ID: 1139530996

View in Genome Browser
Species Human (GRCh38)
Location 16:67542710-67542732
Sequence AGTCCTACCCCCAGTGGTAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139530990_1139530996 -8 Left 1139530990 16:67542695-67542717 CCTCCCACCACTACAAGTCCTAC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530987_1139530996 12 Left 1139530987 16:67542675-67542697 CCCACAAAACCAGTATGTCACCT 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530983_1139530996 25 Left 1139530983 16:67542662-67542684 CCCACAAGTCCCACCCACAAAAC 0: 1
1: 0
2: 6
3: 127
4: 1393
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530985_1139530996 16 Left 1139530985 16:67542671-67542693 CCCACCCACAAAACCAGTATGTC 0: 1
1: 0
2: 2
3: 42
4: 458
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530982_1139530996 26 Left 1139530982 16:67542661-67542683 CCCCACAAGTCCCACCCACAAAA 0: 1
1: 0
2: 1
3: 27
4: 416
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530981_1139530996 27 Left 1139530981 16:67542660-67542682 CCCCCACAAGTCCCACCCACAAA 0: 1
1: 0
2: 3
3: 22
4: 322
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530988_1139530996 11 Left 1139530988 16:67542676-67542698 CCACAAAACCAGTATGTCACCTC 0: 1
1: 0
2: 0
3: 13
4: 304
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530984_1139530996 24 Left 1139530984 16:67542663-67542685 CCACAAGTCCCACCCACAAAACC 0: 1
1: 0
2: 2
3: 35
4: 375
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530989_1139530996 3 Left 1139530989 16:67542684-67542706 CCAGTATGTCACCTCCCACCACT 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1139530986_1139530996 15 Left 1139530986 16:67542672-67542694 CCACCCACAAAACCAGTATGTCA 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139530996 Original CRISPR AGTCCTACCCCCAGTGGTAT GGG Exonic
902254070 1:15176232-15176254 AGTCCTATGCCCAGTGTTAGAGG + Intronic
1071951118 10:90703435-90703457 ATTCTCACCCACAGTGGTATTGG - Intergenic
1072285468 10:93910367-93910389 AATCCTACCCCCAATGGCCTAGG + Intronic
1074559165 10:114519778-114519800 GGTCCTACCCCCAGTGCTGAGGG + Intronic
1079161706 11:18001061-18001083 ACACCTACCCCCAGTGACATAGG + Intronic
1082608952 11:55276540-55276562 ATTTCTACCCCCAGTGGCATTGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088095759 11:106099534-106099556 AGTCCTATGCAGAGTGGTATAGG + Intergenic
1093098099 12:14995066-14995088 AGCCCCACCCCCAGTGATATTGG + Intergenic
1093517436 12:20005253-20005275 AGTACTACACCCAGTGACATAGG - Intergenic
1099401252 12:82205801-82205823 AGTCCTAACCCTACTGGTAAGGG + Intergenic
1114195546 14:20473019-20473041 ACTCCTACCCCCAGTGAGAAGGG + Intronic
1117965353 14:61202163-61202185 ATTCCTAGCCCCAGTGGTCTTGG + Intronic
1121418313 14:93794627-93794649 AGTCCTACCCCCAACGTTAGGGG + Intergenic
1127396939 15:58550597-58550619 AGTCCTACCCTCAGGGGGCTCGG + Intronic
1129932803 15:79426281-79426303 CGTCCCACCCCTAGTGGTAGTGG - Intronic
1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG + Exonic
1144075892 17:11719180-11719202 AGTCCTCCCCACAGTGCTGTGGG + Intronic
1144104005 17:11969883-11969905 AGTCCTTGGACCAGTGGTATTGG + Intergenic
1146452364 17:32984902-32984924 AGTTCTACCCCCAGAGATTTTGG + Intronic
1150380835 17:64718141-64718163 AGCCCCACCTCCAGTGGCATAGG + Intergenic
1151273998 17:73020218-73020240 AGCACTAGCCCCAGTGGGATGGG + Intronic
1158410745 18:57203720-57203742 ACATCTACACCCAGTGGTATTGG - Intergenic
1167798544 19:51726329-51726351 AGTCCTCCGCCCAGTGGGAGGGG + Intergenic
929346886 2:40895313-40895335 ACCCCTACCCACAGTGATATTGG + Intergenic
930159935 2:48144618-48144640 AGTCCTACCCCTAGGGGAATGGG - Intergenic
930903215 2:56533264-56533286 CTTCCCACCCACAGTGGTATTGG - Intergenic
933398947 2:81766551-81766573 AGCCCTATCCCCAATGGTAAAGG - Intergenic
935090836 2:99893410-99893432 AGCCCTAACCCCAGTGTGATGGG + Intronic
935481085 2:103591380-103591402 AGTGCTGCTCCCAGTGGTCTGGG + Intergenic
945200085 2:207272475-207272497 AATCCAAACCACAGTGGTATGGG - Intergenic
1169353215 20:4886906-4886928 AGTCCTACCCACAGTGAAACAGG + Intronic
1170583465 20:17716294-17716316 AGTCCGACCTTCAGTGTTATAGG + Intronic
1174849246 20:53976110-53976132 AGTCCTGCCCCAAGTGGGATAGG + Intronic
1180017246 21:45095453-45095475 AGCTCTTCCCCCAGTGGTGTGGG + Intronic
1183003793 22:34883395-34883417 TGTCCTACCCTCAGTGGAAAAGG + Intergenic
1183387264 22:37522038-37522060 ACTCCCACCCACAGTGCTATGGG + Intergenic
1185089207 22:48756495-48756517 AGTCCTGGCCCCTGTGGTAGCGG - Intronic
950733812 3:14988367-14988389 ATTCCTTCTCCCAGTGGTTTGGG - Intronic
952657748 3:35807143-35807165 AATCCTACCCCCTGTGTTGTTGG + Intergenic
954153851 3:48674036-48674058 ACTCCTACCCCCAGAGGCCTTGG - Exonic
958036186 3:88172835-88172857 ATTCTTACCCACAGTGGTAGTGG + Intergenic
964190608 3:153996060-153996082 AGTACAACCCCCAGTGTGATAGG - Intergenic
969709794 4:8836140-8836162 AGAGTTACCCCCAGTGGTGTGGG - Intergenic
970027614 4:11640142-11640164 AGTCCTACCTCCACTTGTAAAGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
975820176 4:78262756-78262778 AGTCCTACCCCAAATTGTAGTGG + Intronic
976144700 4:82031283-82031305 AGTCCTCCCCCCATTTGTCTAGG + Intronic
977847396 4:101781741-101781763 ATATCTACCCACAGTGGTATTGG - Intronic
982455987 4:155610185-155610207 AGTCCCACCCCCATTGGTGAGGG - Intergenic
982456460 4:155615324-155615346 AGTCTCACCCCCAGTGGGAAAGG + Intergenic
986475261 5:8123662-8123684 AGTACTAACCCCAGTGGTAGAGG + Intergenic
987293464 5:16529758-16529780 AGTCCAACCCAGAGTGGAATGGG + Intronic
992133089 5:73714617-73714639 AGTCATACACCCAGAGATATAGG - Intronic
995738216 5:115326254-115326276 AGTCCTCCCAGCAGTGGTCTGGG - Intergenic
1000434581 5:161192556-161192578 ATTACTGCCCCCATTGGTATGGG + Intergenic
1004398386 6:15266453-15266475 AGTCCTTCCCCCAGCGGGAGAGG - Intronic
1020687487 7:11313652-11313674 ATTCCCATCCCCAGTGGGATGGG + Intergenic
1028669246 7:93382277-93382299 AGTCCTGCCTACAGTGGTACCGG - Intergenic
1030061384 7:105624067-105624089 AGGCCTACCGCCAGAGGTCTGGG + Exonic
1033200413 7:139363321-139363343 AGTCAGACCCCCAGTTATATGGG - Intronic
1038403598 8:27305420-27305442 AGGCCTGTGCCCAGTGGTATTGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039818601 8:41116533-41116555 AGTCCTAGCTCCTGTGGCATTGG + Intergenic
1042800431 8:72712288-72712310 AGGCCTACCCCCAGTCTTACTGG + Intronic
1048880951 8:138872182-138872204 ACTCCCACCCTCAGTCGTATTGG + Intronic
1051761612 9:20472517-20472539 TGCCCAACCCCCAGTGGTAGGGG - Intronic
1056502788 9:87226253-87226275 AGGCCCACCTCCAGTGGTAGAGG + Intergenic
1058584928 9:106497271-106497293 AGTGCAACCACCAGTAGTATTGG - Intergenic
1186483987 X:9918876-9918898 AATCCTAACCCCAATGGGATAGG - Intronic
1186891090 X:13959901-13959923 AGTAAGACCCCCAGTGATATAGG + Intergenic
1189195711 X:39150579-39150601 AGTCCTTCCCCCAGCCGGATGGG + Intergenic
1189752527 X:44237158-44237180 AGTCCAATCCCCAGAGATATGGG + Intronic
1194488678 X:94518979-94519001 AGTCCCACCCTCAGTGTTGTGGG - Intergenic
1194870523 X:99125899-99125921 ATCCCCACCCACAGTGGTATTGG + Intergenic