ID: 1139544755

View in Genome Browser
Species Human (GRCh38)
Location 16:67645028-67645050
Sequence CCGGGAGCGGGGTTGTGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 386}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139544755_1139544773 12 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544773 16:67645063-67645085 GCCGCGAGGCCGGGGCGGGGAGG 0: 1
1: 0
2: 17
3: 131
4: 1029
1139544755_1139544775 13 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544775 16:67645064-67645086 CCGCGAGGCCGGGGCGGGGAGGG 0: 1
1: 0
2: 9
3: 97
4: 703
1139544755_1139544770 7 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544770 16:67645058-67645080 CTCGAGCCGCGAGGCCGGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 108
1139544755_1139544768 3 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544768 16:67645054-67645076 AGCTCTCGAGCCGCGAGGCCGGG 0: 1
1: 0
2: 1
3: 1
4: 72
1139544755_1139544767 2 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544767 16:67645053-67645075 AAGCTCTCGAGCCGCGAGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 27
1139544755_1139544777 18 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544777 16:67645069-67645091 AGGCCGGGGCGGGGAGGGGCCGG 0: 1
1: 5
2: 64
3: 654
4: 3529
1139544755_1139544766 -2 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544766 16:67645049-67645071 GGGCAAGCTCTCGAGCCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1139544755_1139544771 8 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544771 16:67645059-67645081 TCGAGCCGCGAGGCCGGGGCGGG 0: 1
1: 0
2: 4
3: 13
4: 199
1139544755_1139544784 29 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544784 16:67645080-67645102 GGGAGGGGCCGGGCCGGGGGCGG 0: 1
1: 7
2: 84
3: 686
4: 4436
1139544755_1139544780 23 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544780 16:67645074-67645096 GGGGCGGGGAGGGGCCGGGCCGG 0: 2
1: 28
2: 299
3: 1075
4: 6563
1139544755_1139544781 24 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544781 16:67645075-67645097 GGGCGGGGAGGGGCCGGGCCGGG 0: 2
1: 12
2: 99
3: 897
4: 3555
1139544755_1139544782 25 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544782 16:67645076-67645098 GGCGGGGAGGGGCCGGGCCGGGG 0: 1
1: 6
2: 59
3: 470
4: 2215
1139544755_1139544776 14 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544776 16:67645065-67645087 CGCGAGGCCGGGGCGGGGAGGGG 0: 1
1: 1
2: 15
3: 139
4: 1086
1139544755_1139544783 26 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544783 16:67645077-67645099 GCGGGGAGGGGCCGGGCCGGGGG 0: 1
1: 3
2: 34
3: 327
4: 1912
1139544755_1139544778 19 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544778 16:67645070-67645092 GGCCGGGGCGGGGAGGGGCCGGG 0: 1
1: 7
2: 74
3: 809
4: 3452
1139544755_1139544769 4 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544769 16:67645055-67645077 GCTCTCGAGCCGCGAGGCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1139544755_1139544772 9 Left 1139544755 16:67645028-67645050 CCCTCCCACAACCCCGCTCCCGG 0: 1
1: 0
2: 2
3: 33
4: 386
Right 1139544772 16:67645060-67645082 CGAGCCGCGAGGCCGGGGCGGGG 0: 1
1: 1
2: 1
3: 39
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139544755 Original CRISPR CCGGGAGCGGGGTTGTGGGA GGG (reversed) Exonic
900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG + Intronic
900422811 1:2562933-2562955 CGGGGAGAGGGGAGGTGGGAAGG - Intronic
900550045 1:3250120-3250142 CTGGGAGTGGGGTGGGGGGAGGG - Intronic
900568519 1:3347136-3347158 CCGGGAGTGTGAGTGTGGGAAGG + Intronic
901296043 1:8161657-8161679 GCGAGAGCAGGGTGGTGGGATGG - Intergenic
901915435 1:12495907-12495929 CAGGCAGCGGGGTTGGGGGAAGG - Intronic
902272290 1:15313320-15313342 CTGGGGGCGGGGTGGTGGGGGGG + Intronic
902863507 1:19262301-19262323 CCAGAAGCTGGGTTGGGGGAGGG + Intergenic
903048843 1:20586081-20586103 CTGGGAGCAGGGTTTAGGGAGGG + Intergenic
903321612 1:22546772-22546794 GTGGGAGTGGGGCTGTGGGAGGG + Intergenic
905375020 1:37514428-37514450 CCGGGAGCGCGGGAGGGGGAGGG - Intronic
905414500 1:37794783-37794805 GAGGGAGCTGGGGTGTGGGAAGG - Intronic
906214314 1:44030353-44030375 CCGGGGGCGGGGCCGTGGGGCGG - Intronic
907203154 1:52745284-52745306 CCGGAGTGGGGGTTGTGGGAAGG + Intronic
907407953 1:54265283-54265305 CTTGGAGAGGGGTTGTGTGAAGG + Intronic
909358166 1:74732490-74732512 CTGAGAGCTGGGCTGTGGGAAGG + Intronic
911002619 1:93181193-93181215 GCGGGGGCGGGGGTGGGGGACGG - Intronic
911725444 1:101237133-101237155 CGGGGAGCCCGGTTGTGGTAGGG + Intronic
912619489 1:111140468-111140490 TCGCGCGCGGGGTTGTGGGGAGG + Intronic
912771118 1:112465068-112465090 GAGGGAGCGGGGGAGTGGGAGGG - Intergenic
913186242 1:116373104-116373126 CCGTGGGCGGGGTTTCGGGAGGG + Intronic
915704908 1:157834575-157834597 CCGGCAGCTGGGATGTGGGAGGG - Exonic
915991128 1:160517851-160517873 TGGGGAGTGGGGTTGGGGGAGGG + Intronic
916823860 1:168426018-168426040 CCAGGAGAGGGGATGTTGGAAGG + Intergenic
918849214 1:189663380-189663402 CGGGGAAAGGGGTTGGGGGAGGG - Intergenic
920002140 1:202807661-202807683 CGGGGTGCGGGGGTGTGTGATGG - Intronic
921461545 1:215432975-215432997 GCTGGAGCTTGGTTGTGGGAGGG - Intergenic
921842135 1:219839750-219839772 CCGGCAGCGAGGCTGAGGGAGGG + Intronic
1062841967 10:679245-679267 CGGGGAGCAGGGGTGTGGGGAGG - Intronic
1062877621 10:955127-955149 CCGAGAGTGTGGCTGTGGGATGG - Intergenic
1064270033 10:13856618-13856640 CAGGGCGCGGGGGTGTGGGAAGG + Intronic
1065590359 10:27256772-27256794 GCGGGAGCGGGGGTGGGGGGCGG - Intergenic
1066293239 10:34033005-34033027 CCGGAAGTGGGGTTGGTGGAGGG + Intergenic
1067438441 10:46294742-46294764 CGGGGAGCGGGGTTTGGGCATGG + Intronic
1068788390 10:61001565-61001587 CCGGGAGCGAGGTGGCGGAACGG - Intergenic
1068903595 10:62298096-62298118 CAGTCAGCGGGGTTGTGGGTGGG - Intergenic
1069849860 10:71397593-71397615 CCAGGACCGGGGATGGGGGATGG - Intronic
1070411745 10:76148399-76148421 GCGGCAGCGAGGTTGGGGGAGGG - Intronic
1070727369 10:78801652-78801674 CTGGGAGTGGGGGAGTGGGAAGG + Intergenic
1071127220 10:82349652-82349674 GCGGCAGCGAGGTTGGGGGAGGG - Intronic
1071248056 10:83786647-83786669 GCGGGAGCGAGGCTGGGGGAGGG - Intergenic
1072116972 10:92375997-92376019 CCGGGAGGGAGGTTGAGGGGGGG + Intergenic
1072117132 10:92376357-92376379 CCGGGAGGGAGGTTGGGGGGGGG + Intergenic
1072200228 10:93151248-93151270 CTGGGAGTGGGGTTGGGGCAGGG - Intergenic
1073905782 10:108277437-108277459 CGGGGAGCGGGGGGGTGGGGGGG + Intergenic
1075291813 10:121237132-121237154 TGGGGAGAGGGGTTGGGGGATGG + Intergenic
1075483641 10:122802463-122802485 CCAGCAGCTGGGTTGTGGGAAGG + Intergenic
1076372476 10:129964308-129964330 CCGGGAGCGGCGCTGTCAGAGGG + Intergenic
1076739690 10:132477176-132477198 CCTGGAGCAGGGATGAGGGAAGG - Intergenic
1076824808 10:132961583-132961605 CCGGGAGCAGGTGTGTGGCAGGG - Intergenic
1077322823 11:1949886-1949908 GCGGGAACGGGGGTGGGGGACGG + Intronic
1077478321 11:2801443-2801465 CCGAGAGCAAGGTTGTGGAAGGG + Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1080682557 11:34490120-34490142 CCAGGAGAGGGGGTGTTGGAGGG + Intronic
1082022477 11:47546263-47546285 CCGGGGGCGGGGGCGGGGGAGGG + Intronic
1083430842 11:62612909-62612931 CCGGGGGCGGGGATCCGGGAAGG - Exonic
1083485608 11:62981384-62981406 CTGGGAGCGGGGGTGGGGGTGGG + Intronic
1083886477 11:65575917-65575939 GCGGGAGCGGGGGCGGGGGAGGG - Intergenic
1084033491 11:66494303-66494325 CCGAGGGCGGGGTTCTGGGTGGG + Intronic
1084444535 11:69196081-69196103 CCGGGGCCGGGGTTGGGGGCTGG - Intergenic
1086505741 11:87502355-87502377 CGGGGTGGGGGGCTGTGGGAGGG - Intergenic
1086628426 11:88987414-88987436 GCGGCAGCGAGGTTGGGGGAGGG + Intronic
1088472220 11:110198683-110198705 CTGGGAGTGGGGTTGGGGGGTGG - Intronic
1089144698 11:116317190-116317212 CAGGGAGTGGGGTGGTGGGGCGG + Intergenic
1090628254 11:128624515-128624537 CGGGCAGCGGGGTTGGGGGGTGG + Intergenic
1091071408 11:132567442-132567464 CCGGGAGAGAGGTGGAGGGATGG + Intronic
1202805841 11_KI270721v1_random:5199-5221 GCGGGAACGGGGGTGGGGGACGG + Intergenic
1092241906 12:6840726-6840748 CCGGGAGGAGGGTTGGGGGCAGG - Intronic
1092605227 12:10111490-10111512 GCGGGAGCTGGTTTGTGGGTCGG + Intronic
1092677362 12:10936130-10936152 GTGGGGGCGGGGTGGTGGGAGGG - Intronic
1095059555 12:37666305-37666327 GCGGCAGCGAGGCTGTGGGAGGG - Intergenic
1095950006 12:47776628-47776650 CCTGGAGCAAGGTTGAGGGAAGG + Intronic
1096191689 12:49623742-49623764 CCGGGAGGGGGGATGGGGGCGGG + Intronic
1096255404 12:50059143-50059165 CCAGGAGCAGGGCTGAGGGAGGG - Intronic
1096791582 12:54048202-54048224 CCGGGAGCTGTGTTTTGTGAGGG + Intronic
1096928964 12:55182869-55182891 CCTGGGGCGGGGTCGGGGGAGGG + Intergenic
1097166457 12:57088959-57088981 CCGGGGGCGGGGGTGGGGGCGGG - Exonic
1098618698 12:72563797-72563819 CTGGGGGCGGGGGTGGGGGATGG + Intronic
1098733885 12:74071997-74072019 CCGGGGGTGGGGTGGGGGGAGGG + Intergenic
1100419392 12:94416965-94416987 TTGGGAGGGGGGTTGCGGGAGGG - Intronic
1101837094 12:108303292-108303314 CCGGCAGCGGGGGTGTGGGCAGG - Intronic
1103032003 12:117623372-117623394 CGGGGTGCGGGGCTGGGGGAGGG - Intronic
1103415511 12:120739693-120739715 CTGGGGGCGGGGTTGTGGGGGGG + Exonic
1103856304 12:123973064-123973086 CCGGGCGCTGGGGTGGGGGATGG + Intronic
1104714771 12:131009025-131009047 GCGGGAGCAGGGTTGCGGGGCGG + Intronic
1104991365 12:132625560-132625582 CCGGGAGCCGGGGTGTGTGCAGG - Intronic
1105011918 12:132761849-132761871 CCCGGCGCGGGGTCCTGGGACGG - Exonic
1105210112 13:18252637-18252659 CCTGGAGCAGGGTTCTGGGAAGG - Intergenic
1105414007 13:20193312-20193334 CCGTGGGCGGGGTTCAGGGATGG + Intergenic
1105648179 13:22343785-22343807 CCAGGGACGTGGTTGTGGGAGGG + Intergenic
1105650290 13:22370087-22370109 CCTGGGGATGGGTTGTGGGAGGG - Intergenic
1107381134 13:39857436-39857458 GTGGGAGTGGGGTTGGGGGAAGG + Intergenic
1109290390 13:60467129-60467151 CAGGCAGTGGGGTAGTGGGAGGG - Intronic
1109496674 13:63180873-63180895 CCTGTTGTGGGGTTGTGGGAGGG - Intergenic
1109523382 13:63542948-63542970 CGGGGAGTGGGGTTGAGGGGTGG + Intergenic
1110265668 13:73534810-73534832 AGGGCAGTGGGGTTGTGGGAAGG - Intergenic
1113542007 13:111115891-111115913 CGGGGAGCGGGGTCGGGGGGAGG + Intronic
1114301735 14:21384763-21384785 CAGGGGGTGGGGTTGTGGGAAGG - Intergenic
1117856001 14:60034489-60034511 CGGGGAGCGGGGATGAGAGATGG - Intronic
1118323823 14:64768634-64768656 CTGGGAGAGGGGTTGGGGTAAGG - Intronic
1119569855 14:75660883-75660905 CCTGGAGCAGGGCTGAGGGAGGG - Exonic
1120421370 14:84290531-84290553 CGGGGAGTGGGGTGGTGGGGTGG - Intergenic
1122718621 14:103709680-103709702 CCGGGATCGGGGCTGTGGCAGGG + Intronic
1122724268 14:103740069-103740091 CGGGGAGTGGGGCTGTGGGCTGG + Exonic
1122975013 14:105167532-105167554 CCGGGAGCGGGGTCGCGGCGGGG - Intronic
1123175060 14:106409115-106409137 CCTGTAGTGGGGTTGGGGGAAGG + Intergenic
1202851471 14_GL000225v1_random:23100-23122 CGGGGAGTGGTGGTGTGGGAGGG - Intergenic
1202943624 14_KI270726v1_random:6662-6684 CCTGTAGGGGGGTTGGGGGAAGG - Intergenic
1126057003 15:44739658-44739680 GCGGCAGCGAGGCTGTGGGAGGG + Intronic
1126124470 15:45283018-45283040 CCTGTAGTGGGGTTGGGGGAGGG + Intergenic
1126143219 15:45454516-45454538 CTGGGAGCTGGGTTGAGGCAGGG + Intergenic
1126298228 15:47165950-47165972 GCGGCAGCGAGGTTGGGGGAGGG + Intergenic
1126849091 15:52786834-52786856 CAGGGGGCGGGGGTGGGGGATGG + Intronic
1129242681 15:74260951-74260973 CCTGCAGGGCGGTTGTGGGAAGG - Intronic
1129697446 15:77748622-77748644 CCTGGAGCAGAGTTGTGGGGAGG - Intronic
1129919842 15:79310984-79311006 CCGGGAGAGGCGTTGCGGGGGGG + Intergenic
1131349902 15:91690033-91690055 CCAGGGGTGGGGGTGTGGGAGGG + Intergenic
1131517411 15:93088597-93088619 CCGCGAGCCGGGCTGAGGGAAGG + Intronic
1131828456 15:96338880-96338902 CCGGGCGGGGGGTGGTGGGGGGG + Exonic
1132585775 16:705304-705326 CGGGGCGCGGGGCTGCGGGAAGG + Intronic
1133097701 16:3458349-3458371 CCGGGAGCCGGTTTCGGGGACGG + Intronic
1135400639 16:22164064-22164086 TCGGGAGGGGGGTGGGGGGATGG + Intergenic
1136627808 16:31472469-31472491 CCGGGCGCGGGGCTCTGGGGAGG + Intronic
1138515415 16:57533263-57533285 CCTGGAGCGGGTGTGTGGGAAGG + Intronic
1139215627 16:65122509-65122531 CCGGGATGGTGGTTGGGGGAAGG + Intronic
1139484978 16:67250267-67250289 CCGGGAGCGTGGTTCTGTGATGG + Intronic
1139544755 16:67645028-67645050 CCGGGAGCGGGGTTGTGGGAGGG - Exonic
1140478372 16:75250202-75250224 CCGGGAGCTGGGTGGAGGCAGGG - Intronic
1140827561 16:78721497-78721519 CTGGTGGCGGGGTTGTGGGCTGG + Intronic
1141932748 16:87216863-87216885 CCCGCAGCGGGGCTTTGGGAGGG + Intronic
1142594054 17:1021055-1021077 CTGGGTGAGGGCTTGTGGGAGGG - Intronic
1142978400 17:3658311-3658333 GCGGGAGCGGGGCGGTGGGGAGG + Intronic
1144574998 17:16423782-16423804 CCTGGAGAGGGGAAGTGGGAAGG - Intronic
1145087733 17:19956895-19956917 TCGGGAGCCTGGTTGAGGGAAGG + Intronic
1147044995 17:37745212-37745234 CCGGGAGCGGGGCTTTGCCAGGG + Exonic
1147224802 17:38968052-38968074 CCGGGAGCGGGGTTATGGCTGGG - Intergenic
1147374930 17:40017649-40017671 CGGGGACTGGGGATGTGGGAGGG + Exonic
1147462028 17:40578937-40578959 CCTGTAGTGGGGTTGGGGGAGGG + Intergenic
1148203634 17:45766038-45766060 CCTGGGGCGGGGCTGTGGGGTGG + Intergenic
1148853129 17:50564449-50564471 CCGAGAGAGGGGGAGTGGGAGGG + Intronic
1148906432 17:50915257-50915279 GCAGGAGGAGGGTTGTGGGAGGG + Intergenic
1150210411 17:63438462-63438484 CGGGGAGCGGGGTGGGGGGCGGG - Intronic
1150311177 17:64130283-64130305 CCCCGGGCGGGGATGTGGGAGGG + Intronic
1151575836 17:74952212-74952234 GCGGGGCCGGGGTTGTGGGCGGG - Intronic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1151765818 17:76132696-76132718 TCGGGGGTGGGGATGTGGGAAGG - Intergenic
1151994730 17:77601401-77601423 CCTGGGACGGGGTTGAGGGAAGG - Intergenic
1152104177 17:78319179-78319201 CAGGGATCGGGGTTTGGGGAGGG - Intergenic
1152227073 17:79097526-79097548 CCGGGGGCGGGGCTTGGGGAGGG - Intronic
1152479097 17:80538054-80538076 GCGGGAGCGGGGGAGGGGGAGGG + Intergenic
1152514953 17:80817633-80817655 CCGGGAGAAGGGGTGGGGGAGGG + Intronic
1152800371 17:82328031-82328053 CCGGGAGGGGGGCTGGTGGACGG - Intronic
1152840688 17:82566129-82566151 TCTGGAGCGGGGTGGTGTGATGG + Intronic
1153123248 18:1757310-1757332 CCGGTTGTGGGGTTGGGGGAGGG + Intergenic
1153219048 18:2846723-2846745 CCGGGAGCGAGCCTGTCGGAAGG + Intergenic
1153865535 18:9265059-9265081 GCGGGAGCGAGGCTGGGGGAGGG + Intronic
1156480116 18:37430966-37430988 CCCAGACCAGGGTTGTGGGAGGG - Intronic
1157751283 18:50180502-50180524 CGGGGAGCGGGTAGGTGGGAAGG - Intronic
1159005517 18:63006664-63006686 CCGGGAGCGGGGAGTTTGGATGG - Intergenic
1159072001 18:63634970-63634992 CCAGGAGCCGGGATGTGAGAGGG + Intergenic
1159073468 18:63652897-63652919 CCAGGAGCCGGGATGTGAGAGGG + Intronic
1159095267 18:63894585-63894607 CAGGCAGCAGTGTTGTGGGAAGG + Intronic
1160400773 18:78609970-78609992 CAGGGAGGGGGATTATGGGATGG - Intergenic
1160538578 18:79608354-79608376 CCGTGAGCTGGCATGTGGGAGGG - Intergenic
1160835430 19:1122611-1122633 GCGGGAGCGGGGGTGGGGGGCGG - Intronic
1160858336 19:1227294-1227316 CTGGGAGAGGGGCTGTGGCAAGG - Intronic
1161394844 19:4039440-4039462 CGGGGGGCGGAGTTGGGGGAAGG + Intergenic
1161403174 19:4077881-4077903 GTGGGGGCGGGGCTGTGGGAGGG + Intergenic
1161966120 19:7550182-7550204 CCAGGAGTGAGGTTGAGGGATGG - Intronic
1162036659 19:7943743-7943765 CCAGGAGCGGGGTTTCGGGTAGG + Exonic
1162739780 19:12767324-12767346 GCGGGAGCGGGGCTGAGGGCGGG + Intronic
1163226124 19:15962817-15962839 CCTGGAGTGGGGTTGGGGGCTGG - Intergenic
1163548584 19:17952839-17952861 CCGGGAGAGGGGAGGGGGGAAGG - Intronic
1163634745 19:18432762-18432784 CCTGGGCAGGGGTTGTGGGATGG + Intronic
1164730272 19:30498436-30498458 CAGGGAGTGGGGTGGGGGGACGG + Intronic
1165311456 19:35031174-35031196 GCGGGAGGGGGGTGGGGGGAAGG + Intronic
1166105618 19:40596871-40596893 ACGGGAGCGGGGTTGGGGGCAGG - Intronic
1166155451 19:40908396-40908418 CCAGGAGCGGGCCTGCGGGAGGG - Intergenic
1166764664 19:45245572-45245594 CCTGGAGCGGGGGTGAGGGTGGG - Intronic
1166822268 19:45587774-45587796 GGGGGAGCGGGGTGGTAGGAGGG + Intronic
1167210412 19:48130659-48130681 GCGGGGGAGGGGTTGTGGGTGGG + Intronic
1167253786 19:48415448-48415470 CCTGGGGCGGGGTCGCGGGAGGG + Intronic
1167501693 19:49851700-49851722 CGGGGTGGGGGGTTGGGGGACGG + Intronic
1167615789 19:50532360-50532382 CTGGGAGTGGGGATGTGGCAAGG - Intronic
1167660146 19:50791634-50791656 CCTGGAGCGGGGTGGAGAGAGGG - Exonic
1168317613 19:55490893-55490915 CCGGGAACTGGGCTGTGGGGGGG + Exonic
926126810 2:10277170-10277192 CAGGGAGCGGGGATGAGGCAGGG + Intergenic
926127079 2:10278240-10278262 CCTGGACTGGGGTTGGGGGAGGG + Intergenic
927440418 2:23112303-23112325 CAGGGGGTGGGGTTGGGGGAAGG - Intergenic
928059471 2:28096440-28096462 GCGGGAGTGAGGTTGAGGGAAGG + Intronic
928093985 2:28392998-28393020 CCGGGAGCGGGCTCCGGGGAAGG + Exonic
928254034 2:29706486-29706508 CAGGGAGCAGGCTGGTGGGAAGG - Intronic
928651612 2:33410011-33410033 CCTGGAGAGGGGATGAGGGAGGG + Intergenic
928860982 2:35856756-35856778 TCGGGGGTGGGGTTGGGGGAGGG - Intergenic
929283838 2:40113725-40113747 CAGGGAGGGGTGTTGTGGAAAGG + Intronic
930124354 2:47783903-47783925 CGGGGGGCGGGGTGGCGGGAAGG + Intronic
931739257 2:65227645-65227667 CCGGAAGCGGAGCTGCGGGAGGG + Intergenic
932419284 2:71592116-71592138 CCGGGAGCGGGTTTGTGAGAGGG + Intronic
932498748 2:72161557-72161579 ACGGGGGCGGGGTGGTGGGGGGG - Intergenic
932732804 2:74232650-74232672 GCAGGAGCGGGGTTGGGGGAGGG + Intronic
934652500 2:96100497-96100519 CATGCAGTGGGGTTGTGGGAAGG - Intergenic
934661693 2:96146484-96146506 CCGGCAGCAGGGCTGGGGGAGGG - Intergenic
935074890 2:99731511-99731533 CTGTGAGCGGGGAGGTGGGAGGG - Intronic
935837541 2:107071947-107071969 CAGGGAGTGGGGTAGGGGGAGGG - Intergenic
936432031 2:112473218-112473240 CCAGGACCTGGGTTTTGGGATGG - Intergenic
937533881 2:122862620-122862642 CCAGGAGAGGGTTTGTGGGGTGG - Intergenic
937872956 2:126798917-126798939 CCGGGTGGGGGGTTCTAGGAAGG - Intergenic
938099200 2:128486622-128486644 CCGGGGGCGGGGTGGGGGGGGGG + Intergenic
939003805 2:136764627-136764649 CGGGGACCGGAGTTGCGGGAAGG - Intergenic
939513796 2:143141048-143141070 CCTGGAGCAGGGATGGGGGAAGG + Intronic
939617778 2:144379952-144379974 CCAGGGGAGGGGGTGTGGGAGGG - Intergenic
941951537 2:171161000-171161022 GCGGGAGCAGGCTTGGGGGAGGG + Intronic
942272603 2:174291940-174291962 CCTGTCGTGGGGTTGTGGGAGGG + Intergenic
943140482 2:183975856-183975878 GCGGCAGCGAGGCTGTGGGAAGG + Intergenic
944463610 2:199978191-199978213 CCAGGATGGGGGTGGTGGGAAGG - Intronic
945032945 2:205682247-205682269 GCGGGCGAGGGGTGGTGGGATGG + Intronic
945048357 2:205801184-205801206 TGGGGAGTGGGGTGGTGGGAGGG + Intergenic
945137189 2:206641715-206641737 TCTGGAGCGGGGTTGTTGGGGGG + Intergenic
945579858 2:211579796-211579818 CAGGGGGTGGGGTTGGGGGAGGG + Intronic
946045817 2:216820052-216820074 CCAGGAGTGGGGGTGTGGGGTGG + Intergenic
947245986 2:228048995-228049017 CCGGGAAAGGGAGTGTGGGACGG + Intronic
947399257 2:229715033-229715055 CCGGGAGAAGCGCTGTGGGAAGG - Intergenic
947739954 2:232480482-232480504 CCAGGAGCGGGGTGGAGGGGAGG + Intronic
948255914 2:236567906-236567928 CAGGGCGCGGGGCTGTGGGAGGG + Intronic
1169391738 20:5196367-5196389 CCGGGGAGGGGGTTGTGGTAAGG + Exonic
1171101058 20:22384368-22384390 GGGAGAGTGGGGTTGTGGGAAGG - Intergenic
1171170545 20:23011689-23011711 CTGGGAGCTGGGTTGTGGGAGGG + Intergenic
1171291258 20:23984327-23984349 CCTGGGGCAGGGTTCTGGGAAGG - Intergenic
1171387127 20:24778116-24778138 CTGGGAGCTGGGGTGTGGGGTGG - Intergenic
1173858771 20:46268538-46268560 CCGAGCCCGGGGTGGTGGGAGGG - Intronic
1174240665 20:49132096-49132118 CCAGGAGCAGAGGTGTGGGAAGG + Intronic
1174804351 20:53593439-53593461 CCGGGAGCGGGGGTCTGCGGGGG - Intronic
1176239013 20:64067386-64067408 CCGGGAGAGGGGAAGCGGGAGGG + Intronic
1176938266 21:14892556-14892578 CAGGGAGCGGGGTGTGGGGAGGG + Intergenic
1177525974 21:22290083-22290105 CTGGGACTGGGGTTGTGGAAAGG + Intergenic
1178238481 21:30871770-30871792 GGGGGTGGGGGGTTGTGGGAGGG - Intergenic
1178974507 21:37209463-37209485 CAGGGAGCAGGGCTGTGGCAGGG - Intergenic
1179562119 21:42222091-42222113 CCCGGTGCGGGGGTGGGGGAAGG + Intronic
1180173704 21:46077110-46077132 CAGGGTGTGGGGTTGGGGGAGGG + Intergenic
1180766145 22:18346767-18346789 CCTGGAGCAGGGTTCTGGGAAGG + Intergenic
1180780168 22:18515611-18515633 CCTGGAGCAGGGTTCTGGGAAGG - Intergenic
1180812884 22:18772932-18772954 CCTGGAGCAGGGTTCTGGGAAGG - Intergenic
1181199042 22:21207180-21207202 CCTGGAGCAGGGTTCTGGGAAGG - Intergenic
1181199062 22:21207248-21207270 CCTGGAGCAGGGTTCTGGGAAGG - Intergenic
1181400702 22:22648608-22648630 CCTGGGGCAGGGTTCTGGGAAGG + Intergenic
1181702682 22:24629706-24629728 CCTGGGGCAGGGTTCTGGGAAGG + Intergenic
1182060202 22:27391749-27391771 CTGGGGGCGGGGGGGTGGGAGGG + Intergenic
1182157020 22:28083945-28083967 GCGGAAGCGAGGCTGTGGGAGGG + Intronic
1183244379 22:36682485-36682507 TCGGGAGTGGGGTGGGGGGAGGG - Intronic
1183548485 22:38467960-38467982 CCGGGAGCCGGGCGCTGGGATGG + Intergenic
1184152822 22:42648548-42648570 CCGGCGGCAGCGTTGTGGGACGG + Intronic
1184160313 22:42693722-42693744 CCTGGAGTGGGGCCGTGGGAGGG + Exonic
1185167317 22:49269687-49269709 GGGGGAGCGGGGGTGGGGGATGG - Intergenic
1185175761 22:49325635-49325657 CCGGGAGCAGGGTGGGGGCAGGG - Intergenic
1203227763 22_KI270731v1_random:87658-87680 CCTGGAGCAGGGTTCTGGGAAGG + Intergenic
949390712 3:3559132-3559154 TCAGGAGTGGGGTTGGGGGAGGG + Intergenic
950533003 3:13563853-13563875 CCTGGGGCGGGGTGGTTGGAGGG + Intronic
950550131 3:13661308-13661330 CCGGGGCCGGGGTGGTGGGAGGG + Intergenic
950652132 3:14413703-14413725 CCGGGGGTGGGGCTGGGGGAAGG + Intronic
951582003 3:24174530-24174552 CTAGGATTGGGGTTGTGGGAGGG - Intronic
953410600 3:42688578-42688600 ACGGGAGTGGGGGTGGGGGAGGG - Intronic
953412642 3:42698891-42698913 CCAGGAGCGGAGCTGTGGGCAGG + Exonic
953420805 3:42751813-42751835 TCGGCAGCGGGGTTGGGGGTTGG + Intronic
953611534 3:44451112-44451134 CCAGGAAAGGGGTAGTGGGATGG + Intronic
954438006 3:50506098-50506120 CCGGGAGCTGGGGCTTGGGACGG - Intergenic
961037498 3:123652793-123652815 GAGGGAGCGGGGCTGTGGTAAGG + Intronic
961494975 3:127284707-127284729 CCAGGAGAGGGGTTCAGGGAGGG + Intergenic
961824750 3:129593149-129593171 CCAGGAGCTGGGTTGTAGGTAGG - Intronic
962761388 3:138518116-138518138 GCGGCAGCGAGGCTGTGGGAGGG + Intronic
966249882 3:177853007-177853029 CCTGTTGCGGGGTTGGGGGAGGG + Intergenic
966329839 3:178798722-178798744 CAGGGAGTGAGGTTGGGGGAGGG + Intronic
968666819 4:1827011-1827033 CAGTGAGCGGGGCTGAGGGACGG - Intronic
969491414 4:7501193-7501215 ACGGGAGCAGGGCTGTGGGGCGG - Intronic
972503549 4:39698745-39698767 CCGGGAAGTGGGTTGGGGGAAGG + Intronic
973897943 4:55434937-55434959 AAGGGAGAGGGGTTGGGGGAGGG + Exonic
975132341 4:70842029-70842051 CTGGGAGAGGGGGTGTGGGAAGG + Intergenic
975703185 4:77086264-77086286 CTGGGATCGGGGTGGGGGGAGGG - Intergenic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
981344997 4:143664800-143664822 GCGGCAGCGAGGTTGGGGGAGGG - Intronic
982353771 4:154444652-154444674 CCTGGAGCTGTGTGGTGGGATGG - Intronic
983077779 4:163345923-163345945 CAGGGAGGGGGGGTGGGGGAGGG - Intronic
983229159 4:165112579-165112601 CTGGGCGCGGGGCTTTGGGAGGG - Intronic
985512852 5:321887-321909 CCGGGTGTGGGGCTGAGGGACGG + Intronic
985526153 5:403020-403042 CAGGGGCCGGGGGTGTGGGAGGG + Intronic
986175350 5:5347880-5347902 CTGGGAGCGGGGATAAGGGAGGG + Intergenic
986447275 5:7832340-7832362 CCAGGATCTGGGTGGTGGGAAGG - Intronic
986802093 5:11271806-11271828 CTGGGAGCGGGTGTGGGGGAAGG + Intronic
987415392 5:17656240-17656262 CCGGGAGCGGGGTGGGCGGGGGG + Intergenic
988552402 5:32208995-32209017 CCGGGAGGGAGGTGGTGGGGGGG + Intergenic
988899241 5:35714307-35714329 CAGGGAGTGGGGTTGGGGGTGGG - Intronic
989804443 5:45586232-45586254 GCGGCAGCGAGGTTGGGGGATGG - Intronic
990708576 5:58557844-58557866 GCGGCAGCGAGGCTGTGGGAGGG - Intronic
991346235 5:65671637-65671659 CCGGGGGCGGGGGTGGGGGTGGG + Intronic
992125643 5:73637282-73637304 ATGGGAGCGGGGTTAGGGGAAGG - Intronic
994262749 5:97679413-97679435 CCTGTTGCGGGGTTGGGGGAGGG - Intergenic
995407060 5:111810103-111810125 CCGAAAGAGGGGTTGGGGGAGGG + Intronic
995681300 5:114723109-114723131 CCAGGAGGGGTGTTGTGGGTAGG + Intergenic
995692660 5:114844836-114844858 GCGGCAGCGAGGTTGGGGGAGGG + Intergenic
996212724 5:120831844-120831866 GCGGCAGCGAGGTTGGGGGAGGG + Intergenic
997561036 5:134846244-134846266 CCGGGAGCGGGGTAGGGCGGCGG + Intronic
998018855 5:138753394-138753416 CCGGGGGCGGGGGCGTGGGGCGG + Intronic
998257290 5:140598021-140598043 AGGGGAGAGGGGTTGAGGGAGGG - Intergenic
998999843 5:147908384-147908406 CCGGGAGTTGGGTAGTGGGAGGG - Intergenic
999767984 5:154755420-154755442 CCGGGGGCGGGGGGGAGGGAGGG + Intronic
1000170381 5:158696700-158696722 GGGGGAGGGGAGTTGTGGGAGGG - Exonic
1001054979 5:168441858-168441880 CCGGGTGCGGCCTTGTGGGAAGG - Intronic
1001616492 5:173047369-173047391 CCAGGCCCGGGGTTGTGGGTGGG - Intergenic
1001752098 5:174139358-174139380 CCGGGAGCGGGGAGGTGGAGTGG - Intronic
1002054143 5:176589199-176589221 CCGGGAGGGAGGTTGCGGGGAGG + Intronic
1002061674 5:176629438-176629460 CGGGGAGGGGGGTTCTGGGCAGG - Intronic
1002101521 5:176860359-176860381 CCTGGAGTGGGGGTGTGGGATGG - Intronic
1002330607 5:178437820-178437842 CCTGGAGGGTGCTTGTGGGACGG + Intronic
1002685787 5:181008312-181008334 CCTGGAGCTTGGTTGGGGGAGGG + Intergenic
1003290622 6:4776145-4776167 CGGGGGGCGGGGTGGTGGGCGGG - Intronic
1003981602 6:11395377-11395399 TAGGGAGCGGGGTTGGGGGTGGG - Intergenic
1005512124 6:26520858-26520880 ACGGGGGCGGGGGCGTGGGAGGG - Intergenic
1006180437 6:32150654-32150676 CCGGGAGGGGCGTGGTGGGGGGG + Exonic
1006582588 6:35085547-35085569 CCGGGAGCTGGGCTGCGGGGAGG - Intronic
1006928596 6:37673633-37673655 CAGAGAGCGGGGCTGTGGTAAGG - Intronic
1007370225 6:41422025-41422047 CAGGGAGTGGGGTTATGGGGTGG + Intergenic
1007751351 6:44073676-44073698 GCGGGAGCGGGGGAGGGGGAAGG - Intergenic
1007841886 6:44723183-44723205 CCTGAAGCTGGCTTGTGGGAGGG + Intergenic
1008060660 6:46993221-46993243 GGGGGTGGGGGGTTGTGGGAGGG + Intergenic
1009528525 6:64779473-64779495 CCAGGAGTTGGGTTGGGGGAAGG + Intronic
1010196311 6:73242838-73242860 CCAGGACAGGGGTTGAGGGATGG + Intronic
1012547376 6:100434885-100434907 CCTGGAGCGGGGGTGGGGGAAGG + Intronic
1016999098 6:149983297-149983319 CGGGGAACAAGGTTGTGGGAAGG + Intergenic
1017470661 6:154734106-154734128 CCGGGAGGAGGGTTGGGGGAGGG + Intronic
1017708575 6:157147186-157147208 CCGGAGGCGGGGGTGAGGGATGG - Intronic
1017708634 6:157147340-157147362 CCGGAGGCGGGGGTGAGGGACGG - Intronic
1017708670 6:157147436-157147458 CCGGAGGCGGGGGTGAGGGACGG - Intronic
1017708693 6:157147500-157147522 CCGGAGGCGGGGGTGAGGGACGG - Intronic
1017708819 6:157147820-157147842 CCGGAGGCGGGGGTGGGGGACGG - Intronic
1019292244 7:256484-256506 GCGGGAGCACGGGTGTGGGAGGG - Intronic
1019421163 7:952022-952044 CTGGGAGGGGGTTTGGGGGAGGG - Intronic
1019492699 7:1322603-1322625 CCGGCATCGGGGGTGAGGGAGGG - Intergenic
1019665857 7:2252133-2252155 GTGGGAGGGGGGTTGTGGGCTGG - Exonic
1021672367 7:23046331-23046353 CCGGGAGGGAGGTTGGGGGGGGG - Intergenic
1022044477 7:26612146-26612168 GCAGGAGCGGGGTAGGGGGAAGG - Intergenic
1023922108 7:44637733-44637755 CCGGGATGGGGGTTGGGGGGTGG + Intronic
1024675512 7:51634645-51634667 CAGAGAGCTGGGTGGTGGGAAGG + Intergenic
1025050015 7:55725905-55725927 CCGTGACCGGGGTGGGGGGATGG + Intergenic
1025272703 7:57540001-57540023 GCGGCAGCGAGGCTGTGGGAGGG + Intergenic
1026101843 7:67390277-67390299 CCAGGAGCTGTGCTGTGGGAAGG - Intergenic
1027232984 7:76282752-76282774 CCAGGAGCGGGGGTGCGGGCCGG - Exonic
1027235458 7:76295104-76295126 CGTGGAGTGGGGTTGGGGGAGGG - Intergenic
1028572451 7:92306018-92306040 CCTGGGGCGGGGTGGTGGGTGGG - Intronic
1028984056 7:96996211-96996233 GCGGGGGCGGGGTTGGGGGTGGG + Intergenic
1029201208 7:98840380-98840402 CCCGGAGCAGGGTTGTGGTGGGG - Intergenic
1029599947 7:101557740-101557762 CCGGGAGTGGGGGTAGGGGAGGG - Exonic
1029698040 7:102227536-102227558 GAGGCAGCGGGGTTGTGGGCTGG - Exonic
1030346089 7:108434170-108434192 CGGGGATGGGGGTTGTGGGATGG - Intronic
1032012601 7:128356689-128356711 GCTGGGGAGGGGTTGTGGGAGGG + Intronic
1032194044 7:129779753-129779775 CCGGGAGCGGGGGGGCGGGCCGG - Intergenic
1034119697 7:148616262-148616284 CACAGAGCGGGGTTGGGGGACGG + Intergenic
1034406145 7:150903593-150903615 CCAGGAGGGGTGATGTGGGATGG - Intergenic
1034448649 7:151126040-151126062 CCGGGAGCGGGCGGGTGGGTGGG + Intronic
1034637905 7:152581891-152581913 CTGAGAGCGTGGTGGTGGGATGG - Intergenic
1036751004 8:11443729-11443751 CTGGGAGCGGTGTTGGGGGGAGG + Intronic
1037371492 8:18184031-18184053 CCCGGGGCGGGGTGGTGGGGGGG + Intronic
1037790947 8:21941225-21941247 CAGGGAGCGGGGTTGTGGCGTGG - Intronic
1037806535 8:22060719-22060741 CCAGCAGTGGGGTTGTGGGCAGG + Intronic
1038513032 8:28158529-28158551 GCGTGAGCGGGGTTGGGGGGTGG - Intronic
1039847756 8:41337674-41337696 CCGGGAGAGGGTTGTTGGGAGGG - Intergenic
1039881171 8:41626445-41626467 CCGGGAGGGAGGTTGGGGGGGGG - Intergenic
1041552838 8:59119802-59119824 CCGGGGGCGGGGCTGCGGGGCGG - Intergenic
1043414456 8:80033305-80033327 CGGGGAGGGGGGTTGGGGGGGGG + Intronic
1043485504 8:80695274-80695296 CCTGGAGCTGGGCTCTGGGAAGG - Intronic
1043722561 8:83564277-83564299 CCGGGGGTGGGGTGGTGGAAGGG - Intergenic
1047154451 8:122301420-122301442 CAGGGAGGGGGGTTGGGGGTGGG - Intergenic
1047961858 8:130016750-130016772 GCGGGCGCGGGGTTCTGGGGTGG - Intronic
1049023031 8:139970740-139970762 CAGGGAGCAGGGCTGTGGCAGGG + Intronic
1049307968 8:141917359-141917381 CGGGGAGTGGGGTGGGGGGAGGG + Intergenic
1049385624 8:142341618-142341640 CCGGGTGGGAGGTGGTGGGATGG - Intronic
1050280247 9:4043124-4043146 CCTTGAGTGGGGCTGTGGGAAGG - Intronic
1052726182 9:32230619-32230641 GCGGCAGCGAGGTTGGGGGAGGG - Intergenic
1053383545 9:37668498-37668520 CCGGGAGCAGTGTCCTGGGATGG + Exonic
1053641027 9:40080252-40080274 CTGGCAGGGGGGTTGGGGGATGG + Intergenic
1053765109 9:41385216-41385238 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1054521448 9:66077626-66077648 CCGGCTGTAGGGTTGTGGGAGGG - Intergenic
1054543725 9:66296378-66296400 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1056262020 9:84858428-84858450 CTGGAAGGGGGGTTGGGGGAGGG - Intronic
1056659701 9:88534955-88534977 GCGGGGGCGGGGATGTGGGCGGG + Intergenic
1057139077 9:92716017-92716039 CCGGGTGCGGAGCTGTGGGAGGG + Intronic
1057943173 9:99302541-99302563 CCTGGATCGGGGATGTAGGATGG - Intergenic
1058642445 9:107100604-107100626 CCAGGAACAGGGTTGTGTGAGGG - Intergenic
1059414643 9:114155459-114155481 CCGGGAGCGGGGAGGAGGGAAGG + Intergenic
1059451146 9:114372166-114372188 CTGAGAGAGGGGTTGGGGGAGGG + Intronic
1059657531 9:116369786-116369808 CAGGGAACTGGGTTGGGGGATGG - Intronic
1060258549 9:122053682-122053704 CAGGGAGCAGGGCTGGGGGAAGG + Intronic
1060573956 9:124671579-124671601 CCAGGAGTAGGGTTGTGAGAAGG - Intronic
1061064305 9:128267893-128267915 CCGAGAGCGGGGTGGGGGGAAGG - Intronic
1061840565 9:133356518-133356540 CCGGGGGCGGGGCTCTGGGCGGG - Intronic
1062084645 9:134642309-134642331 CGGGGCGCGGGGCTGCGGGATGG + Intronic
1062086819 9:134653417-134653439 CCGGGTGCGGGGGCGTGGGCTGG - Intronic
1062122520 9:134841433-134841455 CTGGGCGCTGGGATGTGGGATGG - Intronic
1062549228 9:137078302-137078324 TCTGGAGCGGGGATGTGGGGGGG - Intronic
1062656389 9:137606154-137606176 CCGGGAGCCAGGGTGCGGGAAGG - Intronic
1186551183 X:10507298-10507320 TCGGGGTCAGGGTTGTGGGAAGG + Intronic
1186624190 X:11274774-11274796 CCGGTGGTGGGGTTGGGGGAGGG - Intronic
1187403825 X:18984698-18984720 CCAGGGGCGGGGATGTGGGCGGG - Intergenic
1187948884 X:24452792-24452814 CCTGGTTCGGGGGTGTGGGAGGG - Intergenic
1189281388 X:39821849-39821871 TCGGGCGCGGGGGTGCGGGAAGG - Intergenic
1190634088 X:52417594-52417616 CAGGGAGCGGGGCGGGGGGAAGG + Intergenic
1191565017 X:62517519-62517541 GCGGCAGCGAGGCTGTGGGAGGG + Intergenic
1192621445 X:72681883-72681905 CCGGGAGGGAGGTTGAGGGGGGG + Intronic
1193033515 X:76924778-76924800 GCGGTAGCGAGGTTGGGGGAGGG + Intergenic
1193084047 X:77432646-77432668 CTGGCAGCAAGGTTGTGGGAAGG + Intergenic
1193097192 X:77563869-77563891 CCGGGGGTAGGGTTGTGGGTGGG + Intronic
1193417766 X:81244790-81244812 CCTGTAGCGGGGTGGAGGGAGGG - Intronic
1194406789 X:93506295-93506317 CCTGGAGCTGGATGGTGGGAGGG + Intergenic
1195688305 X:107604274-107604296 CGGGGAGGGGGGTGGGGGGAGGG + Exonic
1195696614 X:107672224-107672246 CTGGGGGCGGGTTTGTGGGGGGG + Intergenic
1196734819 X:118974382-118974404 TCGGAAGTGGGGTTGTGGGGTGG - Intergenic
1197131429 X:123009861-123009883 CGGGGAGTAGGGTTGGGGGAGGG - Intergenic
1198764388 X:140065680-140065702 CAGGGAAGGGGGGTGTGGGAAGG + Intergenic
1199679294 X:150214514-150214536 GAGGGAGTGGGGTTGGGGGAGGG - Intergenic
1199695932 X:150342535-150342557 GAGGGAGTGGGGTTGGGGGAGGG + Intergenic
1199973257 X:152876105-152876127 ATAGGAGCAGGGTTGTGGGAAGG + Intergenic
1200097246 X:153670048-153670070 CAGGGGGAGGGGTTGGGGGAGGG + Exonic
1200148837 X:153941687-153941709 CGGGGGGTGGGGTTGAGGGAGGG + Intronic
1200441222 Y:3214465-3214487 CCTGTAGTGGGGTTGGGGGAGGG + Intergenic