ID: 1139534614

View in Genome Browser
Species Human (GRCh38)
Location 16:67563363-67563385
Sequence TCGGCGGAGACGGAGACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139534614_1139534622 14 Left 1139534614 16:67563363-67563385 CCGCTGGTCTCCGTCTCCGCCGA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1139534622 16:67563400-67563422 GCTGCAGCGGCTGCGAGCAGAGG 0: 1
1: 0
2: 1
3: 19
4: 294
1139534614_1139534621 1 Left 1139534614 16:67563363-67563385 CCGCTGGTCTCCGTCTCCGCCGA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1139534621 16:67563387-67563409 TGGCGCAGGCGGCGCTGCAGCGG 0: 1
1: 1
2: 0
3: 32
4: 776
1139534614_1139534618 -10 Left 1139534614 16:67563363-67563385 CCGCTGGTCTCCGTCTCCGCCGA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1139534618 16:67563376-67563398 TCTCCGCCGAGTGGCGCAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 47
1139534614_1139534623 15 Left 1139534614 16:67563363-67563385 CCGCTGGTCTCCGTCTCCGCCGA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1139534623 16:67563401-67563423 CTGCAGCGGCTGCGAGCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139534614 Original CRISPR TCGGCGGAGACGGAGACCAG CGG (reversed) Intronic
900524325 1:3121115-3121137 TCAGCGGAGGCTGAGGCCAGAGG + Intronic
900811453 1:4804597-4804619 TCCGAGAAGACTGAGACCAGTGG + Intergenic
901438599 1:9264153-9264175 TCGGACCAGGCGGAGACCAGCGG - Exonic
901835720 1:11922844-11922866 TCGGTGGAGATGTAGAGCAGTGG + Exonic
904604722 1:31692160-31692182 TCAGGGGAGACAGAGACCAGGGG - Intronic
907288449 1:53397052-53397074 TCGGGGGAGACAGAGAGCTGAGG + Intergenic
918736940 1:188076541-188076563 TTGGTGGAAACTGAGACCAGAGG - Intergenic
919804391 1:201372548-201372570 TCTGAGGAGAGGGAGATCAGGGG - Intronic
922153143 1:223022003-223022025 ACAGCAGAGACAGAGACCAGGGG - Intergenic
1067214709 10:44292884-44292906 TCGGAGGAGCGGGAGCCCAGGGG + Exonic
1075940459 10:126387190-126387212 GCGGCGGCGGCGGAGACCCGGGG + Intronic
1079519761 11:21312880-21312902 TCAGAGGAGAGGGAGATCAGGGG + Intronic
1081931849 11:46876990-46877012 TTGGCAGAGACGGAGAGAAGAGG + Intronic
1082782643 11:57299706-57299728 GCGGGGCAGACGGAGACCTGGGG + Exonic
1083334416 11:61914362-61914384 TCTGGGGAAACTGAGACCAGGGG + Intronic
1083573102 11:63770198-63770220 TCCGCGGCGACAGAGCCCAGAGG - Intergenic
1088338228 11:108732506-108732528 TCGGCGTAAATGGAGACGAGAGG + Intronic
1103193786 12:119024880-119024902 TAGGAGGAGAAGGAGACCACTGG + Intronic
1113288013 13:108874924-108874946 TCGCCAGAGATGGAGGCCAGTGG + Intronic
1114563760 14:23612775-23612797 GCGGCGGAGATGGAGAGAAGCGG + Intergenic
1116867221 14:50040536-50040558 TCAGATGAGACGGAGTCCAGTGG - Intergenic
1122145107 14:99684261-99684283 TCGGCGGGGGCGGAGCCGAGCGG + Intergenic
1124372096 15:29109853-29109875 TTGGCAGAGACGAGGACCAGCGG - Intronic
1127961859 15:63896040-63896062 TCGGGGGAGGCGGTGATCAGAGG - Intergenic
1129059578 15:72849943-72849965 TAGGCAGAGACAGACACCAGGGG - Intergenic
1129219817 15:74125344-74125366 TGGAGGGAGACTGAGACCAGAGG - Intronic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1132055759 15:98649320-98649342 TCGGCGGAGTCGGGAACCCGAGG - Exonic
1132810497 16:1794548-1794570 CAGGTGGAGACGGAGCCCAGGGG - Intronic
1132867385 16:2100198-2100220 TCGGTGGAGACGGAGGCCAACGG - Exonic
1134524392 16:14932917-14932939 TCGGTGGAGACGGAGGCCAACGG + Intronic
1134531587 16:14988485-14988507 TCGGTGGAGATGTAGAGCAGTGG + Intronic
1134548509 16:15128024-15128046 TCGGTGGAGACGGAGGCCAACGG - Intronic
1134711980 16:16331404-16331426 TCGGTGGAGACGGAGGCCAACGG + Intergenic
1134719838 16:16374697-16374719 TCGGTGGAGACGGAGGCCAACGG + Intergenic
1134947588 16:18337188-18337210 TCGGTGGAGACGGAGGCCAACGG - Intergenic
1134954848 16:18377290-18377312 TCGGTGGAGACGGAGGCCAACGG - Intergenic
1137972575 16:53000673-53000695 TGGGCTGGGACAGAGACCAGTGG + Intergenic
1139534614 16:67563363-67563385 TCGGCGGAGACGGAGACCAGCGG - Intronic
1142517365 17:441429-441451 TCGGCGCAGATGGAGGCCATCGG + Exonic
1144695794 17:17303313-17303335 CCGGCGGAGGCGGAGCCCCGGGG - Exonic
1144871099 17:18371585-18371607 AGGGTGGAGACGGAGACCACAGG - Intergenic
1151535462 17:74736815-74736837 TCGGCGGAGGCGCAGCCCAGGGG + Intronic
1160927876 19:1555774-1555796 TCGGAGGCGCCGGAGTCCAGGGG + Exonic
1161682533 19:5687236-5687258 CCGGCAGAGGCGGAGCCCAGGGG - Intronic
1162403357 19:10459377-10459399 CTGGTGGAGACGGAGGCCAGAGG - Intronic
936104948 2:109615240-109615262 TCCGCGGAGGAGGAGAGCAGCGG + Exonic
940641231 2:156346368-156346390 TCTGAGGAGGCGGAGACCATTGG - Intergenic
940918924 2:159286675-159286697 CCGGCGGAGACCCAGAGCAGAGG + Intronic
1175337075 20:58203591-58203613 TCGGGGGAGAGGGGGACAAGTGG + Intergenic
1176060836 20:63172201-63172223 CAGGGGGAGACAGAGACCAGGGG + Intergenic
1176222533 20:63976820-63976842 TCTGCGGAGATGAAGAACAGAGG + Intronic
1183370276 22:37427961-37427983 TCAGCGGAGGCGGAGTCCAGGGG - Intergenic
960508987 3:118525706-118525728 ACGGCGGAGAAGGAGAGAAGAGG - Intergenic
962787787 3:138784427-138784449 GAGACGGAGACGGAGACGAGAGG - Intronic
969298095 4:6281298-6281320 TGGGCAGAGAGGGAGCCCAGTGG + Intronic
973620695 4:52722547-52722569 TCGGCCGAGAAGCAGACCGGCGG - Intergenic
985253120 4:188042940-188042962 TTGTCGGAGAATGAGACCAGGGG + Intergenic
986717254 5:10533383-10533405 TCGGAGGAGACGGAGGGCTGGGG - Intergenic
1005959924 6:30687262-30687284 GGGACGGAGACAGAGACCAGGGG + Exonic
1012475795 6:99613803-99613825 TCCGGGGGGACGGAGAGCAGAGG - Exonic
1013169663 6:107625269-107625291 TGGGCAGAGATGGATACCAGGGG + Intronic
1015213414 6:130722462-130722484 TCAGCAGATACGGTGACCAGCGG + Intergenic
1019421930 7:954628-954650 GCGGCGGCGGCGGAGCCCAGAGG - Intronic
1020049634 7:5072931-5072953 CTGGCGGAGACGGAGAGCTGCGG + Exonic
1025230971 7:57203209-57203231 TTGGAGGACAGGGAGACCAGGGG - Intergenic
1029507323 7:100970102-100970124 TCGGGAGAGAGGGAGTCCAGAGG + Intronic
1035561100 8:604023-604045 TTGGAGGAGAGGGAGAGCAGAGG - Intergenic
1035779406 8:2216152-2216174 TCGGGGCACAGGGAGACCAGAGG + Intergenic
1043690102 8:83140684-83140706 TGGGCTGAGAGGGAGATCAGGGG + Intergenic
1046934069 8:119869739-119869761 TCGGCTGTGCTGGAGACCAGAGG - Intergenic
1050744158 9:8857790-8857812 TGGGCGGCGGCGGCGACCAGGGG - Intronic
1061548515 9:131318606-131318628 TATGAGGAGACGGAGGCCAGCGG - Intergenic
1061993917 9:134174597-134174619 TCTGCGGAGCCCTAGACCAGGGG - Intergenic
1187367403 X:18676218-18676240 AAGGAGGAGACTGAGACCAGAGG - Intronic
1192240289 X:69322999-69323021 TGGGGGGAGACGGAAACCAGAGG + Intergenic
1193798376 X:85905276-85905298 TCAGTGGAGACGGAGAGAAGAGG - Intronic
1196704506 X:118705216-118705238 TCAACTGAGACGGAGAACAGAGG - Intergenic
1198494663 X:137179685-137179707 TCGGCTGAGATGGAGAACACTGG - Intergenic