ID: 1139542986

View in Genome Browser
Species Human (GRCh38)
Location 16:67632456-67632478
Sequence CAGGCTGACGTCCCTTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139542986_1139542991 -4 Left 1139542986 16:67632456-67632478 CCCAGAAAAGGGACGTCAGCCTG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1139542991 16:67632475-67632497 CCTGGGCTCCATGCCACTGTTGG 0: 1
1: 0
2: 0
3: 29
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139542986 Original CRISPR CAGGCTGACGTCCCTTTTCT GGG (reversed) Intronic
904663176 1:32100306-32100328 CACGCTGACTTTCCTTTTCTGGG - Intronic
905859848 1:41342864-41342886 CAGGCTGTGCTTCCTTTTCTGGG - Intergenic
906953472 1:50352781-50352803 CAGGCTTCTGTCCCATTTCTCGG + Intergenic
910373862 1:86548382-86548404 CTGGCTGACATCCCAATTCTTGG - Intronic
918706375 1:187667954-187667976 CAGGCTTACCTCACATTTCTTGG - Intergenic
922728955 1:227940199-227940221 TGGGCTGACTGCCCTTTTCTGGG + Intronic
923145362 1:231194022-231194044 CAGGGTGAGGGCCCTCTTCTGGG - Intronic
1063235238 10:4107493-4107515 CATAATGACTTCCCTTTTCTTGG - Intergenic
1067044948 10:42980252-42980274 CATGCGGACGTCCCTTTACCTGG - Intergenic
1078030683 11:7748218-7748240 CAGTCTGACCTTCCATTTCTGGG + Intergenic
1084500713 11:69533725-69533747 GAGGCTGACGTACCTCTCCTTGG + Intergenic
1086862972 11:91947156-91947178 CAGACTGAGGTCTCATTTCTAGG + Intergenic
1088875543 11:113933201-113933223 CCCGCTGAAGTCCCTGTTCTTGG - Intronic
1090103805 11:123830117-123830139 CAGGCTGTCATCGCTTCTCTTGG + Intergenic
1090743751 11:129690933-129690955 CAGGAGGACTTCCTTTTTCTTGG - Intergenic
1097136026 12:56856483-56856505 CAGGGTGACTTACCTTCTCTTGG + Intergenic
1097443769 12:59644514-59644536 CAGGCTGGAGTGCATTTTCTTGG - Intronic
1100186705 12:92146493-92146515 GAGGCTGCAGTCCTTTTTCTTGG - Intergenic
1101730507 12:107423384-107423406 CAGGTTCACCTTCCTTTTCTTGG - Intronic
1104337282 12:127911153-127911175 CAGGCTGGCGTGCCATGTCTTGG - Intergenic
1104534008 12:129600945-129600967 CAGGCTGACTTCCTTGTTGTTGG - Intronic
1115725992 14:36216724-36216746 CCCACTGACATCCCTTTTCTGGG - Intergenic
1124412362 15:29446956-29446978 CAGGATTACATCCCTTTTCGAGG + Intronic
1124686941 15:31790866-31790888 CAGGCTGAGGTCCCCTTTTCAGG + Intronic
1125729786 15:41886645-41886667 CAGGCTGCTGTTCTTTTTCTAGG + Intronic
1127596230 15:60485247-60485269 CAGGATAACTTCCCTTTTGTGGG - Intergenic
1128153370 15:65377263-65377285 CAGGCTGCTGTCCCCTGTCTTGG + Intronic
1128769988 15:70274814-70274836 CAGGATGACCTGCTTTTTCTAGG - Intergenic
1129534663 15:76302889-76302911 CAGGCTGGCGTCCAATTCCTGGG + Intronic
1129741334 15:77991082-77991104 CTGGCTGAGGACTCTTTTCTAGG - Intronic
1130354682 15:83118492-83118514 CAGGCCCACGTCCCTTCTCTTGG - Intronic
1132327665 15:100985259-100985281 AAGGCTGACCTGCCTCTTCTCGG + Intronic
1135686274 16:24500630-24500652 CACGCTTACTTCTCTTTTCTTGG - Intergenic
1139542986 16:67632456-67632478 CAGGCTGACGTCCCTTTTCTGGG - Intronic
1142275468 16:89116471-89116493 TAGGCTCACGCCCCTTTGCTGGG + Intronic
1144733861 17:17543969-17543991 AAGGCTGAGGTCCCATTTCGAGG + Intronic
1146610360 17:34299499-34299521 CAAGGTCACGTCCCATTTCTGGG - Intergenic
1146931135 17:36778747-36778769 CAGGCTGCCCTCCCGTTTCAGGG - Intergenic
1151439780 17:74120664-74120686 CTGGCTGCCTTCCCTTCTCTGGG - Intergenic
1153683273 18:7521503-7521525 CAAGCTGATGTCCTCTTTCTGGG - Intergenic
1154105679 18:11520754-11520776 CAGGCTGGAGTCCCGATTCTTGG + Intergenic
1155311534 18:24529127-24529149 CAGGCTGACGCCCCTATTCCTGG - Intergenic
1156211360 18:34946896-34946918 CAGGCTGACCTCCAATTCCTGGG - Intergenic
1156701340 18:39829245-39829267 AAGGTTGAACTCCCTTTTCTGGG + Intergenic
1157966150 18:52210636-52210658 CTCCCTGTCGTCCCTTTTCTAGG - Intergenic
1159002299 18:62985051-62985073 AAGGCAGCCGTCCATTTTCTGGG + Intergenic
1167122987 19:47530070-47530092 CAGGCTGAGCTCCAATTTCTGGG + Intronic
1168240126 19:55084655-55084677 CAGGCTGAGGTCCCTCTTATTGG + Intronic
1168605679 19:57758381-57758403 CAGGCTGAGGCCCCTATTCTAGG + Intergenic
925033503 2:670112-670134 CAGGGTGACGTCTCTCTGCTGGG - Intronic
926788650 2:16546906-16546928 CATGCTAACTTTCCTTTTCTGGG - Intergenic
932467928 2:71935282-71935304 CAGACTGACTTCCCTGATCTGGG + Intergenic
934130093 2:88939510-88939532 CAGGCTGATGTCTCTGTACTGGG + Intergenic
934134830 2:88985306-88985328 CAGGCTGATGTCTCTGTCCTGGG + Intergenic
934235476 2:90228448-90228470 CAGGCTGATGTCTCTGTCCTGGG - Intergenic
934985535 2:98882136-98882158 CCGGCTGAGTTCCCATTTCTAGG - Intronic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
938639424 2:133264848-133264870 CAGCCTCCCTTCCCTTTTCTGGG - Intronic
939988594 2:148855953-148855975 AAGGCTCACCTCCCTTTTCCAGG + Intergenic
940592555 2:155748373-155748395 AAGGCTGCCGTCCCTCTTCCAGG - Intergenic
944698622 2:202225727-202225749 CATGCTGACCCCCCTCTTCTTGG + Intronic
945276224 2:207990080-207990102 CCAGCTGACGTCCCTTTACATGG + Intronic
946108716 2:217395164-217395186 AAGGCTGATGTCACTTCTCTAGG + Intronic
946397675 2:219451452-219451474 CAGGTTGCCCTCCCTTCTCTCGG - Intronic
946498666 2:220222194-220222216 CAGGCTTACGTCCACTTTTTGGG - Intergenic
948378920 2:237540021-237540043 CAGGCTGACGTCCTTACTCTAGG - Intronic
1172032612 20:31992479-31992501 CAGGCTGAGGTCCCTGTCCTGGG + Intronic
1172689206 20:36778862-36778884 CCAGCTGAGGTCCCTCTTCTTGG + Exonic
1174772820 20:53317214-53317236 CAGGCTGAACTCCCTAGTCTTGG + Intronic
1175276235 20:57772774-57772796 CAGGCTGAGGACCTTTTCCTTGG + Intergenic
1176069589 20:63219063-63219085 CTGGGTGACCTCCCTTTTCCTGG - Intergenic
1181026222 22:20129310-20129332 CAGGCTGACTTCCTTCATCTGGG + Intergenic
1181057980 22:20268747-20268769 CAGGCCTAGGTCCCTTCTCTAGG - Intronic
1181437558 22:22919421-22919443 CAGCCTGAGGTCCCTATCCTGGG + Intergenic
1181491932 22:23265570-23265592 CGGGCTGACTTCCCTGCTCTGGG + Intronic
1183566946 22:38622351-38622373 CAGGCAGAAGCCCCATTTCTGGG + Intronic
1183832335 22:40424963-40424985 CAGGCAAACATCCCCTTTCTGGG - Intronic
949564952 3:5235981-5236003 CAGCCTGAGGTCCCTTTATTAGG + Intergenic
952835278 3:37596835-37596857 CACGCTGACCTCCCTTAGCTTGG - Intronic
955089138 3:55732121-55732143 CAGGATTATCTCCCTTTTCTAGG - Intronic
958091482 3:88882196-88882218 CAGGCAGACCTCACTTTTCACGG + Intergenic
960971235 3:123141575-123141597 CAGGCTGACCTCCCCTGACTGGG - Intronic
961773293 3:129265847-129265869 GAGGCTCAGGTCCCTTTGCTGGG - Intronic
962371011 3:134820717-134820739 CAGGCTGCTTTCTCTTTTCTTGG + Intronic
966580325 3:181554812-181554834 CAGGCTTACATTACTTTTCTTGG - Intergenic
966953034 3:184841640-184841662 CAGGCTGACAGAACTTTTCTAGG - Intronic
969868037 4:10087863-10087885 CACGCTGACGTCCCAAATCTTGG + Exonic
970108033 4:12607193-12607215 CAGGCTGACATGCCTTTTACAGG + Intergenic
971572513 4:28231383-28231405 GAGGCTTTCTTCCCTTTTCTGGG + Intergenic
982980611 4:162129558-162129580 AAGGCTTAAGTCCCTTCTCTGGG - Intronic
986270154 5:6223074-6223096 CAAGCAGACCTGCCTTTTCTGGG - Intergenic
990362138 5:55031254-55031276 TAGGCGGGCGTCCCTGTTCTGGG - Intronic
999085854 5:148888888-148888910 CAGGCTCACCTCCCTTCTCCTGG + Intergenic
999190614 5:149744142-149744164 CAGCCTGAAGTTCATTTTCTTGG - Intronic
1002229743 5:177754087-177754109 CAGCCTGTCATCCCTTTCCTTGG - Intronic
1016458690 6:144259072-144259094 CAGGCTGACCTCAAATTTCTAGG + Intergenic
1017496323 6:154986907-154986929 CTGGCTGAAGTCCATTGTCTAGG + Intronic
1021103468 7:16610087-16610109 CAGACTTAGTTCCCTTTTCTAGG + Intronic
1024709664 7:52001270-52001292 GAGACTGACTTCCCTTTCCTTGG - Intergenic
1025610428 7:63072217-63072239 CAGGGTGACGTGCCTTCTCTGGG - Intergenic
1027701553 7:81476213-81476235 AAGGGTGAGGACCCTTTTCTGGG + Intergenic
1031058382 7:117020314-117020336 AAGGCCGACGTGCCTCTTCTGGG - Intronic
1031131460 7:117837864-117837886 CAGGTGGATGTCACTTTTCTGGG - Intronic
1032528802 7:132603046-132603068 CAGGCTAACAGCTCTTTTCTGGG - Intronic
1037888525 8:22608070-22608092 GAGGATGATGTCCCTTTTTTTGG + Intronic
1043291904 8:78612441-78612463 CAGGCTTACTCCCCTTTTCTTGG + Intergenic
1047664568 8:127076517-127076539 CCTGGTGACGTCCCTTTTCCTGG - Intergenic
1048572742 8:135668910-135668932 CAGGCTGTGCCCCCTTTTCTGGG + Intergenic
1050307187 9:4316668-4316690 CAGGCTGCCGTCCCATCTCAGGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1058729902 9:107839646-107839668 CAGGCTGTAATTCCTTTTCTGGG - Intergenic
1061059057 9:128241396-128241418 CAAGCTAAGGTCCCTTTTCATGG - Intronic
1194141568 X:90216274-90216296 AAGGCTGAACTCCCTTGTCTAGG - Intergenic
1197446729 X:126559464-126559486 AATTCTGAGGTCCCTTTTCTTGG + Intergenic
1198127245 X:133657648-133657670 CAGGCTCAGGCCCCTTTCCTGGG - Intronic
1198152174 X:133922109-133922131 CAGCCAGACTTCCCTTTTCCTGG - Intronic
1200091075 X:153636305-153636327 CATGCTCACTTCCCTCTTCTCGG - Intergenic
1200487320 Y:3785377-3785399 AAGGCTGAACTCCCTTGTCTAGG - Intergenic
1201707881 Y:16956847-16956869 CAGGCTGTAGTCCTTTTTCTGGG - Intergenic
1202243125 Y:22790557-22790579 CAGGCTAACTTGCCGTTTCTGGG - Intergenic
1202396112 Y:24424307-24424329 CAGGCTAACTTGCCGTTTCTGGG - Intergenic
1202474673 Y:25245785-25245807 CAGGCTAACTTGCCGTTTCTGGG + Intergenic