ID: 1139543817

View in Genome Browser
Species Human (GRCh38)
Location 16:67639207-67639229
Sequence CCTGCTTGAGGGAGGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 525}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139543807_1139543817 -4 Left 1139543807 16:67639188-67639210 CCATCTTGCGTGATTCCTGCCTG 0: 1
1: 0
2: 0
3: 7
4: 150
Right 1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG 0: 1
1: 0
2: 13
3: 64
4: 525
1139543806_1139543817 5 Left 1139543806 16:67639179-67639201 CCAAAGACTCCATCTTGCGTGAT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG 0: 1
1: 0
2: 13
3: 64
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139543817 Original CRISPR CCTGCTTGAGGGAGGCTGGG GGG Intergenic
900139492 1:1133609-1133631 CCTGTGGAAGGGAGGCTGGGAGG - Intergenic
900255792 1:1697734-1697756 CCTGGCTGTGGGAGGCAGGGTGG + Intronic
900264463 1:1750344-1750366 CCTGGCTGTGGGAGGCAGGGTGG + Intergenic
900486253 1:2924206-2924228 CCAGCTGGTGGGAGGCTTGGGGG - Intergenic
900504649 1:3023243-3023265 TCTGCTTGTGTGAGGCCGGGCGG + Intergenic
900576361 1:3384357-3384379 CCAGAGTGGGGGAGGCTGGGGGG + Intronic
900641637 1:3690469-3690491 CCTGCCTGGGGAAGGCTCGGGGG - Intronic
901061052 1:6472035-6472057 CCTCCTGGAGGGAAGCTCGGGGG + Intronic
902177281 1:14660109-14660131 CCTGCTTCAGTGGGGCTGGGAGG + Intronic
902375309 1:16027568-16027590 CCTCCTTCAGGGAGGATGGAAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902701493 1:18175487-18175509 GCTCCTTGAGGGATGCTGCGGGG + Intronic
903259115 1:22121664-22121686 CCTGCTTGCTGGAGGCCAGGAGG + Intronic
903320552 1:22540634-22540656 CCTGCTTGAGGATGCCTGGGAGG + Intergenic
903342345 1:22662295-22662317 CCTGCTTCAGGGAGGAGGTGTGG - Intergenic
904013509 1:27403752-27403774 CCTGCCTGAGGAAGGCGAGGGGG - Intergenic
904627743 1:31816477-31816499 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
905018495 1:34793104-34793126 CCTGCTCGCGGGAGGCCGGGAGG + Intronic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905263959 1:36738485-36738507 CCTGCTGGAGGGAGACGGTGGGG + Intergenic
905863370 1:41364414-41364436 CCTGCTGGCGGGGGGGTGGGGGG + Intronic
906231903 1:44171557-44171579 CCTGCCTGTGGGGTGCTGGGCGG - Intergenic
908686723 1:66728946-66728968 CCTGCTTGAGGGAGGAGGATGGG + Intronic
908773875 1:67621014-67621036 ATTGCTTGAGGCAGTCTGGGAGG - Intergenic
909293044 1:73908900-73908922 CCTTTTTGGGGCAGGCTGGGGGG - Intergenic
909539121 1:76771221-76771243 GCTGCTTGAGGGTGGCTGAGTGG - Intergenic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
909891770 1:81016145-81016167 CCAGCTTCATGGAGGCTGGTAGG - Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
911124883 1:94332187-94332209 CCTGCCTGAGGGTGGATGGTGGG + Intergenic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
914061047 1:144208237-144208259 CCTGGGTGGGGGTGGCTGGGAGG + Intergenic
914118103 1:144758132-144758154 CCTGGGTGGGGGTGGCTGGGAGG - Intergenic
915270122 1:154747874-154747896 CCAGCATGAGGGAAGCTCGGAGG - Intronic
915305645 1:154975918-154975940 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
915547515 1:156609752-156609774 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
916345580 1:163787545-163787567 CCTGCTTAAGGCAGAGTGGGTGG + Intergenic
918892577 1:190294955-190294977 TCTGCTTGAGGGAAAGTGGGAGG - Intronic
918981742 1:191570369-191570391 CCTACTTGAGGGTGGGAGGGTGG + Intergenic
919327011 1:196120808-196120830 GCTGCTAGAGGGAGGTTAGGAGG - Intergenic
920437683 1:205958618-205958640 CATGCTAGAGTGAGGCTGAGAGG - Intergenic
921181654 1:212636407-212636429 TCTGCTGGAAGGAGGCCGGGAGG - Intergenic
921965083 1:221079612-221079634 TTTCCTTGAGAGAGGCTGGGTGG + Intergenic
922453490 1:225755628-225755650 CCTGCTTGTGGGAGGATGAAGGG - Intergenic
922766811 1:228160313-228160335 CAGGCCTAAGGGAGGCTGGGGGG - Intergenic
922786739 1:228286634-228286656 CCAGCGTGAGGGTGGCTGGTGGG + Intronic
924415022 1:243849940-243849962 CCCGCCTGAGGGAGGCAGGGAGG + Intronic
924624184 1:245686288-245686310 CTTGCTCGAGGGAGGCAGTGGGG - Exonic
1062774618 10:135258-135280 CCTGAGCGAGGGAGGCTAGGCGG - Intronic
1063842996 10:10092658-10092680 CCTTTTTGAGGGAGGGTGTGTGG + Intergenic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1067131982 10:43573786-43573808 CCTGATGGAGGGAGTGTGGGTGG - Intronic
1067945550 10:50686101-50686123 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1069678435 10:70266363-70266385 ACTGCTGTTGGGAGGCTGGGAGG + Exonic
1069813651 10:71180085-71180107 CCTGCTTGGGGAAGACGGGGTGG - Intergenic
1070867061 10:79712974-79712996 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1070880851 10:79851095-79851117 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1071633975 10:87235197-87235219 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1071647423 10:87367414-87367436 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1072305163 10:94100314-94100336 CCTGATTTAGGGAGGGTGAGGGG - Intronic
1073329248 10:102660159-102660181 ATTGCTTGATTGAGGCTGGGAGG + Intergenic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073460155 10:103661454-103661476 CCGGCATGAGGGAGCCTGCGGGG + Intronic
1073792247 10:106952341-106952363 CTTGCTTGAGGGAAACTAGGTGG - Intronic
1074039717 10:109776258-109776280 CCTGGTCGAGGGAATCTGGGTGG + Intergenic
1074214502 10:111370950-111370972 CCTACTTGAGGGTGGGTGGTAGG - Intergenic
1074412051 10:113236678-113236700 CATGTTTGTGGGAGGCTGGCTGG + Intergenic
1075411120 10:122228629-122228651 CCTGCTTGGGGATTGCTGGGCGG - Intronic
1075879911 10:125842198-125842220 CCTACTGCAGGGAGGCTGGCAGG - Intronic
1076749083 10:132533145-132533167 CATGCATGAGGGATGCTGGCTGG + Intergenic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077137796 11:1009962-1009984 CCAGCTGCGGGGAGGCTGGGAGG - Intronic
1077265669 11:1648356-1648378 CCTGCTTCGGGAAGGCCGGGTGG - Intergenic
1077403008 11:2368284-2368306 CCTGCTGGAGGTGGGATGGGTGG - Intergenic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1078444981 11:11397257-11397279 CCTGCTTGAGAGAGAAGGGGAGG + Intronic
1078662331 11:13297523-13297545 CCAGCTTGAGGGCTGCTGGTGGG + Intronic
1080685205 11:34509607-34509629 CCTGAGTGAGGGGGGCAGGGAGG + Intronic
1080806977 11:35662795-35662817 CCTGGTAGCGGGAGGCTGAGCGG + Exonic
1080875653 11:36271969-36271991 CCTGTTGGTGGGTGGCTGGGTGG + Intergenic
1081669863 11:44936928-44936950 CCCGCTTGGGAGAGGGTGGGGGG + Intronic
1082883468 11:58060471-58060493 CCTGCCTAAGGAAAGCTGGGAGG + Intronic
1083303483 11:61750995-61751017 ACTGCTTTAGGTAGGCTGGTTGG + Intergenic
1083332463 11:61905334-61905356 GCAGAATGAGGGAGGCTGGGAGG + Intronic
1083572740 11:63768877-63768899 CCAGCTCGCGGGGGGCTGGGGGG + Intergenic
1083755110 11:64788104-64788126 TCTGCTGGAGGGTGGCTGAGGGG + Intergenic
1083783655 11:64931631-64931653 CCCGCCAGAGGGAGGCTGGGAGG + Intronic
1084361875 11:68673998-68674020 ATTGCTCGTGGGAGGCTGGGAGG + Intergenic
1085023367 11:73222607-73222629 CCTGCTGGAAAAAGGCTGGGAGG - Intronic
1086611917 11:88767667-88767689 CCTACTTGAGGGTGGATGGTAGG + Intronic
1087842823 11:102937512-102937534 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
1088259359 11:107929173-107929195 CCTGCTTGGAGGAGGGTGGTCGG - Intronic
1088817504 11:113431896-113431918 CCTGCCTGGGGCAGCCTGGGTGG - Intronic
1089577268 11:119454016-119454038 CTTCCTTCAGGGAGGGTGGGTGG + Intergenic
1089603213 11:119627445-119627467 CGTACTTCAGAGAGGCTGGGAGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1089795851 11:120980285-120980307 CCCTGTCGAGGGAGGCTGGGTGG - Intronic
1090438589 11:126708033-126708055 CCTGCTTCAGGGATGCGGAGGGG - Intronic
1090975919 11:131679812-131679834 CCTGCATCAGGGTGACTGGGAGG - Intronic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1091787517 12:3252015-3252037 CCTGCGTGAGTGAGGGTGAGGGG + Intronic
1091845822 12:3655724-3655746 CCTCCAGGAGGCAGGCTGGGTGG - Intronic
1092182170 12:6453326-6453348 CCTGGTGGAGGGAGCCCGGGAGG - Intronic
1094526154 12:31232561-31232583 CCTGCTTGTGTCTGGCTGGGTGG - Intergenic
1095464435 12:42475842-42475864 CCAGCATTTGGGAGGCTGGGGGG + Intronic
1095555860 12:43503717-43503739 CCTACTTGAGGGTGGATGGTGGG - Intronic
1095906629 12:47384977-47384999 CCTGCTTGAGTGAGGTGGAGGGG + Intergenic
1096498095 12:52050293-52050315 GGTGCTGGAGGTAGGCTGGGAGG + Intronic
1097129727 12:56803136-56803158 CCTGCTTGAGGGACGCAGGAGGG - Intergenic
1098785255 12:74745298-74745320 CCTGCTTGAGGGAGGAGGGTAGG - Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1100179870 12:92073654-92073676 CCTACTTGAGGGTGGGGGGGTGG - Intronic
1100251584 12:92830321-92830343 CCTGCTTGAGGGTGGAAGGTGGG - Intronic
1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG + Intronic
1103832309 12:123789630-123789652 AGTGCTTCAGGGAGGCTGAGGGG - Intronic
1104537374 12:129630854-129630876 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1104791194 12:131483161-131483183 CCTGCTTCAGGCAGGCAGGCAGG - Intergenic
1104934751 12:132358483-132358505 CCTGCATGAGGCAGGCAGTGCGG - Intergenic
1105727581 13:23180027-23180049 CCTGCTTGAGGAAGGAGGGAGGG - Intergenic
1105976197 13:25475169-25475191 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1106226728 13:27791970-27791992 CCGGCTGGAGGGAGGTTCGGGGG + Intergenic
1108409229 13:50130378-50130400 CCTCCGTGAGCGGGGCTGGGCGG + Intronic
1108883170 13:55146375-55146397 CCTGCTTCAGGGAGGAAGGCTGG + Intergenic
1109886187 13:68548311-68548333 GCTGCTTGACAGAGGCTGGAAGG - Intergenic
1110020700 13:70466740-70466762 CCTACTTGAGGGTGGAGGGGAGG - Intergenic
1110406731 13:75159308-75159330 CCTGCTTGAGGGAGGAGGGTAGG + Intergenic
1110782018 13:79477683-79477705 CCTGCTTCTGGGAAGGTGGGAGG + Intergenic
1111137459 13:84067005-84067027 CCTGATTTAGGGAGGATGAGAGG - Intergenic
1111179409 13:84642213-84642235 CCTACTTGAGGGTGGCGGGTGGG + Intergenic
1111972395 13:94930413-94930435 CCTACTTGAGGGTGGCGGGTGGG - Intergenic
1112006581 13:95258932-95258954 CCTGCCTGCGGGAGGCTGCTGGG + Intronic
1112684309 13:101805730-101805752 CCTGCTTGTGGGAAGGGGGGTGG - Intronic
1112736289 13:102423106-102423128 CCTACTTGAGGGAGGACGGGGGG + Intergenic
1113122273 13:106936217-106936239 CCTACTTGAGGCAGGGAGGGTGG + Intergenic
1113382931 13:109820359-109820381 CACGCTTGAGGGAGGAAGGGAGG - Intergenic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1113749083 13:112766137-112766159 CCTGCTTGAGGAAGGAACGGTGG + Intronic
1113860931 13:113486341-113486363 CCTGCTTGAGGGTGGCAGGAGGG + Intronic
1113992482 14:16038378-16038400 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1114212712 14:20628998-20629020 CCTTGATGAGGGAGGCTGTGGGG - Intergenic
1118216808 14:63816526-63816548 CCTGCTTCAGGGAAGAAGGGTGG - Intergenic
1118487540 14:66228048-66228070 GCTGCATGAGGGAAGCTGAGAGG + Intergenic
1118651781 14:67903903-67903925 CCTACTTGAGGGTGGCTGGTGGG - Intronic
1118707402 14:68493020-68493042 TCTGCTTCAGGGAAGCTCGGAGG - Intronic
1119027322 14:71164431-71164453 TCTGCTGGTGGGAGGCGGGGTGG + Intergenic
1119489156 14:75015489-75015511 CCTGCTTGAGGGCTGCATGGAGG - Exonic
1119539242 14:75428036-75428058 CCTGCGGGAGGGACGCTCGGCGG + Intronic
1119739863 14:77007446-77007468 ACAGCTTGATGGACGCTGGGAGG + Intergenic
1121180688 14:91926297-91926319 GCTGCTGGAGGGAGGCTGTCTGG + Intronic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122903158 14:104790261-104790283 CCTGCAGGAGCAAGGCTGGGGGG + Intronic
1122931910 14:104937000-104937022 CCAGCTGGAGGGAGGGAGGGAGG + Exonic
1123755488 15:23394671-23394693 CCTGCAGGAGGAAGGGTGGGGGG + Intergenic
1124392285 15:29269848-29269870 CTTGCGTCAGGGCGGCTGGGCGG + Intronic
1124538759 15:30567345-30567367 CATGCTTGGTGGAGGCGGGGGGG + Intergenic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1124967656 15:34448443-34448465 CCGGGTGGAGGGAGGCAGGGCGG + Intergenic
1125038928 15:35160603-35160625 CCTACTTGAGGGAGTGTGAGAGG - Intergenic
1126447631 15:48766509-48766531 CCTCCTTCAGGGAAGCTGGAGGG - Intronic
1126502482 15:49361396-49361418 CCTACTTGAGGGAGGAGGGAAGG - Intronic
1127477071 15:59344732-59344754 CCTGCTTGGGGAAAGGTGGGAGG - Intronic
1128089953 15:64912529-64912551 ACTCCTTGAGGGAGGTTCGGAGG - Intronic
1128551155 15:68598849-68598871 TCTGCTTGCGGGAAGCTGGTGGG + Intronic
1129298021 15:74610403-74610425 CCTGCTAGGAGGAGGCTGAGTGG + Intronic
1129740357 15:77986891-77986913 CCCGCTTCAGCCAGGCTGGGAGG - Intronic
1130256453 15:82328153-82328175 CCCGCTTCAGCCAGGCTGGGAGG - Intergenic
1130282543 15:82531227-82531249 CATGCTTGGTGGAGGGTGGGAGG + Intergenic
1130598499 15:85261835-85261857 CCCGCTTCAGCCAGGCTGGGAGG + Intergenic
1132148239 15:99441263-99441285 CAGACTTCAGGGAGGCTGGGAGG - Intergenic
1132376189 15:101329824-101329846 CCTGCAAGAGAGTGGCTGGGAGG - Intronic
1132503797 16:296894-296916 CCTGCTGGAGGGTGCCCGGGAGG + Intronic
1132797460 16:1732258-1732280 CCTGGCTGTGGGAGGCTTGGGGG - Intronic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133224685 16:4335253-4335275 CCTGCTCCAGGGAGGGCGGGGGG - Exonic
1134624703 16:15715131-15715153 GGGGCTCGAGGGAGGCTGGGTGG + Intronic
1134766666 16:16764858-16764880 CCTGCTTGAGGGAGGAGGGTGGG - Intergenic
1134913624 16:18050978-18051000 CCAGCATGCAGGAGGCTGGGCGG - Intergenic
1135533008 16:23270641-23270663 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1136145105 16:28311918-28311940 CCTGGGTGTGGGAGGCAGGGAGG + Intronic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1136911863 16:34150286-34150308 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1137552188 16:49445285-49445307 CCTCTCTGAGGGAGGCTCGGGGG + Intergenic
1137603755 16:49773846-49773868 CCTGCTTGAGGGAGGCAAGGAGG + Intronic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1137729801 16:50681089-50681111 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1137751527 16:50864414-50864436 CCTGCTGGATGGAGGCTTGGAGG + Intergenic
1138244837 16:55459850-55459872 ACTGCAGGAGGGAAGCTGGGTGG - Intronic
1138431739 16:56973254-56973276 CCAGCTTCAGGGAGATTGGGAGG - Intronic
1139367755 16:66444159-66444181 CCTGCCTGATAGCGGCTGGGTGG + Intronic
1139372964 16:66479933-66479955 TCTGCCTGAGGGGGGCTGGCAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139924445 16:70478473-70478495 CCAGCATGAGGGAGGCAGGCAGG + Intronic
1139961427 16:70720160-70720182 AGTACTTGAGGGAGGCGGGGAGG + Intronic
1140018301 16:71210496-71210518 CCTACTTGAGGGAGGAGGGTGGG + Intronic
1140267497 16:73433319-73433341 CTTGCTTGAGGGCTGCTGTGGGG + Intergenic
1140419666 16:74807828-74807850 GCTGCAGGAGGGAGGCTGGCTGG - Intergenic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1140542883 16:75775672-75775694 TCTACTTGAGAGAAGCTGGGAGG + Intergenic
1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG + Intergenic
1141553592 16:84822113-84822135 CCTGTTGGGGTGAGGCTGGGAGG + Intronic
1141694270 16:85612372-85612394 CCTGGGTGAGGTAGGGTGGGGGG + Intronic
1141832394 16:86517022-86517044 CCTGCTGGTGGGTGGCTGGAAGG - Intergenic
1141860543 16:86713338-86713360 CCTGCTTGCGAGGTGCTGGGAGG + Intergenic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142078800 16:88136201-88136223 TCTGCGTGGGGGAGGCTGTGAGG + Intergenic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142122994 16:88396469-88396491 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG + Intergenic
1142123048 16:88396631-88396653 CCTCCTGAAGGGAGGCCGGGCGG + Intergenic
1142123058 16:88396658-88396680 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123115 16:88396847-88396869 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123125 16:88396874-88396896 CCTCCTGAAGGGAGGCCGGGTGG + Intergenic
1142123160 16:88396982-88397004 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123170 16:88397009-88397031 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142186584 16:88697722-88697744 CCTGCTGGAGGGAGGCAGGAAGG - Intronic
1142278429 16:89135271-89135293 GCTCCTTGAGGGATGCTGGAAGG + Intronic
1142585105 17:967262-967284 CCTGCTGCTGGGAGTCTGGGAGG + Intronic
1142664773 17:1456277-1456299 CCTGCCCGAGGGAGGCTGCCGGG + Intronic
1143634564 17:8156914-8156936 CCAGCTTCAGGGAGCCTCGGTGG - Intronic
1144140511 17:12342797-12342819 CCTGCTGGAGGGATGGGGGGAGG - Intergenic
1144181053 17:12752983-12753005 CCTGCTTGATGGAGGCAGCCAGG - Exonic
1144587315 17:16495043-16495065 CCTGCTTGAGGGTGTGTGGTTGG + Intergenic
1145031351 17:19507496-19507518 CCTGGCTGGGGGCGGCTGGGCGG - Intronic
1145974885 17:28978205-28978227 CCTGGTTGAGGGAATCTGGCAGG - Intronic
1146736714 17:35244341-35244363 GATGCTTGAGGGAGGATGGGGGG + Intronic
1146926452 17:36749229-36749251 CCAGCTTGTGGGGCGCTGGGAGG - Intergenic
1147660041 17:42112501-42112523 CCCACTTGAGGGAGGTGGGGGGG + Intronic
1147801849 17:43096978-43097000 CCTACTTGAGGGAGGAAGGTGGG + Intronic
1148092708 17:45032243-45032265 TCTTCTTGAGGGAGGCAGGGAGG + Intronic
1148097334 17:45061487-45061509 CCAGGTTGTGGGAGGCTGGACGG - Intronic
1148460495 17:47836742-47836764 GCTCCTTGAGGAAGCCTGGGAGG - Exonic
1148463064 17:47849117-47849139 CCTGCTTGAGGGAAGGGGGTGGG - Intronic
1148747148 17:49924745-49924767 ACAGATTGAGGGAGGCAGGGAGG + Intergenic
1148805122 17:50260013-50260035 CCTGCTCGGGGGAATCTGGGTGG + Intergenic
1148847701 17:50538889-50538911 CGTCCCTGTGGGAGGCTGGGGGG - Exonic
1148853280 17:50565062-50565084 CCTGGCTGAGGCAGGCAGGGCGG - Intronic
1149469393 17:56903488-56903510 GCTGCTGGAGGAAGGATGGGAGG + Intronic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1150640445 17:66946189-66946211 CCCGCTGGAGGGAGGCTGGAAGG - Intergenic
1151253590 17:72857132-72857154 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1151328541 17:73393520-73393542 CAAGCTTGGGGAAGGCTGGGAGG - Intronic
1151451467 17:74200678-74200700 GCTGCTGGAGGGAGGAGGGGAGG + Intergenic
1152088301 17:78233327-78233349 CCTGCCTGAGGGACTCTGAGGGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152519810 17:80848845-80848867 CTTCCTTGAGGGAGTGTGGGTGG - Intronic
1152901196 17:82941994-82942016 CCTGCCGGAAGGAGGCTGAGAGG - Intronic
1153141828 18:1981349-1981371 CCTACTAGAGGGAGGATGGAAGG - Intergenic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1154277808 18:12977243-12977265 CCTGCATGTAGGAGACTGGGTGG - Intronic
1155441769 18:25869860-25869882 CTTGCTGGAGAGAGGCGGGGTGG - Intergenic
1155773733 18:29732549-29732571 CCTACTTGAGGGTGGCTTGTGGG - Intergenic
1156067546 18:33162581-33162603 CCTGCTTGAGGGTGGATGTTTGG - Intronic
1156361375 18:36387180-36387202 CCTGCTTGAGGGGAGATGGTGGG + Intronic
1156699513 18:39808771-39808793 CCTACTTGAGGGGGGGAGGGTGG - Intergenic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157368386 18:47087538-47087560 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157674744 18:49560892-49560914 CCGGCTGGAGCGAGGCTGGATGG + Intronic
1158421829 18:57301703-57301725 TCTGCTAGAGAGAGGCAGGGTGG - Intergenic
1158586009 18:58735661-58735683 CCTATTTGAGGGTGGGTGGGTGG + Intronic
1158688762 18:59641439-59641461 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1159116125 18:64114983-64115005 CCTGCATGGAGGAGGGTGGGAGG - Intergenic
1159923288 18:74246085-74246107 CTAGCTTGAGGGTGGGTGGGTGG - Intergenic
1159931390 18:74315967-74315989 GCTGCTTGAAGGAGGCAGAGCGG + Exonic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1160913016 19:1483498-1483520 CCTGCTGGGGGGTGGGTGGGCGG + Intronic
1161002213 19:1916343-1916365 GCTGCTTGAGAGAGGCAGGAAGG + Intronic
1161080816 19:2309109-2309131 CCTGTTTGAGGAAGGCTGAGGGG - Intronic
1161087468 19:2341625-2341647 GCTGCCTCAGGAAGGCTGGGAGG - Intronic
1161267176 19:3369744-3369766 CCAGCGGGAGGGAGGCAGGGAGG - Intronic
1161288415 19:3480226-3480248 CCAGCGAGAGGGAGGCCGGGCGG + Intronic
1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG + Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1162325455 19:9996465-9996487 CCTGCTGGAATGAGACTGGGGGG + Exonic
1162458935 19:10802984-10803006 CCTGCCTGAGGCAGGCCGGGTGG + Intronic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1163758774 19:19121692-19121714 CCTGCCTGGGGGACCCTGGGAGG + Intronic
1164509288 19:28884414-28884436 CCTGCTTGAGGGTGGAAGGTGGG - Intergenic
1164635085 19:29785961-29785983 CATGGGTGTGGGAGGCTGGGAGG + Intergenic
1165055905 19:33176290-33176312 CATGCTGCAGGGATGCTGGGTGG + Intergenic
1165942999 19:39424610-39424632 CCTGCTTGGGTGAAGTTGGGAGG - Exonic
1165994404 19:39833809-39833831 GTTGCAGGAGGGAGGCTGGGAGG - Intronic
1166113966 19:40641468-40641490 AGTGCTTGTGGGTGGCTGGGTGG + Intergenic
1166664291 19:44669545-44669567 CCTGTGTGTGTGAGGCTGGGAGG - Intronic
1166998514 19:46731328-46731350 CCTGCTTGCGCGAGGCTGGCTGG - Intronic
1168259683 19:55186359-55186381 CCTGGTTGAGGAAGGCAGGCGGG + Exonic
925177149 2:1793826-1793848 CCTGCAAGGGGGCGGCTGGGAGG - Intronic
925186687 2:1851809-1851831 CCTACTTGAAAGAGGCTGAGTGG + Intronic
925735067 2:6956737-6956759 CATGCTTCTGGGAGGCTTGGTGG + Intronic
925809241 2:7682725-7682747 CCTGCATGTGGGTGGGTGGGTGG + Intergenic
926066400 2:9843663-9843685 CCGGCTGGAGGAAGGCGGGGCGG + Intronic
926098503 2:10098240-10098262 CCTGCAAGAGTGAGGCGGGGCGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926663167 2:15491180-15491202 CCTGCTTCATGGAGGAAGGGTGG - Intronic
927699422 2:25258475-25258497 CCTGCAGTAGGTAGGCTGGGGGG + Intronic
930928254 2:56847999-56848021 CCTGTTGGAGGGTGGCTGGTGGG + Intergenic
931576743 2:63725199-63725221 CCTGCTGGAGGGTGGAAGGGTGG - Intronic
932827161 2:74952030-74952052 CCTGCTTGAGGGTGGAGGGTGGG + Intergenic
934753004 2:96806084-96806106 CCTCCGGGAGGGAGGTTGGGGGG - Intronic
935549747 2:104440390-104440412 TCTGTGTGAGGCAGGCTGGGTGG - Intergenic
935802730 2:106714863-106714885 CATGCTTTATGGAGCCTGGGGGG - Intergenic
936048621 2:109205768-109205790 GCTGCTTCAGGGAGGCTGCTGGG - Intronic
936297489 2:111278043-111278065 CCTGGTGGGGGGAGGATGGGAGG + Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
938241059 2:129742574-129742596 CCTGTGCTAGGGAGGCTGGGAGG - Intergenic
940839174 2:158559388-158559410 CATGCCTGAGGGAGGCAGGCAGG + Intronic
941917631 2:170822788-170822810 CCTGCCTGAGGGAGGCACGAGGG + Intronic
942321345 2:174739189-174739211 CCTGGTAGAGGGAGGCTGTCTGG - Intergenic
942908559 2:181213076-181213098 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
944058020 2:195543863-195543885 CCTACTTGAGGGTGGATGGTGGG + Intergenic
944150799 2:196556010-196556032 CCTGCTTGGGGAGGTCTGGGAGG - Intronic
944362739 2:198877540-198877562 GATGCTAGAGGGAGGATGGGAGG - Intergenic
944716491 2:202380553-202380575 CCTGCTTGAGTGAGACTTTGCGG - Intronic
945031146 2:205664877-205664899 CCTGCTTGAGGGTGGAGGGAGGG - Intergenic
945159334 2:206873022-206873044 CCTCATTCAGAGAGGCTGGGAGG + Intergenic
945532360 2:210971621-210971643 CCTGCTTGAGGGAATAAGGGTGG - Intergenic
945848610 2:214978950-214978972 CCTCCTTGAGGTAGGCTTCGGGG + Exonic
946025473 2:216669461-216669483 GTTGCTTGAGGGACACTGGGTGG + Intergenic
946026148 2:216673129-216673151 CCACCTTGAGGGGGGCTTGGCGG + Exonic
947095381 2:226561202-226561224 GCTGCTTTAGGGAGGCAGGTTGG - Intergenic
947799743 2:232921325-232921347 CCTGCCTGCTGCAGGCTGGGAGG + Intronic
947968591 2:234302782-234302804 CCTGCATGAAGGAGCCAGGGGGG - Intergenic
948118006 2:235507950-235507972 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
948118991 2:235514816-235514838 ACTGCATGAGGGAGGCGGGATGG + Intronic
948599792 2:239101663-239101685 CCTGGTTCAGGGTGGCTGGGAGG + Intronic
948675009 2:239591988-239592010 CCTGGTTGAGGAAGGATGGCTGG + Intergenic
1168962086 20:1876835-1876857 CATGTTTGAGAAAGGCTGGGAGG - Intergenic
1169155205 20:3323737-3323759 CCTGCTCTGGGGAGGCTGAGTGG + Intronic
1170143246 20:13146268-13146290 TCTGCTTGAGGGAGGAGGGTGGG + Intronic
1170304232 20:14919976-14919998 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1171096814 20:22340147-22340169 CTTGCTGGAGAGATGCTGGGAGG - Intergenic
1171769367 20:29310768-29310790 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1171981798 20:31633736-31633758 CCTTTTTCAGGGTGGCTGGGAGG - Intergenic
1172063300 20:32201988-32202010 TCTGGTTGCGGGAGGCTGTGAGG + Exonic
1172080372 20:32335955-32335977 CCTGCTGGAGTGACCCTGGGGGG + Intergenic
1172104177 20:32506315-32506337 CCTGGGTGAGGGAAGCTGAGAGG - Intronic
1172162135 20:32876071-32876093 GGTGCTGGAGGGAGGCTGGAGGG + Intronic
1172291719 20:33781588-33781610 GCTGCTGGAGCCAGGCTGGGTGG + Intronic
1172455220 20:35066214-35066236 GTTGCTTGATGGGGGCTGGGTGG - Intronic
1172802309 20:37584746-37584768 CCTGATAGAGGGAAGCTGGTGGG + Intergenic
1172808370 20:37629581-37629603 ACTGCTTTAAGGAGGCTGAGAGG + Intergenic
1172894527 20:38291237-38291259 GCTGACTCAGGGAGGCTGGGAGG + Intronic
1172999609 20:39096084-39096106 CCTGCTGGAAGAAGGCAGGGAGG + Intergenic
1173294735 20:41747032-41747054 CCTTGATGAGGGTGGCTGGGAGG + Intergenic
1173322901 20:42005298-42005320 CTTCCTTGAGGGAGGCAGGCTGG + Intergenic
1173334314 20:42100607-42100629 CCTGGATGAGGAAGGCAGGGAGG + Intronic
1173624912 20:44465732-44465754 CCTGCTTCAGGGAGGTGGTGTGG + Intergenic
1174406854 20:50308608-50308630 CCTCCTGGAAGGAGGCAGGGTGG - Intergenic
1176023826 20:62975923-62975945 CCTGCTGGGGGAAGGTTGGGGGG - Intergenic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176429304 21:6566428-6566450 CCTGCTGGAGGGAGGAGGAGGGG - Intergenic
1176551895 21:8226769-8226791 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176552273 21:8231207-8231229 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176570804 21:8409768-8409790 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176571178 21:8413783-8413805 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176578712 21:8453915-8453937 TCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176579092 21:8458345-8458367 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1178641577 21:34348879-34348901 CCTACTTGAGGGTGGATGGTGGG + Intergenic
1179008026 21:37531637-37531659 CCAGCTGGAGGGAGGCAGGCAGG - Intergenic
1179042561 21:37816785-37816807 CCTACTTGAGGGTAGCTGGTGGG + Intronic
1179704696 21:43173890-43173912 CCTGCTGGAGGGAGGAGGAGGGG - Intergenic
1180314789 22:11269139-11269161 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1180340588 22:11614565-11614587 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1180720944 22:17907974-17907996 TCTGCTGGACAGAGGCTGGGAGG + Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1181574058 22:23782914-23782936 TGTGGTTGTGGGAGGCTGGGTGG - Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182552267 22:31106827-31106849 CCTGGTTGGGGGAGGATGGGAGG + Intronic
1182569512 22:31226025-31226047 CCAGCTGGAGGCAGGGTGGGGGG + Intronic
1182572265 22:31248313-31248335 CCTGAATGAGGGAGGGAGGGAGG - Intronic
1182764252 22:32747012-32747034 CTGGCTGGAGGGAGCCTGGGTGG + Intronic
1183204324 22:36408167-36408189 CCTGCTTGAGGGAGAGCAGGAGG - Intergenic
1183758350 22:39791885-39791907 CCTACTTGAGGGAGGAGGGTGGG - Intronic
1184172585 22:42768721-42768743 CATGCCTGAGGGTGGCTGGAGGG - Intergenic
1184261940 22:43322645-43322667 CCTGCTTGAAGGAGGAAAGGAGG - Intronic
1203256915 22_KI270733v1_random:143688-143710 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203257279 22_KI270733v1_random:147981-148003 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
949097686 3:105618-105640 CCTGGTTGAGGGAGCCATGGAGG + Intergenic
949773720 3:7607881-7607903 CCTACTTGGGGGAGGGTGAGAGG - Intronic
950157980 3:10738291-10738313 CCAGAATGAGGGAGGCTAGGGGG + Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
950631059 3:14282253-14282275 CCAGGATGAGGGAGGCTGAGGGG - Intergenic
951838847 3:27011865-27011887 ACTGCTTGAGAGAGACTGAGTGG - Intergenic
951988599 3:28649794-28649816 TCTGCTTGAAGAAGGCAGGGAGG + Intergenic
952945762 3:38477178-38477200 CCTGAGGGAGGGAGGCCGGGTGG - Intronic
953039762 3:39245297-39245319 CCTACTTGAGGGTGGCGGGTGGG + Intergenic
953094825 3:39765224-39765246 CATACCTGAGGGAGTCTGGGAGG - Intergenic
953686632 3:45083104-45083126 CCTGCTTGGAAGGGGCTGGGAGG + Exonic
953745217 3:45568789-45568811 CCTGCTTGAGGGTGGAGGGAGGG - Intronic
954145310 3:48631540-48631562 CCAGCTGGAGGGGGGCTGGGAGG - Intronic
954274731 3:49534845-49534867 CCTGATTGAGGGTGGGTGGGTGG + Exonic
954428152 3:50454417-50454439 CCAGGTTGGGGGTGGCTGGGGGG - Intronic
954478657 3:50775741-50775763 CTTGCTGGAGGGAGGGTGGAAGG - Intronic
954623229 3:52007365-52007387 TGTGCTTGCGGGAGGTTGGGAGG + Intergenic
955960648 3:64337931-64337953 CCTGCATGAAGGAGGCTGAGAGG + Intronic
955971815 3:64444754-64444776 CCTGCTTGGGGAAGGGTGCGCGG + Intronic
956854945 3:73266949-73266971 CCTACTTGAGGGTGGGGGGGTGG + Intergenic
958063769 3:88516971-88516993 CCTGCTTGAGGGTGGAGGGCAGG - Intergenic
961109624 3:124272958-124272980 CCTTCTGGTGGGAGGCTGGTTGG + Intronic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
961422845 3:126819899-126819921 ACTGACTGAGGGAGCCTGGGAGG + Intronic
961554796 3:127690460-127690482 GCTGCTGGAGGGAGGGTGGAGGG + Exonic
961795010 3:129403050-129403072 TATGGTTGATGGAGGCTGGGTGG - Intronic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
962635781 3:137330126-137330148 TCTGCATGGGAGAGGCTGGGAGG - Intergenic
963103061 3:141623811-141623833 CCTGCTGGAGGGAGGAAGGAGGG - Intergenic
966692150 3:182753268-182753290 CCTGGTTGGGGGAGGCCAGGCGG - Intergenic
966911927 3:184564617-184564639 CCTGCTGGAGGGAGGTTAGAGGG + Intronic
967914922 3:194571625-194571647 CCTGCTCGAGGAAGCCAGGGTGG - Intergenic
967970259 3:194994210-194994232 CCTCCGTGAGAGGGGCTGGGAGG - Intergenic
968547286 4:1205729-1205751 TCTGAGTGAGGGAGCCTGGGCGG - Intronic
969339844 4:6533326-6533348 CTTGTTTGAGGGAGGCTGGGAGG - Intronic
969396973 4:6928224-6928246 ACAGCTTGTGGCAGGCTGGGAGG + Intronic
970801598 4:19978791-19978813 CATGCTTGAAGGAGGCTTGGGGG + Intergenic
970945301 4:21683968-21683990 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
972929615 4:44055578-44055600 CTTGCTGAAGGCAGGCTGGGAGG + Intergenic
973938568 4:55878858-55878880 CATGCTTGAGGAATGCTGGTAGG - Intronic
974877482 4:67716634-67716656 CATACTTGATGAAGGCTGGGTGG + Intergenic
976367039 4:84244168-84244190 TCTGGTTGTGGGAGGCTGTGAGG - Intergenic
976369722 4:84273534-84273556 CTTGCTTGAGGGTGGCAGGCGGG + Intergenic
977330626 4:95632847-95632869 ACTGCTTCAGGGAGGCAGGAAGG - Intergenic
978061408 4:104344776-104344798 CATGCAGGAGGGAGGCTGGGAGG + Intergenic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
980009734 4:127581616-127581638 CCTGCTTGAGGGAGGGTGCATGG + Intergenic
980244746 4:130224377-130224399 CCTGCTGGAAGGAGGGAGGGAGG + Intergenic
980635869 4:135501959-135501981 CCTGCTTGAGGGTGGAGGGAGGG + Intergenic
980838700 4:138230251-138230273 CCTGCTTGAGGGTGTTTGGAAGG + Intronic
981062770 4:140444369-140444391 CTTACTTGAGGGAGGATGGTAGG - Intronic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
983664709 4:170167926-170167948 CCTCCTGGAGGGAGGATGTGAGG - Intergenic
983733090 4:171022423-171022445 CCTGTTTGTGGGGTGCTGGGGGG + Intergenic
983915927 4:173290601-173290623 CCTGCTGAAGAGAGGCAGGGAGG + Intronic
985015199 4:185626659-185626681 CCAGCTTGAGTCAGTCTGGGTGG + Intronic
985526648 5:406383-406405 ACTCCATGTGGGAGGCTGGGAGG + Intronic
985932344 5:3068330-3068352 CACACTTGATGGAGGCTGGGAGG - Intergenic
985992593 5:3575640-3575662 CCTGGTTGAGGGCACCTGGGAGG - Intergenic
986596892 5:9431849-9431871 CGTGATTGAGTGAGGCTGGGAGG - Intronic
986750992 5:10787801-10787823 CCTGCTTCAGTGAGGCATGGAGG - Intergenic
987010857 5:13762681-13762703 CCTGGGTGAAGGTGGCTGGGCGG - Intronic
987284079 5:16438721-16438743 CCAGATTGATAGAGGCTGGGTGG - Intergenic
987298407 5:16574701-16574723 CCTGTTTCAGGGGGCCTGGGAGG - Intronic
987394521 5:17409694-17409716 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
988097996 5:26642468-26642490 CCTACTTGAGGGTGGATGGTGGG + Intergenic
988820456 5:34879483-34879505 CCTGTTTGGGGGGTGCTGGGAGG - Intronic
990567344 5:57042767-57042789 CCTGCATTAGGAAGGCTGGCAGG - Intergenic
990611321 5:57459607-57459629 CCTGCTTGAGGGAGGATAGTAGG + Intergenic
991417596 5:66408158-66408180 GATGCATGAGGGAGGCAGGGAGG - Intergenic
991455636 5:66800535-66800557 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
991590807 5:68249756-68249778 CCTGCTTGTGGTGGGGTGGGGGG + Intronic
992227725 5:74635246-74635268 CCTGCTTTAGAGAGACTGAGGGG + Exonic
992760931 5:79950521-79950543 ACAGCTTGAGGGATTCTGGGGGG - Intergenic
993273929 5:85831841-85831863 CCTGCTTGAGGGTGGAAGGTGGG + Intergenic
994995946 5:107063295-107063317 CCTGCTTCAGGGAAGAGGGGTGG + Intergenic
995099951 5:108288103-108288125 CCTACTTGAGGGTGGAAGGGAGG + Intronic
995849442 5:116529833-116529855 GCTGCTTGAGGGCGGGTTGGGGG + Intronic
997236423 5:132274693-132274715 CCTGGTTGGGGGTGGCTTGGAGG + Intronic
998108145 5:139481536-139481558 CCAGCTGCAGGGAGGCTAGGTGG + Exonic
999567378 5:152879822-152879844 CCTGCTTGAGGGTGGAGGGTAGG + Intergenic
999615702 5:153420878-153420900 ATTGTTTGAGGGAGGCAGGGGGG - Intergenic
999695825 5:154188379-154188401 CCTGCCTGAGGGATGCTCTGAGG + Intronic
1001084268 5:168689135-168689157 TCTGATTCAGGGAGTCTGGGTGG + Intronic
1001809720 5:174618503-174618525 CATGGTTCAGGGAGGGTGGGTGG - Intergenic
1002064553 5:176645555-176645577 TCTGCTAGAGGGAAGGTGGGTGG + Intronic
1002191865 5:177482552-177482574 AGTGCAGGAGGGAGGCTGGGAGG - Intergenic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1002430360 5:179199711-179199733 CCAGACTCAGGGAGGCTGGGAGG - Intronic
1002648384 5:180673706-180673728 CCTGCCTGAGGCGGGCTGGGGGG + Intergenic
1004117278 6:12781768-12781790 CCTCCTGGAGGGAGGGAGGGTGG + Intronic
1004580214 6:16943454-16943476 TCTGGTTGAGTGAGGCTGGATGG - Intergenic
1004975505 6:20961432-20961454 CCTGCTTGAGGGAGATCAGGGGG + Intronic
1005486083 6:26301049-26301071 AATGCTTGAGGGAGGCTGTGGGG - Intergenic
1005926855 6:30451861-30451883 CCTCCTTAAGAGAGGCAGGGAGG - Intergenic
1006443859 6:34068142-34068164 CGTGCTGGAGGGAGACGGGGGGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006808447 6:36804578-36804600 CCTGCTAGAGGGATGCTGTGAGG - Intronic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1008298417 6:49805486-49805508 CCAGCTCCAGGGAGTCTGGGTGG + Intergenic
1010187420 6:73159339-73159361 CCTACTTGAGGGTGGATGGTGGG + Intronic
1010188889 6:73174637-73174659 GCAGCTTCAGGGAGGGTGGGAGG - Intronic
1010404179 6:75483868-75483890 CCTGCTTGCTGGGGGCTGGGGGG + Intronic
1011206019 6:84899026-84899048 CCTGGTGGAGGGAAGATGGGTGG - Intergenic
1011340455 6:86307723-86307745 GCTTCTTGGTGGAGGCTGGGGGG - Intergenic
1013466986 6:110426498-110426520 CCTCCTGGAGGGAGGCCAGGCGG + Intronic
1016043682 6:139459287-139459309 GATGCTTCAAGGAGGCTGGGAGG + Intergenic
1017156326 6:151325600-151325622 CCCGCGTGTGGGTGGCTGGGTGG + Intronic
1017220067 6:151955872-151955894 CCTACGTGAGGGAGGGTGAGAGG - Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018649129 6:165976813-165976835 CCTGCTGCAGGGTGGCTGGTGGG - Intronic
1019178847 6:170175136-170175158 ATTCCTCGAGGGAGGCTGGGGGG - Intergenic
1019479352 7:1259550-1259572 CCTGCTTGACGGGGGCTGTTAGG + Intergenic
1019544151 7:1565155-1565177 CCTGCCCGAGGGAGGTTGGGTGG + Intergenic
1019937161 7:4264370-4264392 CCTGAGTGAGGGAGGCCGTGTGG + Intronic
1019937186 7:4264459-4264481 CCTGAGTGAGGGAGGCCGCGTGG + Intronic
1019937193 7:4264488-4264510 CCTGAGTGAGGGAGGCCGCGTGG + Intronic
1019937200 7:4264517-4264539 CCTGAGTGAGGGAGGCCGCGTGG + Intronic
1019937207 7:4264546-4264568 CCTGAGTGAGGGAGGCCGCGTGG + Intronic
1019988945 7:4679109-4679131 CCTGCTTGATTGAGGTGGGGGGG - Intergenic
1020111873 7:5452078-5452100 CCACCTGGAGGGAGGCTGTGTGG + Intronic
1020816997 7:12917825-12917847 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1021532579 7:21664878-21664900 CTTGCTTGAGGGAGTATGAGAGG + Intronic
1021613763 7:22481986-22482008 CCTGCTCTGGGGAGACTGGGTGG + Intronic
1023386038 7:39658868-39658890 TCTGCTTGAGGCAGGCTCGGTGG - Intronic
1024578889 7:50785679-50785701 CCTGGTGGAGGGAGGCTGGAAGG - Intronic
1025994660 7:66520317-66520339 TCTGGGTGAGGGTGGCTGGGTGG + Intergenic
1026847470 7:73705983-73706005 CCTGCCTGAGAGAAGCTGGATGG + Intronic
1026888338 7:73967529-73967551 ACTGCTTGGGGGAGGCTGCTGGG + Intergenic
1027225915 7:76243662-76243684 GCTGCTTGTGGGGGGCTGGCAGG - Intronic
1029505050 7:100958411-100958433 ACTGCTTGAGGGGGTCTCGGTGG - Exonic
1030807922 7:113938730-113938752 CCTGCTTGAGGGTGGAGGGTAGG - Intronic
1030943400 7:115683541-115683563 CCTGCCTGAGGGAGCCTAGAAGG + Intergenic
1031793648 7:126142571-126142593 CCTGCTTCAAGGAAGATGGGTGG + Intergenic
1032444550 7:131970829-131970851 AGTGCTGGAGAGAGGCTGGGCGG - Intergenic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1032988344 7:137363274-137363296 CCTACTTGAGGGAGGCATTGTGG - Intergenic
1034627368 7:152503703-152503725 CCTGCCAGGGGGAGGCAGGGAGG + Intergenic
1035115075 7:156517396-156517418 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035115140 7:156517717-156517739 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035391803 7:158509168-158509190 CCTGCTGGGTGGAGGCTGCGTGG - Intronic
1035404148 7:158587470-158587492 CCTCCGTGAGGGGGTCTGGGTGG - Intronic
1035412625 7:158657513-158657535 CATCCTTGAGGGAGGTGGGGGGG + Intronic
1035684452 8:1513117-1513139 CCAGCTCCAGGGAGGCTCGGTGG + Intronic
1035684485 8:1513263-1513285 CCAGCTCCAGGGAGGCTCGGTGG + Intronic
1035684504 8:1513336-1513358 CCAGCTCCAGGGAGGCTCGGTGG + Intronic
1037404054 8:18522821-18522843 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1038286373 8:26209564-26209586 TCTGGGTGATGGAGGCTGGGTGG - Intergenic
1038406807 8:27328147-27328169 TCTTCTTGAGGGATGGTGGGTGG + Intronic
1038945854 8:32359065-32359087 CCTGCTAGAGAGATGGTGGGTGG + Intronic
1039488273 8:37928060-37928082 CCTCCGGGAGGGAGGTTGGGGGG + Intergenic
1039807486 8:41013275-41013297 CCTACTTGAAGGTGGTTGGGTGG - Intergenic
1041221392 8:55655156-55655178 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
1041600528 8:59712126-59712148 CCTGCTTGGAGGAGGCCAGGTGG - Intergenic
1041914036 8:63121690-63121712 CCTCCTTGAGGGAGGAGGGTGGG - Intergenic
1044999228 8:97865790-97865812 TCTACTTGAGGGAGACAGGGAGG + Intergenic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1045523354 8:102922166-102922188 AGTGCGTGAGTGAGGCTGGGCGG + Intronic
1045643733 8:104280406-104280428 GCTGCTTCAGGGAGGCAAGGGGG + Intergenic
1048136706 8:131753094-131753116 AGTGTTTGAGGGAGACTGGGGGG + Intergenic
1048329432 8:133461961-133461983 CATACTTGATGAAGGCTGGGTGG + Exonic
1048765756 8:137842797-137842819 CTTGCTTGAGGGCGGCTGTGGGG + Intergenic
1049233088 8:141494354-141494376 CCTGCTTGATGGAGACTTGGGGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049501911 8:142971553-142971575 CCTAGGGGAGGGAGGCTGGGTGG - Intergenic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049584382 8:143426154-143426176 CCTGGCTGAGGGAGGTTGTGTGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1050294667 9:4193699-4193721 TGAGCTGGAGGGAGGCTGGGAGG + Intronic
1052860474 9:33435015-33435037 TCTGTTTGGGAGAGGCTGGGGGG - Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056254520 9:84785217-84785239 CCTGTGTGATGGAGGGTGGGAGG - Intronic
1056292735 9:85160343-85160365 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056292875 9:85161314-85161336 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056457213 9:86772060-86772082 CTTGGTTGAGGCGGGCTGGGGGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057353377 9:94317954-94317976 CCTGCTTTAGGGAGGCTTCTCGG - Intergenic
1057408041 9:94791332-94791354 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1057443079 9:95096039-95096061 CCTGCTTCGGAGAGGCAGGGAGG - Intergenic
1057519730 9:95751614-95751636 GCTGCAAGAGGGAGGATGGGAGG + Intergenic
1057519742 9:95751653-95751675 GCTGCATGAGGGAGGGAGGGAGG + Intergenic
1057654374 9:96939638-96939660 CCTGCTTTAGGGAGGCTTCTCGG + Intronic
1058102928 9:100937198-100937220 CCTTGATGAGGGTGGCTGGGGGG + Intergenic
1059409201 9:114121608-114121630 CCTGACTGAGGGAGGCAGGATGG + Intergenic
1059896334 9:118870141-118870163 CATGCTTGAGGGAGGCAGCAGGG - Intergenic
1060358944 9:122936582-122936604 GCGGCTTGCTGGAGGCTGGGTGG + Intergenic
1061075985 9:128341509-128341531 GCTGATTGAGGGAGGCGAGGAGG - Intronic
1061364984 9:130168002-130168024 ACTGCTTGGGGAAGGGTGGGGGG - Intergenic
1061553056 9:131349067-131349089 CAAGCTCCAGGGAGGCTGGGCGG + Intergenic
1061679967 9:132238131-132238153 CTTGCTGGAGGGTGGGTGGGTGG + Intronic
1062021211 9:134320226-134320248 TCTGCTGGACGGAGGGTGGGGGG - Intronic
1203473073 Un_GL000220v1:125373-125395 TCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203473453 Un_GL000220v1:129803-129825 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203363096 Un_KI270442v1:235152-235174 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1186012481 X:5150504-5150526 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1186180212 X:6966843-6966865 CATGCCTGAAGGTGGCTGGGTGG - Intergenic
1186334505 X:8572282-8572304 CCTGCTTGGGGGAGGTGGGGAGG - Intronic
1186393074 X:9180840-9180862 ACTGGTTGAGGGCTGCTGGGGGG - Intergenic
1187426310 X:19180435-19180457 CCTGGTTCAAGGATGCTGGGTGG - Intergenic
1187793508 X:22976946-22976968 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
1188205778 X:27355963-27355985 CCTCCTTGGGGGTGGCGGGGCGG - Intergenic
1188879352 X:35472723-35472745 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
1188910691 X:35843454-35843476 CCTACTTGAGGGAGACAGGTGGG - Intergenic
1189720656 X:43912919-43912941 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1190054457 X:47173715-47173737 CCTGCAAGAGGGAGGGAGGGAGG - Intronic
1190532106 X:51388917-51388939 CCTACTTGAGGGAGGAAGGTGGG + Intergenic
1191046240 X:56140595-56140617 CCTACTTGAGGGTGGATGGTGGG + Intergenic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1191891109 X:65942310-65942332 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1193219720 X:78910125-78910147 GCTGCTTCAGGGGGGATGGGAGG + Intergenic
1194264005 X:91733633-91733655 CCAGCTTTGGGGAGTCTGGGAGG - Intergenic
1198011440 X:132559784-132559806 CCTACTTGAGGGTGGCGGGTGGG - Intergenic
1198457924 X:136835658-136835680 GCTGCTTGAGGGAGGGAGGGAGG + Intergenic
1199310691 X:146316470-146316492 CCTACTTGAGGGAGGTTAGGAGG + Intergenic
1199619461 X:149686339-149686361 CTTCCTTGAGGGAAGTTGGGTGG + Intergenic
1200485973 Y:3768625-3768647 TCTGCTTCAGGGAAGATGGGTGG - Intergenic
1201075230 Y:10181636-10181658 CCTACTTGAGGGAGGAAGGGTGG + Intergenic
1201386555 Y:13446166-13446188 CCTACTTGAGGGTGGATGGTGGG + Intronic