ID: 1139535638

View in Genome Browser
Species Human (GRCh38)
Location 16:67571317-67571339
Sequence CCTGGAGTTGGAGGATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139535630_1139535638 16 Left 1139535630 16:67571278-67571300 CCATTTTTTCTATCTTAAAAATG 0: 1
1: 0
2: 13
3: 152
4: 1461
Right 1139535638 16:67571317-67571339 CCTGGAGTTGGAGGATTTGTTGG 0: 1
1: 0
2: 3
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139535638 Original CRISPR CCTGGAGTTGGAGGATTTGT TGG Intronic