028417548 7:90596260-90596282 GCCCGCCCCGCCTCCTCCTTCGG + Intronic
1030005848 7:105119019-105119041 CCCTGCCCACAGACCTCCTTAGG + Intronic
1035250062 7:157591189-157591211 CCCAGGCCCGTGCACTCCTTGGG - Intronic
1038450249 8:27634730-27634752 ACCCACCCTCTGACCTCCTTGGG + Intronic
1041997123 8:64076260-64076282 TCCCGCCTCCTGTCCTCCTTTGG - Intergenic
1049060715 8:140274014-140274036 CACCTCCCTGTGATCTCCTTGGG + Intronic
1049224096 8:141441456-141441478 CCCTGGCCTGTGACCTCCTAGGG - Intergenic
1049347765 8:142147870-142147892 CCCCACCCTGTGTCCACCTTTGG + Intergenic
1051418901 9:16871179-16871201 CACCGCCCCGTGACTTCTTTGGG + Intergenic
1051936245 9:22446721-22446743 CCCCGCCCCGGGCCCTCCCCCGG + Intergenic
1052871389 9:33510954-33510976 CCCCGCCTCCTGAGCTCCCTCGG - Intergenic
1053279155 9:36806128-36806150 CCCGGCCCTGTGGCCTCCTGTGG - Intergenic
1053397415 9:37787141-37787163 CCCCGCCCAGCCACCGCCTTCGG - Intronic
1056676184 9:88678861-88678883 CCCCGCCTCGTGAGCTCCTCAGG - Intergenic
1056747741 9:89318768-89318790 CCCCGCCTCGGGTCCGCCTTGGG + Intronic
1057316800 9:93974452-93974474 CCCCCCCCCGTGGCCCCATTGGG - Intergenic
1059309338 9:113377371-113377393 CCCCGGCTCCTGGCCTCCTTTGG + Intergenic
1060152829 9:121299741-121299763 CCCCGCCCCGCGCCCTCCCTGGG + Intronic
1060816472 9:126638008-126638030 CCCTGCCCGGGGACCTGCTTTGG + Intronic
1061502701 9:131012990-131013012 CCCAGCCCCGTGGCCTCCCTGGG - Intronic
1061853294 9:133428617-133428639 CCCCGCCCCCCGACCAGCTTCGG + Exonic
1062164707 9:135101798-135101820 CCACGCCCCGGGAGCTCCATGGG - Intronic
1203470659 Un_GL000220v1:114155-114177 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1203478480 Un_GL000220v1:158127-158149 CCCGGCCCCGCGTCCTCCCTCGG + Intergenic
1186425917 X:9464715-9464737 CCCTTCCCCGTGGCCTCCGTGGG - Intronic
1189331369 X:40146697-40146719 CCCGCCCCCGTGGCCTCCCTAGG + Intronic
1196393390 X:115233679-115233701 CCCCGTCCTGTCACCTGCTTGGG + Exonic
1198807450 X:140505369-140505391 CCTCCCCCCGTCACCTCCTCAGG - Exonic
1199954605 X:152733725-152733747 TCCGGCCCCGTGACTTCCCTGGG - Exonic