ID: 1139531341

View in Genome Browser
Species Human (GRCh38)
Location 16:67544139-67544161
Sequence GAGGATTTCCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 2, 2: 4, 3: 50, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139531341_1139531350 29 Left 1139531341 16:67544139-67544161 CCTTCCTCCTTCTGGAAATCCTC 0: 1
1: 2
2: 4
3: 50
4: 431
Right 1139531350 16:67544191-67544213 TGCATCATCTTCTTCCTTTCTGG 0: 1
1: 1
2: 3
3: 111
4: 408
1139531341_1139531346 6 Left 1139531341 16:67544139-67544161 CCTTCCTCCTTCTGGAAATCCTC 0: 1
1: 2
2: 4
3: 50
4: 431
Right 1139531346 16:67544168-67544190 CTTACCCCACTGTCTGCTGTCGG 0: 1
1: 0
2: 1
3: 13
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139531341 Original CRISPR GAGGATTTCCAGAAGGAGGA AGG (reversed) Intronic
901055651 1:6447702-6447724 GATGGTTTCCAGATGCAGGAGGG + Intronic
901404049 1:9034130-9034152 GAAGATATCCAGAAGGAAGGTGG - Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902478737 1:16700935-16700957 GATGGTTTCCAGATGCAGGAGGG - Intergenic
902661637 1:17908332-17908354 GAGGATTTGCAGAGGTAGTAAGG + Intergenic
902700136 1:18166825-18166847 GAGGATTTTCACAGGTAGGAAGG + Intronic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903166357 1:21523413-21523435 GAGTCTTTACAGAAGGAGGCAGG - Intronic
903616745 1:24665074-24665096 TAGGATTTAGAGATGGAGGAAGG + Intronic
904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
904945039 1:34192975-34192997 GAGGATTTTCAGCAGGGGAATGG + Intronic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905489486 1:38332436-38332458 GAGGGTTTCCAAAAAAAGGACGG - Intergenic
905516936 1:38568943-38568965 GAGGGCTTCCAGAAGTAAGAGGG + Intergenic
905707567 1:40073057-40073079 GTTGATCTCCAGAAGGAGAAAGG + Exonic
905932280 1:41797523-41797545 GAGAATTTCTGGTAGGAGGAGGG + Intronic
906282453 1:44563515-44563537 GAGAATTTCAAGAACGAGGGAGG - Intronic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908034976 1:60042052-60042074 GAGGACCTCAAGAAGGAAGAAGG - Intronic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
912493269 1:110074438-110074460 GTGGATTTCCAGAAGGGATAGGG + Intronic
914922074 1:151853910-151853932 GAATATTTCCAGAAGGATAAGGG + Intergenic
915029365 1:152863389-152863411 GGAGATATCCAGAAGAAGGAAGG + Intergenic
915433827 1:155887957-155887979 GGGGACTACCAGAAGGGGGAGGG - Intergenic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
915709591 1:157882808-157882830 GTGGCTTCCCAGAAGAAGGAAGG - Intronic
916815014 1:168343252-168343274 GAAGGTTTCCTGAAGAAGGAGGG + Intergenic
916815158 1:168344507-168344529 GAAGGTTTCCTGAAGAAGGAGGG - Intergenic
916927240 1:169535017-169535039 GGGGACTTCTAGAAGGGGGAAGG + Intronic
917268500 1:173247357-173247379 GAGTATGTTCTGAAGGAGGAGGG + Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
918650835 1:186961154-186961176 GAGGATTACCAGAAGCTGGGGGG + Intronic
918885830 1:190193117-190193139 CAGGATTTTCAGAAAGAGTAAGG - Intronic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
920210190 1:204322374-204322396 GAGAACTTCCAGAAGGATGCCGG - Intronic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
923434170 1:233952908-233952930 GATGATTTCCAAAAAGATGAGGG + Intronic
924071551 1:240285419-240285441 GAGGAGTTCAGGAAGGAGGTCGG + Intronic
924195765 1:241605187-241605209 GAGAAATTCCAGAACGAGTAAGG + Intronic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1063025946 10:2178852-2178874 GAGGATTGAAGGAAGGAGGAAGG - Intergenic
1063722482 10:8598351-8598373 TTGGATTTCCAGCAGGATGAAGG - Intergenic
1063902105 10:10744822-10744844 GAGGCTCTCTAGGAGGAGGAGGG + Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065566589 10:27017376-27017398 GTAGATTTCTAGAAGGATGATGG - Intronic
1066004275 10:31133031-31133053 GAGGATGTCCAGGTGGAGGCTGG - Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1067731363 10:48814042-48814064 CAGCATTTCCAGGAGGAGCAAGG - Exonic
1067840161 10:49669315-49669337 GAGAAATCCCAGAAGGAGGTGGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068662347 10:59635607-59635629 GAGGACTTTCATAAGGAAGATGG + Intergenic
1068835331 10:61546369-61546391 GAGGATTTCCATAAGGGCTAAGG + Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069833854 10:71296564-71296586 GGGGATCTCCTGCAGGAGGAGGG - Exonic
1071666223 10:87561525-87561547 GAGGATTCCCAAAAGAAGGATGG + Intergenic
1071848860 10:89548059-89548081 GAGAATTTCAAAAAGCAGGAAGG + Intronic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1074084067 10:110194217-110194239 GGGGATTTGGAGAAAGAGGATGG + Intergenic
1074750867 10:116585902-116585924 GTAGAGTTCCAGAAGGAGCATGG - Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076120020 10:127928487-127928509 GAGCACTTCCAAAAGAAGGAAGG - Intronic
1076489222 10:130845715-130845737 GAGACATTCCAGAGGGAGGATGG + Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1078478427 11:11655008-11655030 GAGGACCACAAGAAGGAGGAGGG + Intergenic
1078693373 11:13604274-13604296 GAGGATTTGAAGATGGAGAAGGG - Intergenic
1079019602 11:16898535-16898557 GAGCATTTCAAGAAGAAGCAAGG + Intronic
1079473169 11:20799860-20799882 GGGGACTACTAGAAGGAGGAAGG - Intronic
1080260853 11:30348259-30348281 GAGGATTTCCCACAGGAGGCAGG - Intergenic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1083573308 11:63771500-63771522 GGGTATTGCCAGAAGGAGAAAGG + Intergenic
1084516713 11:69641667-69641689 GGGTATTTTCTGAAGGAGGAAGG + Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084975949 11:72798439-72798461 GAGGATTTCAAGGTGGGGGAAGG + Intergenic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1087245851 11:95835891-95835913 GAGGTTATCCAGACAGAGGAGGG + Intronic
1087623581 11:100569922-100569944 GAGGATTTGCAGAAGTAGACAGG - Intergenic
1088849730 11:113695098-113695120 GGGGCTTTCCAGAAGAAAGATGG + Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089824345 11:121260808-121260830 TAGGATTTCCAGAATGAGTTTGG + Intergenic
1090469099 11:126963656-126963678 GATGATATCCAAAAGGAAGAAGG - Intronic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1091125069 11:133087441-133087463 GGGGACTTCTAGAAGGGGGATGG - Intronic
1092291364 12:7161260-7161282 GACGATGACAAGAAGGAGGAGGG - Intergenic
1092672714 12:10882297-10882319 GGGGCTTTCCAGGAGGAGGTGGG + Exonic
1092676980 12:10930978-10931000 GGGGCTTTCCAGGAGGAGGTGGG - Exonic
1092902352 12:13071753-13071775 GAGAATTTCAAGGAGGAGTAAGG + Intronic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1099648746 12:85396365-85396387 GAAGATTTCATGAAGGAGGTAGG - Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1102194176 12:111012663-111012685 GAGGGTTTCAGGAAGGAGGTTGG - Intergenic
1102299755 12:111762695-111762717 GAAGATTTCCATAAGGAGAGAGG + Intronic
1102952878 12:117041939-117041961 GAGGACTTCCTGAAGGTGGGTGG - Exonic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103798757 12:123523494-123523516 GAGGAGTTCCAGAAGCATGAAGG - Exonic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1105442875 13:20429992-20430014 GAGGAGTTCGGGGAGGAGGAGGG - Intronic
1105617225 13:22029914-22029936 GTGAATTTCCAGAAGGAGCTGGG - Intergenic
1107676205 13:42799879-42799901 GAGGATTCCTAGAGGGGGGATGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109663915 13:65504722-65504744 GAAGAGTTCCAGAAGGAGATGGG - Intergenic
1110220843 13:73071222-73071244 GAGGCTTTCTAGAAGGAGTGAGG + Intronic
1111436437 13:88215931-88215953 GAGTAGTTTGAGAAGGAGGAAGG + Intergenic
1112114783 13:96339902-96339924 AATTATTTCCAGAAGGAGGTGGG + Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113270287 13:108666029-108666051 AAGGCTTTTCAGAAGCAGGAAGG + Exonic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1116601820 14:46935577-46935599 GGGGATTCCCAGAAAGAGGCAGG - Intronic
1116787474 14:49303538-49303560 GAGGTCTTCCACAAGAAGGAAGG + Intergenic
1116802679 14:49459582-49459604 AAGGATCTCCAGCAGGATGAGGG + Intergenic
1117547237 14:56803888-56803910 GAGGATTTCTATACAGAGGAAGG + Intronic
1117652186 14:57918642-57918664 GAAAATTTGCAGAACGAGGAAGG + Intronic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1121380675 14:93463175-93463197 GAGAGTTTCAAGAAGGAGGGAGG + Intronic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1121687496 14:95848195-95848217 GAGGAATTGCAGAGGGAGGTGGG - Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1123083207 14:105705777-105705799 GAGGATTGGTAGACGGAGGATGG - Intergenic
1123153805 14:106206074-106206096 GGAGATTTCCAAAAGAAGGATGG + Intergenic
1124421101 15:29523099-29523121 GAGGCTTTGCACAAGCAGGAAGG + Intronic
1125532785 15:40424439-40424461 GAGGTCTTCCTGAAGGAGGCAGG - Intronic
1127267102 15:57371254-57371276 GAGGATTTCTTAGAGGAGGAGGG + Intergenic
1128357859 15:66941115-66941137 GAGGACTTCTGGAAGGAGGTGGG - Intergenic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130193255 15:81756042-81756064 GAGGATTTCAAGAAACAGGGAGG + Intergenic
1131066376 15:89437204-89437226 GAGGATGTGAAGCAGGAGGAAGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132436488 15:101808660-101808682 GAGAGTTTCCAAAATGAGGAAGG - Intronic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132500650 16:283275-283297 GAGGAAATCCCCAAGGAGGATGG + Exonic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135785412 16:25344544-25344566 GGAGGTTTCAAGAAGGAGGAAGG + Intergenic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1136851194 16:33613665-33613687 GAGCATTTTCAGAAGGGGAACGG + Intergenic
1137341745 16:47614122-47614144 GAGGTTTTCCTCATGGAGGAAGG + Intronic
1139138072 16:64229091-64229113 TAGGAATTCCAAAAGGTGGAGGG - Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139775471 16:69314291-69314313 TAGAATTTCCAAAAGGAGGGAGG + Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141688923 16:85585652-85585674 GAAGAGTTCCAGAACCAGGATGG - Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1143549567 17:7621731-7621753 GAGAAATTACAGAAGGAGGCTGG + Intronic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1148543717 17:48501056-48501078 GAGTCTTTCCTGAAGGAGGGCGG + Intergenic
1149607206 17:57933522-57933544 GAGAATTTGCAAAGGGAGGAAGG + Intronic
1151088954 17:71413293-71413315 GATTATTTCCAGAGGAAGGAGGG + Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151577413 17:74959716-74959738 GAGGGTTTCAAGATGCAGGAAGG - Intronic
1151647872 17:75445941-75445963 GAGGATTTCTTGAACCAGGAAGG + Intronic
1151898903 17:76998734-76998756 CAGGATTTACAGCAGGATGAAGG - Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152646881 17:81473297-81473319 GAGGAGTTCGAGGAAGAGGAGGG + Intergenic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153598110 18:6749932-6749954 GAGGATTCCAAGAAGGAAAAAGG + Intronic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1154098994 18:11451055-11451077 GAGGACTACTAGAAGCAGGAAGG + Intergenic
1155752828 18:29450464-29450486 GAGGATTTCAAGAATAAGCAAGG - Intergenic
1155778601 18:29801045-29801067 CAGGATTTCCAGAATTATGATGG - Intergenic
1156967586 18:43114027-43114049 TAGGATTTAAGGAAGGAGGAAGG - Intronic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158084903 18:53639637-53639659 GAGGAATGCCAAAAGGAGGGTGG - Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159689365 18:71466962-71466984 GAGGATTTGAGGAAGGAGCAGGG + Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160594725 18:79965210-79965232 GAGGATTTCCCGGAAGAGGCCGG - Intronic
1160761105 19:784928-784950 GAAGATGACCAGGAGGAGGAAGG + Intergenic
1161509743 19:4663736-4663758 GAGGCTTTGTAGAATGAGGATGG - Intronic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163286478 19:16351640-16351662 GGGGTTTTCCTGCAGGAGGAAGG + Intergenic
1167153943 19:47726642-47726664 GAGGATGTAAGGAAGGAGGAAGG - Intronic
1202712756 1_KI270714v1_random:26766-26788 GATGGTTTCCAGATGCAGGAGGG - Intergenic
925140248 2:1545102-1545124 GAGGATATTCAGTAGGAGAATGG - Intergenic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
927849783 2:26491617-26491639 GTGGATTTTCAGCAGGAGGAAGG + Intronic
927899700 2:26810555-26810577 TAGGATTTCCAGAAGAAGGTGGG + Intergenic
928063733 2:28141599-28141621 GAAGAATTCCAGAAGGAGCAAGG + Intronic
928415602 2:31089137-31089159 TAGGATTTCAAGGAGAAGGAGGG - Intronic
929224099 2:39495163-39495185 GAGTATTTCAAGAAGCAGGAAGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
931652849 2:64484110-64484132 GTGGTTTTACAGAAGAAGGAGGG - Intergenic
933478224 2:82819752-82819774 GAGGATATCCGTAATGAGGAGGG - Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
935122247 2:100193175-100193197 GAGGTTTTGCAGTAGGAGAAAGG + Intergenic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
936869381 2:117116252-117116274 GATGATTTCCAGAAATTGGATGG - Intergenic
937071829 2:119069655-119069677 GAGTATGTCCAGGAGAAGGAAGG + Intergenic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
937379550 2:121364261-121364283 GAGGATTGCCAGGAGGTGGCAGG - Intronic
938127557 2:128685517-128685539 GAGGATGTGAAGCAGGAGGAAGG + Intergenic
938241584 2:129746459-129746481 GGTGATTTCCAAAAGCAGGAGGG + Intergenic
938407180 2:131039173-131039195 GTGGCTCTCCAGGAGGAGGAAGG - Intronic
938663240 2:133508318-133508340 GAGGGCTTCCCCAAGGAGGAGGG - Intronic
938934213 2:136115118-136115140 GATGATTTCCAGGAGGATGAAGG + Exonic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939125305 2:138171142-138171164 GGGGACTACAAGAAGGAGGAAGG + Intergenic
941425084 2:165333203-165333225 TACCATTACCAGAAGGAGGATGG + Intronic
942964592 2:181876324-181876346 GAGGATTAGTGGAAGGAGGAAGG - Intergenic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
945268349 2:207913458-207913480 GAGAATTTCATGAAGGAAGAAGG + Intronic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
947476907 2:230458378-230458400 GAGTAGTTTGAGAAGGAGGAAGG + Intronic
947836460 2:233179486-233179508 GAGGCTTTAGAGAAAGAGGAGGG + Intronic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169603748 20:7291791-7291813 GAGAATTTCAAGAAAGAGGTGGG + Intergenic
1169701333 20:8450154-8450176 GAGCACTTCCAGGAGTAGGATGG - Intronic
1170144821 20:13161609-13161631 GAAAGTTTCAAGAAGGAGGAGGG + Intronic
1170599810 20:17832700-17832722 GAGGTGTTCCAGAAGAAGGAAGG + Intergenic
1171329505 20:24325266-24325288 GGAGACTTCAAGAAGGAGGAAGG + Intergenic
1171492673 20:25532298-25532320 TAGGATTTCCAGAAGAGGGAAGG + Intronic
1172299282 20:33837519-33837541 GAGGAATTTCAGAGAGAGGAGGG + Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173400574 20:42722407-42722429 GACTATTTCCAGGAGCAGGAGGG - Intronic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1174924117 20:54738312-54738334 GGGGTCTTCCAGAAGGTGGAGGG + Intergenic
1175030336 20:55947274-55947296 GGGAATCTCAAGAAGGAGGAGGG + Intergenic
1176139267 20:63537971-63537993 GAGGACTTCCCGGAAGAGGAGGG + Intergenic
1176686311 21:9851327-9851349 GAATATTTTCAGAAGAAGGAAGG - Intergenic
1178182564 21:30179638-30179660 GTGGCTTTCAAGATGGAGGACGG + Intergenic
1179154773 21:38840279-38840301 GGGGATTTCCAGAAGGAGACTGG + Intergenic
1180148754 21:45936867-45936889 GAAGATCCCCAGGAGGAGGATGG - Intronic
1180756584 22:18166135-18166157 GAGGTTCTCCAGACTGAGGACGG - Intronic
1180760412 22:18198157-18198179 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180770725 22:18382454-18382476 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180775257 22:18426539-18426561 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180808331 22:18737594-18737616 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180828669 22:18885413-18885435 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181071253 22:20342559-20342581 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181075185 22:20371298-20371320 GAGGTTCTCCAGACTGAGGACGG + Intronic
1181150973 22:20883330-20883352 GAGGCTATCCAGAGGGATGAGGG - Intronic
1181194328 22:21171508-21171530 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181215115 22:21321270-21321292 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1182398672 22:30057023-30057045 GGGAAGTTCCAGAAGGAGAAGGG + Intergenic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1203232561 22_KI270731v1_random:123626-123648 GAGGGTTGCCACAAGGACGACGG + Intergenic
1203278760 22_KI270734v1_random:111401-111423 GAGGGTTGCCACAAGGACGACGG + Intergenic
949412355 3:3779738-3779760 GTGTATTTCCACAAGGAAGAGGG + Intronic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
950426977 3:12929615-12929637 GTGGATTTTCAGCAGCAGGAAGG - Intronic
950575954 3:13832159-13832181 GAGGATCTTGAGGAGGAGGAGGG - Intronic
951330612 3:21363971-21363993 GAGGAATACAAGAAGAAGGAAGG + Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
955789229 3:62571434-62571456 GAGCTTTTGGAGAAGGAGGAAGG - Intronic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
959241768 3:103806074-103806096 GAGGATTACAAGACTGAGGAGGG - Intergenic
959829849 3:110847796-110847818 GAGGTTTGCCAGAAGAAAGAAGG + Intergenic
960367223 3:116787254-116787276 GAGGACTACAAGAAGGGGGAGGG - Intronic
961093972 3:124139037-124139059 GAGGACTTGCAGCAGGAGGCTGG + Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
963418714 3:145031542-145031564 GGGGATTTCTAGACAGAGGAGGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964097972 3:152955458-152955480 AAAGATTTCCAGCAGAAGGAAGG - Intergenic
964218771 3:154320560-154320582 GAGGATTTGCAGGAGGGAGAGGG - Intronic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
966838111 3:184065350-184065372 TTGGATTTCCAGAAGATGGAAGG - Intergenic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
970567209 4:17343316-17343338 TAGGATTTCGAGAAGGTGGGTGG - Intergenic
972050583 4:34727767-34727789 GATGTTTTCCTGGAGGAGGAGGG + Intergenic
975137926 4:70892598-70892620 GGAGGTTGCCAGAAGGAGGAAGG + Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975618748 4:76274687-76274709 TAGGTTTTCCAGGAGGAAGAAGG + Intronic
977257169 4:94754225-94754247 GAGGATATCCATGAAGAGGAAGG + Intergenic
977322826 4:95540535-95540557 GAGGAGATCCAGAAGGAAAAAGG + Intronic
978104955 4:104890809-104890831 GGGCATTCCCAGCAGGAGGAAGG + Intergenic
978949461 4:114540201-114540223 GGGGACTACTAGAAGGAGGAGGG - Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982419592 4:155178861-155178883 TGGGAGTTCCAAAAGGAGGAAGG - Intergenic
983504672 4:168539967-168539989 GGGGATTACTAGAAGGGGGAGGG - Intronic
984924527 4:184794925-184794947 GAGGATTTGCTGAAGAGGGACGG + Intronic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
984981353 4:185284934-185284956 GATGATTTTGAGAAGGATGATGG + Intronic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986295659 5:6435948-6435970 AATGCTTTCCAAAAGGAGGATGG + Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
986667883 5:10118910-10118932 GAGGACTTCAAGAAGGAAGTTGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
987760211 5:22152076-22152098 GAGGAATTCCAGAACGAGATGGG - Intronic
988308775 5:29529703-29529725 GAGGAATTACATAAGGAGAAAGG + Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988702043 5:33685239-33685261 GAAAACTTCCAGCAGGAGGAAGG + Intronic
988780209 5:34513797-34513819 GAGCTCTTCTAGAAGGAGGAAGG + Intergenic
988859969 5:35267513-35267535 GAAGGTTTCTAGAAGGAGGTGGG + Intergenic
989819324 5:45776250-45776272 GGGAATCTCCAGAAGGTGGAGGG - Intergenic
990847326 5:60157486-60157508 GAAGATTTAGAGAATGAGGAGGG + Intronic
990969300 5:61485387-61485409 GAGGATTTCAAGGAGGAAGCTGG - Intronic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
991894952 5:71385513-71385535 GAGGAATTCCAGAACGAGGTGGG - Intergenic
992102056 5:73417589-73417611 GAGGAATTCCTGGAGGAGGGAGG + Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
994603417 5:101937002-101937024 GAGGATTACTAGAGGGCGGAGGG - Intergenic
995115147 5:108471001-108471023 GAGGATCTCCAGAAGGATTGAGG + Intergenic
996576644 5:124983268-124983290 GAGGACTACTAGAAGGAGAAGGG - Intergenic
997025853 5:130060054-130060076 CAGGTTTTCCAGAAGGAGTTAGG - Intronic
997864209 5:137446520-137446542 GAGGAATTCCCATAGGAGGAAGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
999371259 5:151056681-151056703 GTGGATTCCCAGGAGCAGGAAGG + Intronic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1001155789 5:169271538-169271560 GAGGGTTTCAGGAAGGAGGCAGG + Intronic
1002479045 5:179487265-179487287 GAGGGTTTCACAAAGGAGGAAGG - Intergenic
1003097404 6:3153879-3153901 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1003106944 6:3224767-3224789 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1003455288 6:6276238-6276260 GAGGATTGGAAGCAGGAGGAGGG + Intronic
1003601608 6:7522632-7522654 GAGTTTTTCCTGAATGAGGATGG + Intergenic
1003788122 6:9510884-9510906 GAGAATTGCCAGAACCAGGAAGG - Intergenic
1004756028 6:18611314-18611336 GGAGATTTCCAGAAGGCTGAAGG + Intergenic
1004884022 6:20034844-20034866 CAGAATTTCCAAAAGGAGGGAGG + Intergenic
1005001475 6:21246148-21246170 GAGGATCTCCAGAAAGAAGTTGG - Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1007751985 6:44076489-44076511 AATGATTTCCCGAAGCAGGAAGG - Intergenic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008600525 6:53089439-53089461 GAAGATTTTCAGAAGAAGCAAGG + Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1012581478 6:100875242-100875264 TAGGATTTAAAGAAGGAGAAAGG + Intronic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013181258 6:107718695-107718717 CAGGATTTCCAGCAGTAAGAGGG - Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014249113 6:119097986-119098008 GAGGTTTTGCATCAGGAGGAGGG + Intronic
1015159709 6:130138949-130138971 GAAGATGTCCAGAGAGAGGAAGG + Intronic
1015193642 6:130500944-130500966 GAGAATTTCAAGACTGAGGAAGG + Intergenic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015691031 6:135923029-135923051 GAGGTTTTCCAGAAGGTGGTTGG - Intronic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1017506437 6:155072805-155072827 GAGGAGTTCAGGAAGGAGGCTGG + Intronic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1019132835 6:169890116-169890138 GAGGATTTACAGCAGGCGGCTGG - Intergenic
1021349173 7:19568468-19568490 TAGTATTGCCAGAAGTAGGATGG + Intergenic
1022664244 7:32395361-32395383 AAAGATTTCCAGAAAGATGAGGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023789602 7:43742928-43742950 GTAGATTCCCAGAAGTAGGATGG - Intergenic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1025101098 7:56135904-56135926 GAGGTTTTGCAGCAGGAGAAAGG + Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1026317767 7:69241948-69241970 GAGGTTTTGCAGCAGGAGAAAGG + Intergenic
1026318251 7:69246161-69246183 GAGGTTTTGCAGCAGGAGAAAGG - Intergenic
1026807926 7:73439312-73439334 GAAAATGTCCAGAAGGAGCATGG + Intergenic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027430096 7:78103025-78103047 GAGGAATTCCAGATAGAAGAAGG - Intronic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1029886367 7:103876994-103877016 GAGCATTTCCAGAAGGGGTGAGG - Intronic
1031361031 7:120848508-120848530 GAAGTTTTCCAGAAGAAAGATGG + Intronic
1031659289 7:124400114-124400136 GGGGATTTCCAGGAAGAGGGAGG + Intergenic
1032453465 7:132054169-132054191 GAGGAATTCCAGTGAGAGGAGGG + Intergenic
1032644642 7:133809329-133809351 GAGGATTGGCACAATGAGGATGG + Intronic
1032676726 7:134136296-134136318 GATCATTTCCATAAGGAGGTTGG - Intronic
1032884653 7:136124517-136124539 GAGGATCATCACAAGGAGGAGGG + Intergenic
1033560837 7:142528901-142528923 GAAGACTTCCCGAAGGCGGAGGG + Intergenic
1033667780 7:143459175-143459197 GAGGATATCTGGATGGAGGAAGG - Intergenic
1035223965 7:157423629-157423651 GCGGATTCCCAGAAGTGGGATGG + Intergenic
1035291680 7:157843462-157843484 GAGGAGCTCCAGGTGGAGGAAGG - Intronic
1035688991 8:1547523-1547545 GGGGCCTGCCAGAAGGAGGAAGG + Intronic
1036155114 8:6334585-6334607 TATGATTTCCAGGAGGAGAAGGG - Intergenic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1042360433 8:67876859-67876881 GGGGAATACAAGAAGGAGGAAGG + Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1044009122 8:86970259-86970281 GTGAAATTCCAGAAGGAGTAGGG - Intronic
1044936953 8:97302617-97302639 GGGGAGTTCCAGATGGAGGTGGG - Intergenic
1045964333 8:108006619-108006641 GAGGAATTCAAGAAGAAAGAAGG + Intronic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1048149896 8:131884038-131884060 GAAGATAACCAGAAGGATGAAGG + Intergenic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049309512 8:141925889-141925911 TAGGACTTCCAGGAGGAGGGAGG + Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1050267574 9:3906940-3906962 GAGGAGTTACATTAGGAGGAGGG - Intronic
1051798780 9:20907484-20907506 GAGGATGTCCAGAAGGCAGCAGG - Intronic
1052643054 9:31194063-31194085 TAGGATTTCCATAAAGAGAAAGG - Intergenic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1056488508 9:87082885-87082907 CAGAATTTCCAGAAGGTGAATGG - Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056847719 9:90055261-90055283 GATGCTTTCCAGAAGGAGGGTGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062015701 9:134290117-134290139 GAGGATTTGCACAAGGACCATGG + Intergenic
1062325199 9:136009520-136009542 GTTGCTTTCCAGAAGGAGGTGGG - Exonic
1062407331 9:136403183-136403205 GAGGGTTTCCAGAGCGGGGAGGG + Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186271263 X:7890863-7890885 GGGGATTACTAGAAGGGGGAGGG + Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1188575522 X:31645273-31645295 GAGACTTCCCACAAGGAGGATGG - Intronic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1190037512 X:47039560-47039582 GGGGATTACTAGAGGGAGGAGGG - Intronic
1191143585 X:57140816-57140838 TAGGATTTCCAAAAAGAGGGAGG + Intergenic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192434458 X:71134412-71134434 GATGATCTCCAGGAGGAGCATGG - Exonic
1192564541 X:72152775-72152797 TAGGATTTCCAGAATTAGGAAGG + Intergenic
1192838224 X:74825387-74825409 GAGGACTTCCAGATGGTGGGGGG - Intronic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194946227 X:100071275-100071297 AAGGATTTTCAGACGGGGGAAGG - Intergenic
1195451082 X:105013713-105013735 GAGGATTTTCAGTAGGCAGAAGG - Intronic
1195656873 X:107340251-107340273 AAAGACTTCCAGAAGGAGGTGGG + Intergenic
1195676542 X:107511399-107511421 GCTGATTTCCAGAAGCAGCAGGG - Intergenic
1196765366 X:119237070-119237092 GGGGATTCCTGGAAGGAGGAGGG + Intronic
1197325264 X:125084888-125084910 GAGAATTTCCAGAATGTGAATGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1197949028 X:131874219-131874241 GAGTAGTTCCAGAAGGTGTAAGG - Intergenic
1198162576 X:134022194-134022216 GAGTGTTTCAAGAATGAGGAAGG - Intergenic
1199271155 X:145883785-145883807 CAGGAGTTCTAGAAGTAGGAAGG + Intergenic
1200033208 X:153312651-153312673 GGGGCTTTCCAGGAGGAGAATGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1201242769 Y:11974757-11974779 TGGGATTCCCAGAAGGAGAATGG - Intergenic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic
1202127283 Y:21579793-21579815 GACGCTTTCCACAATGAGGAAGG - Intergenic