ID: 1139544820

View in Genome Browser
Species Human (GRCh38)
Location 16:67645229-67645251
Sequence GCCATGGGCCGGGCGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139544820_1139544836 13 Left 1139544820 16:67645229-67645251 CCCCGGCCCGCCCGGCCCATGGC 0: 1
1: 0
2: 6
3: 42
4: 397
Right 1139544836 16:67645265-67645287 GGCATCTCCTGTGAGCTCCGAGG 0: 1
1: 0
2: 2
3: 19
4: 153
1139544820_1139544838 23 Left 1139544820 16:67645229-67645251 CCCCGGCCCGCCCGGCCCATGGC 0: 1
1: 0
2: 6
3: 42
4: 397
Right 1139544838 16:67645275-67645297 GTGAGCTCCGAGGTAAGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 55
1139544820_1139544828 -8 Left 1139544820 16:67645229-67645251 CCCCGGCCCGCCCGGCCCATGGC 0: 1
1: 0
2: 6
3: 42
4: 397
Right 1139544828 16:67645244-67645266 CCCATGGCCCAGACCCCCGACGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139544820 Original CRISPR GCCATGGGCCGGGCGGGCCG GGG (reversed) Exonic
900102294 1:967024-967046 GAGCTGGGCGGGGCGGGCCGCGG + Intronic
900115937 1:1027954-1027976 GCTGTGGGCCGGGGCGGCCGTGG - Intronic
900119812 1:1043743-1043765 CCCTGGGGCCGGGCGGGCCAGGG + Intronic
900126682 1:1071863-1071885 GCCGGGGGCCGGGGGGGCAGGGG + Exonic
900146986 1:1162739-1162761 CCCATAGGCCGGGCGGGAGGCGG - Intergenic
900349551 1:2228164-2228186 GCCGGCGGGCGGGCGGGCCGGGG + Intergenic
900429406 1:2594747-2594769 GGCATGGGCGGGGGGGGCCAGGG - Intronic
900592933 1:3467894-3467916 GCCGTGGGCGTGGCGGGCAGCGG + Intronic
900653538 1:3743279-3743301 GCTATGGGCTGGGCTGGCTGAGG - Intergenic
900827944 1:4941534-4941556 GCCAGGGGTGGGGCGGGCTGCGG - Intergenic
900995949 1:6123924-6123946 TCTGTGGGCTGGGCGGGCCGGGG - Intronic
901022213 1:6261152-6261174 GGCGGGGGCGGGGCGGGCCGAGG - Intergenic
901028859 1:6294424-6294446 GGCGTGGGCAGGGCTGGCCGAGG + Intronic
901454043 1:9353184-9353206 TCGAGGGGCCGGGCGGGCTGAGG - Intronic
901805480 1:11736107-11736129 GCAACGGGCGGGGCGGGGCGGGG + Intronic
902385544 1:16073534-16073556 GCCAGAGGACGGGCGGGGCGGGG + Exonic
902530535 1:17087867-17087889 ACCATGTGCCGGGCAGGCCCTGG - Intronic
902536175 1:17120319-17120341 GACATGGGAGGGGCTGGCCGAGG - Intergenic
902619778 1:17644109-17644131 GACATGGGCCTGGCAGGCCATGG + Intronic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
903016872 1:20367031-20367053 GCCAGGGGCCGGGCAGGCAGGGG + Intergenic
903184757 1:21622650-21622672 GCCGCGGGCCGGGCCGCCCGGGG - Intronic
903190211 1:21652007-21652029 GCCCTGGGCCGGCCGGGCGGGGG + Intronic
903413784 1:23168148-23168170 GCCGCGGGCCGGGCGGGGAGGGG - Intronic
903543288 1:24108578-24108600 TCCATGGCCTGGGGGGGCCGGGG + Exonic
903777102 1:25800228-25800250 GCCATGGGCCGGGCCCGGCCGGG + Exonic
903931640 1:26865465-26865487 GGCCTGGGCCGGGCCGGCCGCGG + Intergenic
904215297 1:28914425-28914447 GCCAATGGGCGGACGGGCCGCGG + Intronic
904528830 1:31155071-31155093 GCCCTGGGCGGGGCAGGGCGAGG + Intergenic
904822634 1:33255912-33255934 GACTTGGGCCTGGCGGGCCACGG - Intergenic
905174055 1:36125293-36125315 GCGCTGGGCCGGGCGGGGCGCGG - Intergenic
906044418 1:42817079-42817101 CCCTGGGGCCGGGCGGGCCGGGG - Intronic
906128502 1:43442136-43442158 GGCATGGCCCGGGGGGGCGGGGG + Intronic
906259908 1:44379001-44379023 GCCATGGGTCGGGTGGGTCTTGG + Intergenic
906537306 1:46558606-46558628 GCCCTGGCCCAGGCAGGCCGTGG - Exonic
906782717 1:48586765-48586787 GCCATGGGTCCGGCTGGCCTGGG + Intronic
907051061 1:51330292-51330314 GCCAGGGGCCGGGCGGGGTGGGG + Intronic
910251471 1:85201810-85201832 GCGACGGGGCGCGCGGGCCGGGG + Intergenic
912481489 1:109985029-109985051 GCCGCTGGCCGGGCCGGCCGGGG + Exonic
913644583 1:120844540-120844562 GCGAGGGGCAGGGCGGGCCAAGG - Intergenic
915089667 1:153415704-153415726 TCCATGGGGCGGGGGGGGCGGGG + Intergenic
915333503 1:155127794-155127816 GCCGCGCGCCGGGCGGGGCGAGG + Exonic
915343453 1:155188580-155188602 ACCATGGGCTGGGGGGGCGGTGG + Intronic
915580315 1:156809312-156809334 GCCATGGGCCGGGGCAGCCCTGG - Exonic
919847167 1:201649439-201649461 GCCAGGGGCGGGGCGGGGCGGGG - Intronic
920630368 1:207645818-207645840 CCCATGGGCTGGGCTGGCCTGGG + Intronic
922701727 1:227765228-227765250 GCCTTGGGCAGGGCGGGGTGGGG + Intronic
923684127 1:236142371-236142393 GCCCGGGGGAGGGCGGGCCGGGG + Intergenic
924058060 1:240143190-240143212 GCCATGGGCATGGTGGGCAGTGG - Intronic
924539730 1:244970268-244970290 CCCTTGGGCGGGGCGGGGCGGGG - Exonic
1063464900 10:6236781-6236803 GTCCTGGGCCGGCCGGGCTGTGG + Intergenic
1065071464 10:22028869-22028891 GCCATGGGCTGGGTGGGATGGGG + Intergenic
1065636805 10:27742757-27742779 TCCTTGGGCCAGGCGAGCCGCGG + Intronic
1065883612 10:30058828-30058850 GCCAGGAGCCGGGCGGCCCCGGG + Intronic
1065883861 10:30059615-30059637 GCGGTGGGCGGGGCGGGCCCGGG - Intronic
1065992819 10:31029775-31029797 GTCAAGGGCCAGGCAGGCCGTGG - Intronic
1067037866 10:42932890-42932912 GCTGTGGGCGGGGCGGGGCGGGG + Intergenic
1068690193 10:59906420-59906442 GCCATGGCCGCGGCGGGCTGGGG + Exonic
1068955357 10:62815615-62815637 GCCCGGGGCTGGGCGCGCCGGGG + Intronic
1069750985 10:70744791-70744813 GCCTTGGGTCGGGAGGGCCAGGG + Intronic
1069761786 10:70816196-70816218 GACAGGGGCCGGGTGGGCCGAGG + Intronic
1070162546 10:73874655-73874677 GCCGGGGGCCGGGCGGGGGGGGG - Intergenic
1070660650 10:78303217-78303239 GACAATGGCCGCGCGGGCCGAGG - Intergenic
1070783481 10:79150344-79150366 GCCAGAGGCAGGGCGGCCCGAGG - Intronic
1072531588 10:96324419-96324441 GCTATGGGCTGGTCGGGTCGTGG + Intronic
1073306049 10:102504187-102504209 GCCAGGGGCCGGGGGCGCGGTGG - Exonic
1073392776 10:103193097-103193119 GCCATGGTCCCTGGGGGCCGGGG + Intronic
1074772436 10:116742638-116742660 GCGGGGCGCCGGGCGGGCCGGGG - Intergenic
1075734284 10:124654579-124654601 GCCCTGGGCAGGGAGGGCCACGG - Intronic
1075768966 10:124917299-124917321 GCGAGGGGCCCGGCAGGCCGCGG - Intergenic
1076678024 10:132158087-132158109 GCCGGGGGCGGGGCGGGGCGGGG - Intronic
1076889424 10:133276577-133276599 GCCCCGGGCCGGGGAGGCCGGGG - Intronic
1077103840 11:833434-833456 GCCATTGGCCGCGCCGGGCGGGG + Intronic
1077153615 11:1082033-1082055 GCCAGGGGCCGGGCAGGAGGAGG - Intergenic
1077167748 11:1151441-1151463 GCCAAGGCCGGGGTGGGCCGTGG - Intergenic
1077350345 11:2090331-2090353 GCCATGGGGAGGGCGGGCATGGG + Intergenic
1078128684 11:8594020-8594042 GGGATGGGGCGGGCGGCCCGGGG - Intronic
1078561582 11:12377610-12377632 GCCGCGGGCCGGTCGGGACGCGG - Exonic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1081804942 11:45885509-45885531 GCCCAGGGCCGCGGGGGCCGTGG + Intergenic
1082029529 11:47594337-47594359 GCCAGGGGCCGGGCGTGGGGAGG + Exonic
1083306143 11:61762874-61762896 GCCAGGGTCCGGGCGGACGGAGG - Intronic
1083674616 11:64318493-64318515 GGGATGAGCCGGGCGGGCGGAGG - Intronic
1083741468 11:64713712-64713734 GCCGGGGGCCGGGCGGGGCCGGG - Exonic
1084184943 11:67466582-67466604 GCCAGGGGCCTGGCTGGCTGGGG + Intronic
1084187541 11:67482877-67482899 TCCGCGGGCCGGGCGGGACGAGG - Intergenic
1084265611 11:68003868-68003890 GGCGGGGGCGGGGCGGGCCGGGG - Intronic
1084284087 11:68120729-68120751 GGCGTGGGCCGGGGGGGTCGGGG - Intronic
1084980291 11:72825255-72825277 GACATGCGCGGGGAGGGCCGGGG + Intronic
1085165820 11:74398461-74398483 GCCGTAGGCGGGGCGGGCGGCGG - Exonic
1085640064 11:78188083-78188105 GCCCTGGGCCGGCCGCGCTGTGG - Intronic
1087046961 11:93850509-93850531 GCCCGGGGCCTCGCGGGCCGGGG + Exonic
1088522262 11:110712459-110712481 GCCCGAGGCGGGGCGGGCCGCGG - Intronic
1088653332 11:111977165-111977187 GCCAGGGGCGGGGCTGGGCGGGG - Intronic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089119351 11:116122859-116122881 GCCAGTGGCCAGGCTGGCCGTGG - Intergenic
1089527654 11:119107663-119107685 AGCATGGCCCGGGCGGGCCGCGG - Exonic
1089537410 11:119169098-119169120 GCGGGGGGCAGGGCGGGCCGGGG + Exonic
1090029485 11:123195065-123195087 GCCATGTGCCGGGCGGGAGCCGG + Exonic
1090345204 11:126063411-126063433 GCGAGGGGCGGGGCGGGGCGAGG - Intergenic
1090799099 11:130159721-130159743 GCGGCGGGCTGGGCGGGCCGAGG + Exonic
1091791468 12:3274466-3274488 GCCAGGGGCAGGGAGGGCAGTGG + Intronic
1091802598 12:3334025-3334047 GCCGAGGGCCTGGCTGGCCGTGG - Intergenic
1092256222 12:6928040-6928062 GCCGAGGGCCGGGCGGGCCGCGG + Intronic
1092906081 12:13101514-13101536 GCCAGGGACCCGGCGAGCCGCGG + Intronic
1094466102 12:30754996-30755018 GCCGAGGGCGGAGCGGGCCGGGG - Intergenic
1097246445 12:57610224-57610246 GCCAGGGGCGGGGCGGTCCGGGG - Exonic
1101371957 12:104138334-104138356 GCCGGGGGCGGGGCGGGGCGGGG - Intergenic
1102124296 12:110468160-110468182 GTCATGGGCCCCGCGGGCAGCGG - Intronic
1102238683 12:111310338-111310360 GCCAGGGGCCGGGGTGGCAGGGG - Exonic
1102474369 12:113179273-113179295 GCCATGGCCCGGACGGGCAGTGG - Exonic
1102946005 12:116988779-116988801 GACATGTGACAGGCGGGCCGTGG - Exonic
1103595588 12:122022693-122022715 GCGGGCGGCCGGGCGGGCCGGGG - Intronic
1103721598 12:122978383-122978405 GCCGTGGGCCGGCCAGGCCTGGG - Intronic
1103807561 12:123584957-123584979 GCCGTGGCCGGGGCGGGGCGGGG - Intronic
1103856148 12:123972612-123972634 CCCATGGGCTGGGCGGGGCGCGG + Exonic
1104568303 12:129903962-129903984 GCCCGGGGCCGGGCGGGCCGAGG - Intergenic
1104854345 12:131894984-131895006 TCCATGGCGCAGGCGGGCCGGGG - Exonic
1104869742 12:131986543-131986565 GCCGTGGGCAGGGCGGGGCAGGG - Exonic
1105512237 13:21060975-21060997 GGCAGGGGCGGCGCGGGCCGGGG - Intronic
1105913515 13:24892527-24892549 GCCAGGGGCTGGGGGGGCAGTGG - Intronic
1105975454 13:25468743-25468765 GCCAGGGGCCGCGCGGGGCGTGG + Intronic
1106125195 13:26895475-26895497 GCCGTGGGCCGGGCTGGGAGAGG + Intergenic
1106422411 13:29595240-29595262 GACCAGGGCCGGGCGGGCCCCGG - Intronic
1106553748 13:30792714-30792736 GCCATGGGCTTGGCTGGCCGTGG + Intergenic
1106568377 13:30906202-30906224 GCCGTGGGCCGGCAGGGGCGAGG + Exonic
1113492894 13:110706172-110706194 GGCGTGGGCGGGGCGGGGCGGGG - Intronic
1114649006 14:24271429-24271451 GCCGTGGGACGGGCGGGTAGCGG - Exonic
1115399131 14:32938792-32938814 GCCCTGGGCCGGGCTGCCCGCGG + Intronic
1115566634 14:34630179-34630201 GCCAGGAGCGGGGCGGGGCGGGG + Exonic
1115752921 14:36508376-36508398 GGCAGGGGCGGGGCGGGGCGGGG + Intronic
1119898729 14:78242630-78242652 GCCAGGGACAGGGAGGGCCGGGG - Intronic
1121181497 14:91932431-91932453 TCCATGGGCTGGGCGGGGCCGGG - Intronic
1121569501 14:94936829-94936851 GCCAAGGCCAGGCCGGGCCGAGG - Intergenic
1121617061 14:95320094-95320116 GCGAGGGGCGGGGCGGGGCGGGG + Intergenic
1122226770 14:100285200-100285222 GCCAAAGGCCAGGCGGGCAGGGG - Intergenic
1122233876 14:100321269-100321291 GGCATGGGCGGGGCGGGCTGCGG + Intergenic
1122688723 14:103521796-103521818 GGTAGGGGCCGGGCGGGCCGAGG - Exonic
1122811897 14:104293353-104293375 GCCAGGGGCCTGGAGGGCCAGGG + Intergenic
1122919414 14:104873917-104873939 CCCATGTGTCGGGCGGGCTGAGG + Intronic
1123041145 14:105490693-105490715 GCCAGGGGCCGGCCGCGCTGGGG + Intronic
1123042668 14:105496732-105496754 GCCATGGGGCAGGCAGGGCGGGG + Intronic
1123630740 15:22258196-22258218 GCCGCGGGCCGGGCGGGCGCCGG - Intergenic
1126800888 15:52295632-52295654 GCCATGGGCAGGAGGGGCCGGGG + Exonic
1127788906 15:62380957-62380979 GCAATGGGCCGAATGGGCCGAGG - Intergenic
1127997758 15:64163327-64163349 GCTCCGGGCGGGGCGGGCCGCGG - Intergenic
1128344075 15:66842677-66842699 GGCCCGGGGCGGGCGGGCCGGGG + Intergenic
1128995006 15:72289323-72289345 GGGAGGGGCCGGGCGGGGCGGGG - Intronic
1129116710 15:73368778-73368800 GGGACGGGCCGGACGGGCCGGGG - Exonic
1131049038 15:89334464-89334486 GCTCTCGGCCGGGTGGGCCGTGG - Intronic
1132336901 15:101053521-101053543 GCCATGGGTTGGGCGTGCCCTGG - Intronic
1132499819 16:280365-280387 GGCACGGGCCGGGCGGGCGGCGG + Intronic
1132512979 16:353153-353175 GCCGGGGGCGGGGCGTGCCGGGG + Intergenic
1132519769 16:381802-381824 GCCATGGGCCGGGCTGGCACCGG - Exonic
1132564790 16:616986-617008 GCCACGGGCAGGGCGGGGCAGGG - Intronic
1132639462 16:971055-971077 GCCGTGGGCAGGGCCGGCCAGGG - Intronic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1132683553 16:1153295-1153317 GCCGGGAGCCGGGCGGGCTGGGG + Exonic
1132683853 16:1154149-1154171 GGCGTGGGCCGGGCGCGCGGGGG + Intronic
1132789527 16:1678049-1678071 GCGGCGGGCCGGGCGGGCCCTGG - Intronic
1132879530 16:2155869-2155891 GCCCCGGGTCGGGCGCGCCGCGG - Intronic
1132925966 16:2429304-2429326 GACATGGGCGGGGCCGGCGGCGG + Intergenic
1132935010 16:2475606-2475628 TCCCTGGGCGGGGCGGGGCGGGG - Intronic
1133272363 16:4616440-4616462 GCGCTGGGCCGGGGAGGCCGGGG + Intergenic
1133339472 16:5027342-5027364 GGCATGGGCCGGGCTGCCAGAGG - Exonic
1134149711 16:11796621-11796643 GCCCTGGGCCGGGCGGGGAGAGG - Intronic
1135047873 16:19168988-19169010 GCCGTGGGGAGGGCGGCCCGGGG + Intronic
1135725931 16:24853968-24853990 GCCAGGGGCCGCGAGGGACGTGG - Intronic
1136399285 16:30009162-30009184 GTCATGGGCTGGGCCGGGCGGGG + Intronic
1136402274 16:30025186-30025208 GTCCTGGGCCTGGCAGGCCGGGG + Exonic
1136779009 16:32885617-32885639 GCCGGGGGGCGGCCGGGCCGGGG + Intergenic
1136891609 16:33975901-33975923 GCCGGGGGGCGGCCGGGCCGGGG - Intergenic
1137988787 16:53131483-53131505 GACAGGCGCGGGGCGGGCCGCGG - Intronic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138104841 16:54282485-54282507 GGCCTGGGGTGGGCGGGCCGGGG - Intergenic
1139544820 16:67645229-67645251 GCCATGGGCCGGGCGGGCCGGGG - Exonic
1139853865 16:69965701-69965723 GCCTCGGGCGGGGCGGACCGCGG - Intergenic
1140369667 16:74406905-74406927 GCCTCGGGCGGGGCGGACCGCGG + Intergenic
1141089854 16:81122737-81122759 GCCATTGGCCGGGTGGGGGGGGG - Intergenic
1141927578 16:87179242-87179264 GACAGGGGCCGGGAGGGCAGGGG + Intronic
1141972305 16:87492377-87492399 GCCGCGGGCCGGGCGGGCGCCGG + Intergenic
1142225043 16:88873111-88873133 GCCATCGTCCGGCCGGGCCTTGG + Intergenic
1203081420 16_KI270728v1_random:1147706-1147728 GCCGGGGGGCGGCCGGGCCGGGG + Intergenic
1142496113 17:307089-307111 GCCATGGGATGGGCCTGCCGTGG - Intronic
1142683318 17:1562585-1562607 GCGGGAGGCCGGGCGGGCCGCGG - Exonic
1142799763 17:2337780-2337802 CCCCTGGGCCGCGCGGGCCAGGG - Intronic
1142859029 17:2749729-2749751 GCCGTGGGCGGGGCGGGGGGAGG + Intergenic
1142966284 17:3583781-3583803 GCCATGGGCTGGGGTGGCAGCGG - Intronic
1143109100 17:4543621-4543643 GGCGTGGCCCGGGCGGGCCTGGG + Intronic
1143153835 17:4823255-4823277 GCAATGGGCTGGGAGGGCCCTGG - Exonic
1143697544 17:8631141-8631163 GACATTGGCTGTGCGGGCCGCGG + Intergenic
1145883696 17:28368906-28368928 GCTATGGGCAGGGAGGGCCAAGG + Exonic
1146445343 17:32928249-32928271 CCGCCGGGCCGGGCGGGCCGCGG + Intronic
1147000617 17:37359400-37359422 GCTAGAGGGCGGGCGGGCCGCGG + Intronic
1147132818 17:38419174-38419196 GCCACGGGCCGGGCGGGGTGAGG + Intergenic
1147315487 17:39618169-39618191 GCCGCGCGCCGGGCGGGGCGGGG + Intergenic
1147365636 17:39957412-39957434 GCCATGGGCGGGCAGGGCTGGGG - Intergenic
1148568370 17:48646960-48646982 GAGATGGGCCTGGCGCGCCGCGG + Intergenic
1150747320 17:67825989-67826011 GCCCCGGGCCGGGGGGGGCGAGG + Exonic
1151188833 17:72383054-72383076 GCCAGGAGCTGGGCGAGCCGGGG - Intergenic
1151264723 17:72945915-72945937 GCCATGGGCTGGTGGGGTCGGGG - Intronic
1151582397 17:74987841-74987863 GCCAGGGTCCGGCCCGGCCGGGG - Exonic
1151680751 17:75621459-75621481 GCCATGGGTCTGGGGGGCCGTGG - Intergenic
1151812402 17:76452502-76452524 GCCCGGGACCGGGCGGGCCCTGG - Intronic
1151875972 17:76868544-76868566 GCCATGGGCGCGGCGCGGCGCGG + Intronic
1152526002 17:80888741-80888763 GCCACGTGCCGGGCCGGCTGGGG + Intronic
1152644862 17:81464059-81464081 GCTGTGGGTGGGGCGGGCCGGGG - Exonic
1152654318 17:81512948-81512970 GCTGGGGGCGGGGCGGGCCGGGG - Intronic
1152691658 17:81720845-81720867 GGAATGGCCCAGGCGGGCCGCGG + Exonic
1152864951 17:82716902-82716924 GCAGCGGGTCGGGCGGGCCGGGG + Intronic
1152908271 17:82982192-82982214 GTGATGGGCCGAGCGGGCCGAGG + Intronic
1154066355 18:11110701-11110723 GACCCGGGGCGGGCGGGCCGGGG - Intronic
1154208531 18:12358845-12358867 GGCATTGGCCGGACAGGCCGAGG - Exonic
1156270165 18:35523458-35523480 GCCAAGGGGCGGGAGGGCGGGGG - Intergenic
1157752959 18:50194789-50194811 GACATGGCCCGGGCCGGGCGGGG + Exonic
1158478785 18:57803076-57803098 GGCTGGGGCCGGGCGGGCGGCGG - Exonic
1159586597 18:70288834-70288856 GCCGGGGGCCGCGCGGGGCGGGG - Intergenic
1160163346 18:76491611-76491633 GCCGTGGGCGGGGCGGGAAGGGG - Intronic
1160613949 18:80109698-80109720 GCGGCGGGCGGGGCGGGCCGCGG - Intronic
1160738708 19:676330-676352 GCCGCGGGCGGGGCGGGGCGCGG - Intergenic
1160754675 19:751186-751208 GCCCCGGGCCGGGCCGGGCGGGG + Intronic
1160947798 19:1651805-1651827 GGTCGGGGCCGGGCGGGCCGGGG - Intronic
1161096827 19:2396806-2396828 GCCAGGGGGCGGGCAGGACGAGG + Intronic
1161376391 19:3941200-3941222 GCCTTGCCCCGGGCGGGCGGGGG + Intronic
1161483755 19:4523881-4523903 GCCAGCGGCCGCGCTGGCCGAGG - Exonic
1161613279 19:5255847-5255869 GCCCTAGGCCGGGCTGGGCGCGG + Intronic
1161767074 19:6213869-6213891 GCCCTGGGCCGGGCTGTCCTAGG - Intronic
1162030327 19:7914494-7914516 GTCATGGGCCTGGCAGGGCGAGG + Intergenic
1162030770 19:7916417-7916439 GCCAGGGGCCGGGCGCCGCGGGG - Exonic
1162909839 19:13842822-13842844 GCCCCGGGCCGGGCCGGCCGAGG + Intergenic
1163104439 19:15115394-15115416 GCCATGGGTCTGGGGGCCCGGGG - Exonic
1163118299 19:15200886-15200908 GCCATGGGGCCGGGGGCCCGTGG - Exonic
1163304906 19:16471891-16471913 GGTACGGGCCGGGCGGGCCTGGG - Exonic
1163329573 19:16627974-16627996 GCCAGCGGGCGGGCGGGCTGAGG + Exonic
1163612762 19:18309677-18309699 GGCATGGGCGGCGCTGGCCGAGG - Exonic
1164159633 19:22617973-22617995 GCGCTGGACCGGGAGGGCCGAGG - Intergenic
1164179574 19:22807255-22807277 CCCATGGGCCGGGCTCCCCGCGG + Intergenic
1165056144 19:33177364-33177386 GCCATGGTGCTGGCTGGCCGTGG + Intergenic
1165922611 19:39308140-39308162 GTCCTGGGCCGGCAGGGCCGGGG + Exonic
1166079378 19:40434107-40434129 GCCACGCCCAGGGCGGGCCGCGG + Intergenic
1166097404 19:40549431-40549453 GCCTGGGGCGGGGCGGGGCGGGG + Intronic
1166100817 19:40570508-40570530 GCCCGGGGCCGGTCCGGCCGAGG - Exonic
1166773402 19:45297972-45297994 GGCAGGGGCAGGGCGGGGCGGGG + Intronic
1166781750 19:45346777-45346799 GCCACGGGCAGGGCGAGGCGGGG + Intronic
1167088069 19:47324154-47324176 GGCATGGGCCAGGCAGGGCGTGG - Intergenic
1167267601 19:48491345-48491367 GCCATGGGGCGGACGGGGCGGGG - Intronic
1167270006 19:48501254-48501276 ACCACGGGCCGCGGGGGCCGAGG - Intronic
1167449193 19:49557027-49557049 GCCGCGGGCTGGGCGGGCCCAGG - Intronic
1168348307 19:55661342-55661364 GCCAGGGGCCGGGCTGGGGGTGG + Intronic
1168358685 19:55719441-55719463 GCCAGGGGCCGGGCCGGGCATGG - Intronic
925389343 2:3484810-3484832 ACCATGGGCCGGGCTGGTCCTGG - Intronic
926027358 2:9556309-9556331 GCCCGGGGCCGGGGGGGGCGGGG - Intergenic
927181142 2:20447448-20447470 GCCATGAGCGGGCCGGGCCCGGG - Exonic
927203413 2:20592329-20592351 GGAATGGGCGGGGCGGGGCGGGG - Intronic
931517774 2:63059783-63059805 GCCCAGGGCCTGCCGGGCCGCGG + Intergenic
933666656 2:84970678-84970700 GCCTTGGGCTGCGCCGGCCGCGG - Intergenic
933886132 2:86720475-86720497 GCCATGGGGCAGGCGGGCTCCGG + Exonic
933924049 2:87076231-87076253 GCCATGGGGCAGGCGGGCTCCGG - Intergenic
934993263 2:98936141-98936163 GCGCAGGGCCGGGCCGGCCGCGG - Exonic
935260307 2:101350032-101350054 GCCCAGGGCCGGGCAGGCAGTGG + Exonic
935971509 2:108534418-108534440 GCCAGGGGCCGGCCGCGCGGGGG - Intronic
936122675 2:109760379-109760401 GCCGGGGGCCAGGCGGGGCGGGG + Intergenic
936222018 2:110611094-110611116 GCCGGGGGCCAGGCGGGGCGGGG - Intergenic
937018942 2:118633090-118633112 GGCAGGGGCGGGGCGGGGCGGGG - Intergenic
937991386 2:127664276-127664298 GCCAGGGGCGGGGCGGGTGGCGG - Intronic
938338902 2:130522742-130522764 GCCACGGGCCGCGGGGGGCGCGG + Intronic
938350936 2:130598008-130598030 GCCACGGGCCGCGGGGGGCGCGG - Intronic
940420996 2:153478852-153478874 GCCGTGGGAGGTGCGGGCCGCGG + Intergenic
943645972 2:190408337-190408359 GCGACGGGCTGGGCGGGGCGCGG - Exonic
947593159 2:231396220-231396242 GAGAGGGGCCGGGCGGGCGGCGG - Intronic
947860475 2:233354435-233354457 GCCGAGGGCGGGCCGGGCCGGGG - Intergenic
948207187 2:236168465-236168487 GCCATTGGCTGAGCGGGGCGGGG + Intergenic
948427079 2:237895092-237895114 GCCATGGTGCTGGGGGGCCGTGG - Intronic
948610280 2:239162328-239162350 GCCAGGGGCAGGGTGGGCCTGGG - Intronic
948991789 2:241559233-241559255 GCCAGGGACCGGTGGGGCCGCGG - Intronic
1169131167 20:3167036-3167058 GCCATGGGCAGCGTGGGCAGTGG - Exonic
1170889140 20:20364465-20364487 GCCTGGGGCCGGGCCGGGCGGGG + Intergenic
1171217344 20:23362086-23362108 GCCAGGGGCGGGGCCGGCCGCGG + Intergenic
1171305532 20:24102639-24102661 GCCATGGGCAGGATGGGCTGGGG - Intergenic
1172094384 20:32453510-32453532 GCCATGGGAAGGGCTGGCCCTGG + Intronic
1172100744 20:32483144-32483166 GCCCTGGGCCGAGTGGGCTGGGG - Intronic
1172118712 20:32585488-32585510 CCCAGGGGCCGGGCCGGGCGGGG - Intronic
1172252551 20:33490061-33490083 GCCGGGGGCGGGGCGGGGCGCGG + Intronic
1172620754 20:36316781-36316803 GCAATGGGACGGGCTGGCCTGGG - Intronic
1172676694 20:36677400-36677422 GCCATGGGCAGGCCGGGAAGAGG - Intronic
1173279730 20:41617971-41617993 GCCGCGGGCCTGGCGGGCGGGGG - Intronic
1173852397 20:46227443-46227465 GCCAGGGGCGGGGCGGGACGAGG - Intronic
1174298821 20:49567941-49567963 GACTCGGGCCGGGCCGGCCGCGG + Intronic
1175227263 20:57451875-57451897 CCCATGGGCTGTGCGGGCCCGGG - Intergenic
1175349569 20:58309043-58309065 TCCCTGGGCGGGGCGGGCTGAGG - Intergenic
1175399650 20:58693092-58693114 GCCCAGGCCCGGGCGGCCCGCGG + Intronic
1175521472 20:59604997-59605019 GCCATGGGCCCGGCCGGCGCGGG - Exonic
1176164195 20:63664348-63664370 AGCATGGGCCTGGCCGGCCGTGG + Intronic
1178104157 21:29299321-29299343 GTCACAGCCCGGGCGGGCCGCGG - Intronic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180609203 22:17084941-17084963 CCCAGGGGCGGGCCGGGCCGAGG - Exonic
1180876915 22:19178866-19178888 GGCCTGGGCGGGGCGCGCCGAGG + Intergenic
1180908350 22:19431520-19431542 TCCATGGCCCGGGCGCGCTGAGG - Exonic
1180960522 22:19760569-19760591 GCCCCGGGCCGAGCGAGCCGCGG + Intronic
1180960585 22:19760687-19760709 GCCCCGGGCGGGGCGGGGCGGGG + Intronic
1181161979 22:20964960-20964982 GCCAGGGGCCGCTCTGGCCGGGG - Intergenic
1181404599 22:22673731-22673753 GCCATGAGCAGGGCTGGCCTGGG + Intergenic
1182260953 22:29072981-29073003 GCGCTGAGCTGGGCGGGCCGGGG + Intergenic
1183560791 22:38570712-38570734 GCCATGGGCAGCGGGGGCGGGGG - Intergenic
1183623313 22:38987187-38987209 CCCATGGGCAGAGCGGGCAGTGG - Intronic
1184086837 22:42270470-42270492 GCCGGCGGCGGGGCGGGCCGGGG + Intronic
1184090466 22:42290473-42290495 GCCATGGAGCGGGCAGGCTGGGG + Intronic
1184155188 22:42662543-42662565 AGCCCGGGCCGGGCGGGCCGGGG + Intergenic
1185381164 22:50508019-50508041 GCCGTGGGTCGGGCGGGGCGGGG - Intergenic
1185420282 22:50731066-50731088 GGCGTGGGCCGGGGGCGCCGGGG - Intergenic
1203256792 22_KI270733v1_random:143101-143123 GCTCTGGGCGGGGCGGGGCGAGG + Intergenic
950031996 3:9859690-9859712 GCCCTGGGCAGGACGGGCCACGG + Intergenic
950153736 3:10707683-10707705 GCGGCGGGCGGGGCGGGCCGGGG - Intronic
950428146 3:12935721-12935743 TCCAGGGGCCTGGGGGGCCGGGG + Exonic
952354253 3:32570304-32570326 GCTGGGGGCCGGGCGGGGCGGGG + Intronic
952905443 3:38136875-38136897 GCCATCTGCCGGGCGGGCCGCGG - Exonic
953786010 3:45911707-45911729 GCCATGAGCGGGGAGGGCCTGGG - Intronic
953909205 3:46883292-46883314 GCCGGAGGCCGGGCGGGCGGCGG - Intronic
954615601 3:51967509-51967531 GGGCCGGGCCGGGCGGGCCGGGG - Intronic
955695586 3:61632806-61632828 GCCATGGGCAGGGAGGGGAGGGG - Intronic
958936394 3:100260744-100260766 GCCGCGGGCGGGGCGGGGCGCGG - Intergenic
959984895 3:112561670-112561692 GCGACGGGACGGGCGGGACGAGG + Exonic
961383291 3:126509735-126509757 GCCAGGGGCTGGGCGGGGCCAGG - Intronic
961446342 3:126983351-126983373 GTCCGGGGCCGGGCGGCCCGTGG + Intergenic
961545299 3:127629147-127629169 GTCAGGGGCCGCGCGGGCGGCGG - Intergenic
962867776 3:139461845-139461867 GCCATGGGCCTGGCAGGCAGAGG - Intronic
963081926 3:141402479-141402501 GCCGGGGGCGGGGCGGGGCGAGG + Intronic
966849354 3:184155306-184155328 GCCGGGGGCGGGGCGCGCCGGGG + Intronic
966849381 3:184155372-184155394 GCCCTGGGCCGGGAGGGCCGCGG + Exonic
966873455 3:184307504-184307526 GCCATGGGCATGGTGGGCAGTGG + Exonic
966886664 3:184380807-184380829 GCCAGGGCCCGGGCCGGCCGCGG - Intronic
967989361 3:195119920-195119942 GTCAGGGGCTGGGCGGGGCGGGG + Intronic
968133689 3:196207623-196207645 GCCAGGGGCGGGGCGGGGCTCGG - Intronic
968133736 3:196207720-196207742 GCCAGGGGCGGGGCGGGGCTCGG - Intronic
968699371 4:2047396-2047418 TGCATGGGCCAGGCGGGGCGCGG + Intergenic
968965120 4:3765838-3765860 GCGCGGGGCGGGGCGGGCCGCGG - Intergenic
969720289 4:8889758-8889780 TCCAGGGGCGGGGCGGGGCGCGG + Intergenic
972286731 4:37656337-37656359 GCCAGGGGCTGGGAGGGCAGGGG + Intronic
972793745 4:42397295-42397317 GGCATGGGCGGGGGTGGCCGGGG + Intergenic
973107825 4:46361761-46361783 GCCATGGGCCGAGCTGCCCAAGG + Intronic
978351497 4:107824944-107824966 GCCGTGGGCCGAGTGGGGCGGGG + Intronic
985534359 5:455242-455264 GCCATGGCCCGGGAGGGCCCAGG - Intronic
985668886 5:1196290-1196312 GCAATGGGCAGGGCTGGCCAGGG + Intergenic
985696608 5:1344642-1344664 GCCGGGGGCCGGGCGGGTTGGGG - Intronic
985721277 5:1490493-1490515 ACCACGAGCCGGGAGGGCCGAGG + Intronic
986608612 5:9546156-9546178 GGCAGGGGCGGGGCGGGGCGGGG - Intergenic
987099838 5:14581963-14581985 GCCTGGGGCCGGGCGGGGCGGGG + Intronic
1001261452 5:170233121-170233143 GCGGTGGGCCGGGCTGGCCTCGG + Exonic
1001648948 5:173301865-173301887 GCCATTGCCTGGGCGGGGCGGGG - Intergenic
1001960668 5:175878828-175878850 GAGAGGGGCCGGGTGGGCCGAGG - Intronic
1002000946 5:176195981-176196003 GCCATGGGGTGGGAGGGCCCAGG + Intergenic
1002253388 5:177942991-177943013 GCCATGGGGTGGGAGGGCCCAGG - Intergenic
1002455804 5:179344977-179344999 GCCTTGGGCCGGGGGAGCCTCGG - Intronic
1002645268 5:180649621-180649643 GCCTGGGGCGGGGCGGGGCGGGG + Exonic
1003086252 6:3063771-3063793 GCCCTGGGCGGGGCGGACTGGGG + Intergenic
1003556073 6:7141226-7141248 GGCGGGGGCCGGGCGGGGCGGGG + Intronic
1003993288 6:11510259-11510281 GCCATGGGTGGGGCGGGGCAAGG + Intergenic
1004024991 6:11809694-11809716 GCCAGGGGCTGGGGGGGACGTGG + Intergenic
1005968350 6:30742784-30742806 GCCAGCGGGCGGGCGGGCTGCGG - Intergenic
1006841064 6:37028098-37028120 GCCATGGAGCGGGCGGCCAGTGG + Exonic
1007628290 6:43258996-43259018 GCCATGGGCAAGGCTGGCAGGGG - Intronic
1008511084 6:52276431-52276453 GCCATGGTCCTGGCTGACCGAGG - Exonic
1008741451 6:54614481-54614503 GCCATGGGTTGGGGGGGCCAGGG + Intergenic
1009643090 6:66362721-66362743 TCCATGGGCAGGCCGGGGCGGGG + Intergenic
1010483636 6:76383022-76383044 GCCATGAGCTGTGCGGGCTGGGG + Intergenic
1014045232 6:116877193-116877215 GCCCGGGGCGGGGCGGGGCGGGG - Intronic
1014437486 6:121437077-121437099 GCCGTGGGCCGGACGGGCGCGGG + Intronic
1015625766 6:135180502-135180524 CGCCTGGGCCGGGCGGGGCGGGG + Intergenic
1017877549 6:158536929-158536951 GCCAAGGCCGGGGCGCGCCGGGG - Intronic
1019732504 7:2635683-2635705 TCCATGGGCCGTGCTGGCCCTGG + Intronic
1020016524 7:4834914-4834936 GCCAAGGCCCGGGCGGGCAGGGG + Exonic
1020099992 7:5389186-5389208 GCCAAGGAGCGGGCGGGCCGCGG - Exonic
1020204653 7:6105226-6105248 GGCCTGGCCCGGGCGGGCGGTGG - Intronic
1021828007 7:24573635-24573657 GCCGCGCGCCGGGCCGGCCGGGG + Intronic
1022446953 7:30478665-30478687 GCCATGGTCCGGGGACGCCGGGG + Exonic
1022496092 7:30854017-30854039 GCCATGAGCTGGGCGGGACGTGG + Intronic
1023627361 7:42129518-42129540 GCCATGGGCTGGGTTGGGCGCGG + Intronic
1023773681 7:43583298-43583320 GGCTCGGGCCGGGCAGGCCGGGG + Exonic
1023972310 7:45000294-45000316 GGGGCGGGCCGGGCGGGCCGCGG + Intronic
1025994313 7:66518556-66518578 GCCATGGTGCGGGCGGGCAAGGG + Intergenic
1026990295 7:74581307-74581329 GCAATGGGCCGGGCATGCGGTGG - Intronic
1027232663 7:76281737-76281759 GCCCGGGGCCGGGGGCGCCGCGG - Exonic
1028231060 7:88306842-88306864 GCCGCGGGCCGGGCGGGTAGAGG + Exonic
1028639770 7:93029250-93029272 GCAATGGGCGTGGCTGGCCGTGG - Intergenic
1029117173 7:98243349-98243371 GGCATGGGGTGGGGGGGCCGGGG + Intronic
1032020710 7:128405971-128405993 GCCGCGGGCCGGGCGGGCCGGGG + Intronic
1034544548 7:151781349-151781371 GACATGGGGCTGGAGGGCCGGGG + Exonic
1034621970 7:152463732-152463754 GCCAATGGGAGGGCGGGCCGGGG + Intergenic
1034621987 7:152463782-152463804 GCCAATGGGAGGGCGGGCCGGGG + Intergenic
1034827828 7:154282576-154282598 GCCATGGGCAGGGAGGCCCTGGG - Intronic
1034948348 7:155279124-155279146 GCCATGGGTGGGGCTCGCCGTGG - Intergenic
1036391137 8:8325223-8325245 GTCATTGGGGGGGCGGGCCGTGG - Intronic
1037368117 8:18144523-18144545 AACATGGGCCGGGCCGGGCGTGG - Intergenic
1038583484 8:28769998-28770020 CTCGTGGGCTGGGCGGGCCGAGG + Exonic
1039973258 8:42338420-42338442 GTCCTGGGCGGGGCGGGGCGGGG - Intergenic
1040038998 8:42897302-42897324 GGCCTGGGGCGGGCGGGGCGAGG + Intronic
1040079265 8:43271105-43271127 GGCATTGGCCGGACAGGCCGAGG - Intergenic
1041698855 8:60765689-60765711 GACATGGGCCAGGAGGGCCGGGG + Intronic
1041792560 8:61714068-61714090 GCGAGGGGCCAGGCGGACCGGGG - Intronic
1049004189 8:139844515-139844537 GCCCTGTGCAGGGCGGGCAGTGG + Intronic
1049098656 8:140563831-140563853 GGCATGGGCATGGCGGGCAGTGG - Intronic
1049367968 8:142249856-142249878 ACCATGGGCCGGTCTGGCTGTGG - Intronic
1049474536 8:142790606-142790628 TCCATGGGCCGGGCCGGGCCGGG + Intergenic
1049624242 8:143612988-143613010 GCCATGGACAGGGAGGGTCGGGG + Intronic
1049687795 8:143945894-143945916 GCCAGGGGTCGGGCGGGCCCAGG + Intronic
1049720868 8:144114920-144114942 GGCAGGGGCCGGGGGGGCCTTGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1050512907 9:6413415-6413437 GGCGCGGGCCGGGCGGGGCGCGG + Exonic
1056097188 9:83267165-83267187 GCCCTGGGCCATGCAGGCCGAGG - Intronic
1057146972 9:92764947-92764969 GCCGGGGGCCGGGCGGGCGCCGG - Intergenic
1057595213 9:96410269-96410291 GCCATAGGCCTGGCTGGGCGTGG + Intronic
1057716630 9:97501478-97501500 GCCCTGGGCCGGGAGCGCAGGGG - Intronic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1060918947 9:127406989-127407011 GCCTTGGGCAGGGCAGGCTGGGG + Intronic
1061230237 9:129311768-129311790 GCCATGCCCAGGGAGGGCCGGGG + Intergenic
1061580067 9:131531044-131531066 GTAAGGGGCCGAGCGGGCCGGGG - Intronic
1061609875 9:131739538-131739560 GCCAGGGGCCGGGCCGGGCGGGG - Intronic
1061838095 9:133342375-133342397 GCCAGGGGCGAGGCAGGCCGCGG - Intronic
1061889246 9:133609055-133609077 GGTAAGGGCCGAGCGGGCCGCGG - Intergenic
1062162330 9:135087383-135087405 GCCCCGGGACGGGAGGGCCGCGG + Intronic
1062283963 9:135764911-135764933 GCCTGGGGCAGGGCCGGCCGGGG - Intronic
1062397491 9:136358334-136358356 GCCCTGGGTCGGGGAGGCCGTGG - Exonic
1062461883 9:136665728-136665750 GCCGGGGGCGGGGCGGGGCGGGG + Intronic
1062461972 9:136665971-136665993 GCCGGGGGCGGAGCGGGCCGGGG + Intronic
1062533631 9:137012235-137012257 GACATAGGCAGGGCGGGGCGGGG - Intronic
1062568676 9:137174562-137174584 GCCGTGGCCCGGGCGTGACGTGG + Intergenic
1062636163 9:137492797-137492819 GCCATGGGCTGGGTGGGCTACGG + Intronic
1185460662 X:331560-331582 GGCCTGGGCAGGGCGGCCCGTGG + Intergenic
1185610520 X:1391678-1391700 GCACTGGGCCCGGCGGGCGGGGG - Intronic
1186463420 X:9765873-9765895 GTCATGTGCTGGGCGGGCTGGGG + Exonic
1188242685 X:27809544-27809566 GCGGTGGGCGGGGCGGGGCGGGG - Intronic
1189322282 X:40094355-40094377 GCCGTGAACCGTGCGGGCCGGGG - Intronic
1189337135 X:40176776-40176798 GACAAGGGCCGGGCCGGGCGGGG - Intronic
1189659339 X:43279764-43279786 GCCTCGGGCCGGGCGGGCCGGGG + Intergenic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic
1192755951 X:74047252-74047274 GCCAAGGGCCAGGCCGGGCGCGG + Intergenic
1192762252 X:74105496-74105518 GGCGTGGACCGGGCGGGGCGCGG + Intergenic
1195923287 X:110002960-110002982 GGCAGGTCCCGGGCGGGCCGCGG + Intronic
1200084880 X:153599180-153599202 GCGAGGGGCGGGGCGGGGCGGGG - Exonic
1200100796 X:153688437-153688459 GCCGGGGGGCGGCCGGGCCGGGG - Exonic
1200179780 X:154143373-154143395 GCGCTGGGGCGGGTGGGCCGTGG + Intergenic
1200239508 X:154486433-154486455 GGCACGGGGCGGCCGGGCCGAGG - Intronic
1201504418 Y:14681882-14681904 GCAATGGGCCAGGCGGGTGGGGG - Intronic
1202246864 Y:22829132-22829154 ACCATGGGCAGGGCCTGCCGGGG - Intergenic
1202399853 Y:24462880-24462902 ACCATGGGCAGGGCCTGCCGGGG - Intergenic
1202470927 Y:25207206-25207228 ACCATGGGCAGGGCCTGCCGGGG + Intergenic