ID: 1139535638 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:67571317-67571339 |
| Sequence | CCTGGAGTTGGAGGATTTGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 270 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 23, 4: 243} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139535630_1139535638 | 16 | Left | 1139535630 | 16:67571278-67571300 | CCATTTTTTCTATCTTAAAAATG | 0: 1 1: 0 2: 13 3: 152 4: 1461 |
||
| Right | 1139535638 | 16:67571317-67571339 | CCTGGAGTTGGAGGATTTGTTGG | 0: 1 1: 0 2: 3 3: 23 4: 243 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139535638 | Original CRISPR | CCTGGAGTTGGAGGATTTGT TGG | Intronic | ||