ID: 1139548598

View in Genome Browser
Species Human (GRCh38)
Location 16:67661242-67661264
Sequence TGGAGACCAGCAGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 507}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139548598_1139548609 22 Left 1139548598 16:67661242-67661264 CCTTCCTCCACTGCTGGTCTCCA 0: 1
1: 0
2: 5
3: 53
4: 507
Right 1139548609 16:67661287-67661309 GGAGGGCGGTAAGAAGACCTTGG 0: 1
1: 0
2: 0
3: 12
4: 174
1139548598_1139548604 4 Left 1139548598 16:67661242-67661264 CCTTCCTCCACTGCTGGTCTCCA 0: 1
1: 0
2: 5
3: 53
4: 507
Right 1139548604 16:67661269-67661291 TCTGTGGCCTGAGTACCTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 263
1139548598_1139548605 5 Left 1139548598 16:67661242-67661264 CCTTCCTCCACTGCTGGTCTCCA 0: 1
1: 0
2: 5
3: 53
4: 507
Right 1139548605 16:67661270-67661292 CTGTGGCCTGAGTACCTGGAGGG 0: 1
1: 1
2: 4
3: 42
4: 349
1139548598_1139548603 1 Left 1139548598 16:67661242-67661264 CCTTCCTCCACTGCTGGTCTCCA 0: 1
1: 0
2: 5
3: 53
4: 507
Right 1139548603 16:67661266-67661288 CTCTCTGTGGCCTGAGTACCTGG 0: 1
1: 0
2: 3
3: 22
4: 343
1139548598_1139548606 8 Left 1139548598 16:67661242-67661264 CCTTCCTCCACTGCTGGTCTCCA 0: 1
1: 0
2: 5
3: 53
4: 507
Right 1139548606 16:67661273-67661295 TGGCCTGAGTACCTGGAGGGCGG 0: 1
1: 0
2: 4
3: 29
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139548598 Original CRISPR TGGAGACCAGCAGTGGAGGA AGG (reversed) Intronic
900197484 1:1384075-1384097 TGGAGCCGAGCAGTGGGCGACGG - Intergenic
900284350 1:1891839-1891861 TGGAGACCTCCAGGTGAGGAAGG + Intergenic
900516913 1:3086520-3086542 AGGAGGCCAGAAGTGGAGGGAGG - Intronic
900762685 1:4483480-4483502 TGGAGACCAGCAGGGGAAACAGG + Intergenic
901153699 1:7121789-7121811 TGGGGACCCACAGTGGAGCAGGG + Intronic
902553001 1:17230360-17230382 TGGAGGGAAGCAGTGGAGGCTGG - Intronic
902638434 1:17750616-17750638 TGGAGAGCAGCTTGGGAGGAAGG + Intergenic
903225087 1:21890149-21890171 TGGAGACAGGCAGGAGAGGAGGG + Intronic
903259406 1:22123234-22123256 CCAAGACCAGCAGAGGAGGAAGG - Intronic
903974505 1:27140452-27140474 TGGGGTCAAGCACTGGAGGATGG - Intronic
904963836 1:34356246-34356268 GGGAGACCTGCAGGGCAGGATGG + Intergenic
905405548 1:37730026-37730048 TGGGGACCGTCAGTGGAGAAGGG - Intronic
905630155 1:39514109-39514131 GGGAGACAGGCAGTGGAGGCAGG + Intronic
905667605 1:39772081-39772103 GGGAGACAGGCAGTGGAGGCAGG - Intronic
905878873 1:41450706-41450728 TGGAGTCCAGCAAAGAAGGAAGG + Intergenic
906236590 1:44214845-44214867 TGGCGACGTGCAGCGGAGGAGGG + Exonic
906673677 1:47677898-47677920 TAGGGACCAGGAGGGGAGGAAGG - Intergenic
908622453 1:65999377-65999399 TGGAGAACAGGAGAGGAGGTTGG - Intronic
908796818 1:67838432-67838454 AGGAGCCCAGCTGAGGAGGAGGG + Intergenic
909094912 1:71274633-71274655 TGGAGTACAGCAATGAAGGAGGG - Intergenic
911102239 1:94104136-94104158 TGGAAGCCAGCCGAGGAGGAGGG - Intronic
912459007 1:109818872-109818894 TGGAGACCTGAAGAGGAGAAAGG - Intergenic
912869762 1:113293436-113293458 TAGAGACCAGCAGAAGAGGTAGG - Intergenic
914755552 1:150559841-150559863 TGGAGGGCCGCAGTTGAGGAGGG - Exonic
914970913 1:152307467-152307489 CGGGGTCAAGCAGTGGAGGAAGG - Exonic
915440467 1:155942470-155942492 GGGAAACCAGCAGAGGAAGAAGG - Exonic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
915942011 1:160124226-160124248 GGGAGACCAGCAGGAGAAGAAGG + Intronic
915974964 1:160379352-160379374 GGGATACCAGGAGAGGAGGAGGG - Intergenic
916555805 1:165893193-165893215 TGCAGTCTAGGAGTGGAGGAGGG + Intronic
916636227 1:166671941-166671963 TGGAGAGCAGCAGTCAAGGTTGG - Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917580203 1:176369340-176369362 TGGATTCCAGCAGTGGGGCAGGG + Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918019417 1:180671167-180671189 TAGAGGCCAGCAGAGGAGTATGG + Intronic
918068389 1:181117450-181117472 TGGAGACCAGCAGGGGTGGAGGG + Intergenic
918323664 1:183389170-183389192 TGGGGACCTGCAGTGCTGGAGGG - Intronic
918662541 1:187107085-187107107 TGGAGACTACTAGAGGAGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919191411 1:194225307-194225329 TAGAGACCACCAGTCTAGGAAGG - Intergenic
920227857 1:204450992-204451014 TGGAGGACAGCGGTGGAGGCAGG - Intronic
920260918 1:204687113-204687135 TGGAGACAAGCAGAGTAGAATGG + Intergenic
920420687 1:205831252-205831274 TTGAAACCAGGAGTGGAAGATGG - Intronic
921167178 1:212515361-212515383 TGGAGGGCTGCTGTGGAGGAAGG + Intergenic
921888249 1:220327799-220327821 TGGTGACAGGCAGTGAAGGAGGG + Intergenic
922208942 1:223472312-223472334 TGGAGTCCAGGGGTGGAGCAAGG - Intergenic
923228486 1:231961534-231961556 TGGAGACTGACAGAGGAGGAAGG - Intronic
923641192 1:235762784-235762806 GGCATTCCAGCAGTGGAGGAAGG - Exonic
924657848 1:245989678-245989700 TGGAAATCAGCAGTGCAAGATGG - Intronic
1062896382 10:1106339-1106361 TGGAGAGCAGCACTGGTGGGAGG - Intronic
1063455436 10:6179281-6179303 TGGGGAAGAGCAGTGGATGAGGG + Intronic
1063655579 10:7985304-7985326 TGGAGGCCAGCAGCTGAGGAGGG - Intronic
1063904246 10:10766406-10766428 TAGAGACCTGCAGGGGAGGAAGG + Intergenic
1064759003 10:18599581-18599603 TGTAGTCCAGCAGTGGCGCATGG - Intronic
1065844117 10:29730632-29730654 TGGAGGCCAGAAGTGGATTAAGG + Intronic
1066094958 10:32063297-32063319 TGGAGAACAGAAATGGAGGTTGG - Intergenic
1066144342 10:32541224-32541246 TGGCTACCAGCAGTGGGGGTGGG + Intronic
1067083928 10:43228326-43228348 TGCTGACCACCAGTGAAGGAGGG - Intronic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1067804732 10:49384815-49384837 TGGACGCCAGCAGTGGCTGAAGG - Intronic
1068582046 10:58752861-58752883 TGGAGGTCAGCAGTGCAGGCTGG + Intronic
1069585804 10:69601049-69601071 TATGGACCAACAGTGGAGGATGG + Intergenic
1070421931 10:76245800-76245822 TGGAAAGTAGCAGTGGAGGAGGG + Intronic
1070588660 10:77785880-77785902 TGGAGCCCAGTAGGGGAAGAAGG - Intergenic
1071263302 10:83940724-83940746 GGAAGACCAGCAGGGCAGGATGG + Intergenic
1071399185 10:85252946-85252968 TGTAGACCAGCAGTAGATTAAGG - Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1071990914 10:91100150-91100172 TGATGTCCAGGAGTGGAGGAGGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073072724 10:100805161-100805183 GGGAGGCCAGCAAGGGAGGATGG + Intronic
1073611263 10:104946329-104946351 GGGACAACAGCAGAGGAGGAGGG - Intronic
1075369285 10:121921227-121921249 TGGAGACTACTAGAGGAGGAGGG - Intronic
1075811423 10:125227475-125227497 TGGAGACAAGAAGAGGAGGTGGG - Intergenic
1075970046 10:126644293-126644315 TGGAGTTCTGCAGTGGAGGAGGG - Intronic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076462499 10:130656362-130656384 TGGAGACAGGCAGGCGAGGAGGG - Intergenic
1076635801 10:131881072-131881094 TGGAGACCACCATGGTAGGAAGG + Intergenic
1077307215 11:1873805-1873827 GGGAGCCCAGCAGAGGAGGGAGG + Intronic
1077409956 11:2399336-2399358 TTGGGAGCAGCAGGGGAGGAGGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1082097079 11:48139588-48139610 TGGAGGTCAGCAGTGGAGCCTGG + Exonic
1082885410 11:58077058-58077080 TGGAGAGGAGTAGTGGAGTAGGG + Intronic
1083207982 11:61164674-61164696 AAGAGACCAGGACTGGAGGAGGG - Intergenic
1083312666 11:61792738-61792760 TGGGGACAAGCGGTGGAGAAGGG + Exonic
1084101287 11:66951330-66951352 TGCAGACCAGCAGGGGGAGAGGG + Intronic
1084554103 11:69865552-69865574 GGGACACCAGCAGGGGAGGGGGG - Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084883658 11:72189617-72189639 TGGAGCCCAGGAGTGGAGCCTGG - Intronic
1085041874 11:73331451-73331473 TGGGGCCCAGGAGTGGGGGAGGG - Intronic
1085119470 11:73957907-73957929 TGGAGACAGGGAGGGGAGGAAGG + Intronic
1085226636 11:74927252-74927274 TGGAGGCCAGCAATGAAGCAAGG + Intronic
1085270757 11:75268666-75268688 GGGAGGCCAGGAGTGGAGAAGGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086063551 11:82724053-82724075 TGGTATCCAGCAGTGGAGGGAGG - Intergenic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1089045374 11:115497700-115497722 TGGAAACCATCAATGAAGGAAGG - Intronic
1089117536 11:116108404-116108426 AGGAGACAGGCAGGGGAGGAAGG - Intergenic
1090259576 11:125308979-125309001 TGGAGTGCATCTGTGGAGGAAGG - Intronic
1090708792 11:129366261-129366283 TGGAGAACAGAAATGGAGCAGGG - Intergenic
1091139092 11:133220127-133220149 TGGACACTGGCAGTGGAGGTTGG + Intronic
1091333723 11:134751327-134751349 TGGAGGCATGAAGTGGAGGATGG + Intergenic
1091686628 12:2567130-2567152 TGGAAAGCAGCTGTGGAGGATGG - Intronic
1092160188 12:6311525-6311547 AGGAGACCAGCAGAAGAGGATGG + Intronic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092438353 12:8472916-8472938 TGGGGACTAGTAGAGGAGGAAGG - Intronic
1092857270 12:12685713-12685735 AGGAAAGAAGCAGTGGAGGATGG - Intronic
1092999546 12:13981758-13981780 GGGAGAGCAGGAGGGGAGGAGGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095729826 12:45494285-45494307 TGGAGAACATCAGTGTAAGAAGG - Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096873222 12:54607878-54607900 TGGAGAGCAGTTGTGGAGGCTGG + Intergenic
1096886027 12:54720189-54720211 AGGAAACCAGCAGTATAGGAGGG + Intergenic
1097325250 12:58269329-58269351 TGGAGATTAGGAGTGGAGAATGG - Intergenic
1098016589 12:66111213-66111235 TGGAGACTAGGGGTGGAGGGAGG + Intergenic
1101266238 12:103090943-103090965 TGAAGACCAGCAGTTGAAGTGGG - Intergenic
1101411624 12:104473505-104473527 TAGAGATGAGCAGTGAAGGATGG + Intronic
1101424804 12:104579180-104579202 AGGAGCCCAGGAATGGAGGAGGG - Intronic
1101756102 12:107621723-107621745 TGGAGGATAGCAGTGGAGTAGGG - Intronic
1101912428 12:108870267-108870289 TGGAGACTAGCAGTGGGGTAGGG - Intronic
1102565418 12:113794411-113794433 TGGAGTCCAGCAATGGGAGAAGG - Intergenic
1103099276 12:118158369-118158391 TGGAAACCTGCAGTTTAGGAGGG - Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1103892779 12:124252428-124252450 TGGAGAACAGTTGGGGAGGAAGG + Intronic
1104140547 12:125983236-125983258 GAGAGACCAGGATTGGAGGACGG - Intergenic
1104573184 12:129943110-129943132 TGAAGACCAGCGGTGGGAGATGG + Intergenic
1104727248 12:131085582-131085604 TGGAAACCAGGAGTGGAAGGAGG + Intronic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1105322743 13:19344541-19344563 TGGAGCCCGGCAGAGGAGGGAGG - Intergenic
1105874872 13:24542174-24542196 TGGAGCCCGGCAGGGGAGGGAGG + Intergenic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1107192890 13:37610901-37610923 TGGAGAGCAAGAGGGGAGGATGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108941783 13:55964204-55964226 TGGATACCAGTGGTGGAGGTGGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1110480823 13:75973943-75973965 TGGAAACCAGGAGAGGAGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1111064188 13:83069429-83069451 TGCAGACCACCAGTGGACTAAGG - Intergenic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1113677073 13:112214778-112214800 GGGAGACCTGGAGGGGAGGAGGG + Intergenic
1113693695 13:112329623-112329645 AGGAGACCATCAGGGGATGACGG + Intergenic
1113938228 13:114006148-114006170 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938263 13:114006258-114006280 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938324 13:114006444-114006466 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938384 13:114006630-114006652 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938432 13:114006778-114006800 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938467 13:114006888-114006910 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938502 13:114006998-114007020 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938537 13:114007110-114007132 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1113938633 13:114007387-114007409 TGGCGTCCAGCAGGGCAGGAGGG - Intronic
1113938656 13:114007459-114007481 TGGTGTCCAGCAGGGCAGGAGGG - Intronic
1114129847 14:19778325-19778347 TGGAGTAGAGCAGAGGAGGAAGG + Intronic
1114238975 14:20848663-20848685 TGGAGAGCAGCACAGAAGGAGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114559346 14:23579070-23579092 AGGAGAAAAGCAGGGGAGGAGGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118909948 14:70053198-70053220 TGGCCACCAGCACTAGAGGAAGG - Intronic
1118925342 14:70186759-70186781 TGGAGACCTGCAATGCATGAAGG + Intronic
1118939354 14:70318129-70318151 TGGAGACCAGATTTTGAGGATGG - Intergenic
1119154899 14:72400940-72400962 TGCAGAGAAGCAGTGGAGAAAGG - Intronic
1120723895 14:87916645-87916667 GGGTGAGCTGCAGTGGAGGAAGG + Intronic
1121002919 14:90464995-90465017 TGGAGGCCTGCAGTTTAGGAAGG + Intergenic
1121104308 14:91270880-91270902 TGGATTCCAACTGTGGAGGAAGG + Intergenic
1121472386 14:94165628-94165650 TGGGCTCCAGCAGTTGAGGAGGG - Intronic
1122624024 14:103075169-103075191 TGGCAACCAGCCGGGGAGGAAGG - Intergenic
1123821064 15:24030952-24030974 AGTAGACCATCAGTGGTGGAAGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125722783 15:41853155-41853177 TGGAAACCAGCAGGAAAGGAAGG - Intronic
1126257644 15:46646613-46646635 TGGAGACTAGAAGTGATGGAAGG + Intergenic
1126805612 15:52345670-52345692 TGGAGTCAACCAATGGAGGATGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127117843 15:55744456-55744478 TTGAGACCAGAAGTCGAGGCTGG + Intergenic
1127422296 15:58818493-58818515 AGGAGGCTAGCAGGGGAGGACGG - Intronic
1127661049 15:61100514-61100536 TGGAGCCCTGAAGTGGAGAAGGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128460573 15:67863708-67863730 TGGAGTGCAGCGGTGGAAGAGGG - Intergenic
1129236314 15:74225787-74225809 TGGGGAGCAGCAGGGTAGGAAGG + Intergenic
1129254133 15:74324722-74324744 AGGAGGCCAGCAGTGGCTGATGG - Intronic
1129933763 15:79432493-79432515 TGGAGACCCGCAGAGAAGGGCGG + Intergenic
1130213381 15:81946446-81946468 TGGTGCCCAGCAGTGAAGGGAGG + Intergenic
1130215871 15:81968926-81968948 TGTCCACCAGCAGTGTAGGAGGG - Intergenic
1130575969 15:85093467-85093489 TGGAGACCAGCATTGCAGAATGG + Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131261784 15:90891463-90891485 GGGAGAGCAGCAGGGGAGAAAGG - Intronic
1131512195 15:93055617-93055639 TGGAGCCCACCCGTGGGGGAGGG - Intronic
1131915044 15:97255938-97255960 TGGACTCCTGCAGTGGAGAAAGG + Intergenic
1132228532 15:100164121-100164143 TGGAGTGCAGGGGTGGAGGAGGG - Intronic
1133271570 16:4613202-4613224 TGGAGACCAGGAGGGAAGCAGGG + Intronic
1133625774 16:7569251-7569273 TGGAGATCAGAAGTGTAGCATGG + Intronic
1136281192 16:29212389-29212411 TGAAGACCAGGAGGAGAGGAAGG + Intergenic
1137443021 16:48512030-48512052 TGGAGACCAGGAAGTGAGGAAGG + Intergenic
1137792518 16:51186870-51186892 AAGAGACCATCAGAGGAGGAAGG + Intergenic
1137941844 16:52695705-52695727 TGGATGCCAGCAATGGAGGAGGG + Intergenic
1138099475 16:54240935-54240957 CGGAGGCCAGCTGTGGAGTAAGG - Intergenic
1138680190 16:58678526-58678548 TGGGGCCCAGCAGAGCAGGAGGG - Intronic
1139106726 16:63835404-63835426 GGAAGAGCAGCAGTGGAGCATGG + Intergenic
1139416842 16:66819238-66819260 TGAAGACCACAAGAGGAGGAAGG - Intronic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1139602584 16:67995477-67995499 TGCTGACCAGCAGTGGATGATGG - Intronic
1139699477 16:68698855-68698877 TGGAAACCAGAAATGCAGGACGG - Exonic
1139950074 16:70664293-70664315 GGCAGCCCAGCAGTGGAGGCTGG + Exonic
1141476725 16:84279121-84279143 TGCAGAGCAGGAGTGGGGGAAGG - Intergenic
1141910883 16:87057645-87057667 TGGCGGCCAGGAGAGGAGGAGGG + Intergenic
1142687476 17:1586042-1586064 TAGAGGCCAACTGTGGAGGAAGG + Exonic
1143059439 17:4187522-4187544 TGGAGACCAGCACTGCAGAAGGG - Intronic
1144344066 17:14334086-14334108 TGGTGATCAGCTATGGAGGATGG + Intronic
1145041867 17:19582960-19582982 AGGAGGCCAGCAGGGAAGGAGGG + Intergenic
1145042543 17:19587750-19587772 AGGAGGCCAGCAGGGAAGGAGGG - Intergenic
1146688772 17:34858808-34858830 TGGAGACCAGCTGTGATGGAGGG + Intergenic
1147183092 17:38699220-38699242 TGGAGAATAGCACTGGGGGATGG - Intergenic
1147417927 17:40307147-40307169 AGGAGACAAGCAGTGGATGGCGG - Intergenic
1147653960 17:42077992-42078014 TGGAGCCCAGCAGTGGCAGGAGG - Intergenic
1147977158 17:44254527-44254549 TGAAGACCAGCAGAGCAGGCAGG + Exonic
1148668050 17:49389286-49389308 TGGAGACCCACAGGTGAGGACGG - Intronic
1148817560 17:50340990-50341012 GGGAGCCCAGCAGAGGAGGTTGG + Intergenic
1148819191 17:50350747-50350769 TGGTGAAAAGCAGAGGAGGAGGG + Intronic
1149042666 17:52209012-52209034 TAAAGACTAGCAGTGGGGGAAGG - Intergenic
1149228799 17:54507725-54507747 TGGAGACCAGCAGCCAAAGATGG - Intergenic
1150836150 17:68565802-68565824 TGGAGGCCTGGAGTGGAGAAGGG - Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151391705 17:73791581-73791603 GGGAGCCCAGGGGTGGAGGAAGG - Intergenic
1151698012 17:75727873-75727895 TGGAGGACAGCAGGGCAGGAGGG + Intronic
1152135522 17:78501086-78501108 TGGAGGTCAGCTGTGGAGGCTGG - Intronic
1152285699 17:79411495-79411517 TGGAGACCTGGAGGGGAGGTGGG - Intronic
1152286174 17:79414527-79414549 GGGAGACCAGGAGAGGTGGAAGG - Intronic
1152479625 17:80541757-80541779 TGGAGACCAAGGGTGGAGGAGGG + Intergenic
1152499618 17:80699073-80699095 TGGAGTACAGCAGTGAAGCAAGG - Intronic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1153394148 18:4598814-4598836 TAGAGAACAGAAATGGAGGATGG + Intergenic
1153986857 18:10358254-10358276 ATGAGACCAGCAGTGGCTGAGGG + Intergenic
1154110886 18:11567562-11567584 TGGAGAATGGCAGAGGAGGAGGG + Intergenic
1154241384 18:12657371-12657393 CGGGGACCCGCAGGGGAGGACGG - Intronic
1155149456 18:23111456-23111478 TGCAGACCAGGAGTGGAAGCAGG + Intergenic
1155160876 18:23194581-23194603 TGGAGACAGGGACTGGAGGAGGG + Intronic
1157167805 18:45374488-45374510 TGGAGACCACCAGAGTTGGAAGG + Intronic
1157271582 18:46280385-46280407 TGGAGACAAGCAGAGGGGGCAGG - Intergenic
1157711480 18:49852721-49852743 TGGAGACTGGCAGAGGGGGAGGG - Intronic
1157730959 18:50003895-50003917 TGAATCCCATCAGTGGAGGAGGG + Intronic
1158112533 18:53956739-53956761 TGGAGATCAACAGTGAAGAAGGG + Intergenic
1158777192 18:60597452-60597474 TGGAGACCAGCAAGGGTAGAGGG + Intergenic
1159055066 18:63455138-63455160 TGGAGACCATTAATGGAAGATGG - Intergenic
1159823145 18:73172454-73172476 TGCAGACCAGCAGTGCAAGGAGG - Intronic
1160329218 18:77977199-77977221 GGGAGGCCAGTGGTGGAGGAGGG - Intergenic
1160796836 19:949470-949492 GGGACACCAGCATTGGAGGAAGG + Intronic
1161872793 19:6883235-6883257 TTGAGGCAAGCAGTGGAGGTGGG + Intergenic
1162000372 19:7741060-7741082 TGGAAAGGAGCAGTGCAGGAGGG + Exonic
1163377719 19:16944008-16944030 TGCAGGCCAGCAGGGGAGCAAGG + Intronic
1163579702 19:18130974-18130996 TGGAGACCAGAAGTGAAGGCAGG + Intronic
1163822176 19:19502315-19502337 TGGAGGCCTGCAGTGGAGAAAGG - Exonic
1164529953 19:29041060-29041082 TGGAGACAGGCAGGGAAGGAAGG + Intergenic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1166691034 19:44821249-44821271 GGGGGACCAGCAGGGGAGGCGGG - Exonic
1167260268 19:48454264-48454286 GGGAGACTGGCAGTGGGGGACGG - Exonic
1167634950 19:50649038-50649060 TGGAGCCCAGGAGAGAAGGAGGG + Intronic
1167720983 19:51180130-51180152 TGGAGACCTCCAGAGAAGGAAGG + Intergenic
1168156188 19:54474061-54474083 TGGAGCCCAGGAGAGGAGGATGG + Intergenic
1168242690 19:55095364-55095386 TGGAGAGGAGAAGGGGAGGAAGG + Intronic
1168251675 19:55145688-55145710 TGGAGTCCAGTTCTGGAGGAGGG + Intronic
1168285752 19:55331968-55331990 TGAATCCCAGAAGTGGAGGATGG + Intronic
1168432389 19:56291560-56291582 TGTTGGGCAGCAGTGGAGGAAGG - Intronic
1168484744 19:56751411-56751433 TGGAAACAGGCAGTGGGGGAGGG + Intergenic
925192288 2:1894245-1894267 GGGAGCCCAGCAGTGCAGGGCGG + Intronic
925913350 2:8587432-8587454 TGAAGAGCTGCAGTGGAGGAGGG - Intergenic
926819939 2:16840960-16840982 TGGAGACCAGACGTGGAAGTGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
929597315 2:43184353-43184375 ATGAGACCAGCAGTGATGGAAGG - Intergenic
930177621 2:48315696-48315718 TGGAGTTAAGTAGTGGAGGATGG - Intronic
930412074 2:51037256-51037278 TGGAGCCTAGCAGTTGAGAATGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
930681316 2:54259467-54259489 GAGAGACCAGCAGGGTAGGAAGG + Intronic
932623014 2:73277212-73277234 TGGAGGGCAACTGTGGAGGAGGG - Intronic
936236382 2:110746120-110746142 TTGAGACCAGGAGTTGAGAATGG + Intronic
936516855 2:113186520-113186542 TGGAGACCAGGAGAGGAGGAAGG + Intronic
936607443 2:113972580-113972602 TGGGGAAAGGCAGTGGAGGAAGG + Intergenic
936672073 2:114668248-114668270 GGGAGGCTGGCAGTGGAGGATGG + Intronic
937278260 2:120700190-120700212 CGGAGCCCTGCAGTGGGGGAGGG - Intergenic
937425636 2:121796298-121796320 TGAAGACCTGCAGTTAAGGAGGG - Intergenic
937747309 2:125430045-125430067 TGGAAACCAGCAGGCCAGGATGG + Intergenic
937851998 2:126644111-126644133 TGCACACCAGCAGTTGAGGCTGG + Intergenic
937880454 2:126860471-126860493 TGGATAGCAGCAGAGGAGGCAGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941063308 2:160872491-160872513 TGGGTAACAGCAGTGGAGGTAGG + Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943694440 2:190909474-190909496 TGGTTACCAGAAGTGGGGGAGGG - Intronic
943747762 2:191480007-191480029 TAGAGACCAGCAATGGATGATGG - Intergenic
944340141 2:198586409-198586431 TTGCTACCAGCAGTGGATGAGGG - Intergenic
948456083 2:238105249-238105271 AAGAGGCCAGAAGTGGAGGAAGG - Intronic
948563411 2:238868440-238868462 TGGAGAGCCTCAGTGGGGGATGG + Intronic
948574990 2:238944137-238944159 TGGTGACCAGGAGGGGAGGTGGG - Intergenic
1169172187 20:3473726-3473748 TGGGGACCAGCGGTGTGGGAAGG + Intronic
1169308385 20:4514576-4514598 AGGAGACCAGCTGTTGGGGAGGG + Intergenic
1169425261 20:5491883-5491905 TGCTGGCCAGCAGTGGAGGGTGG + Intergenic
1169800641 20:9508450-9508472 TGGAGACTAGTAGGGGAGGCAGG - Intergenic
1170261583 20:14414418-14414440 TGGGGGCCAGCAATGGAGGCAGG - Intronic
1170369441 20:15632793-15632815 AGGAGGACAGCAGGGGAGGAGGG - Intronic
1171001742 20:21422490-21422512 TGGAGTCAAGCATTGGAGGTGGG - Intergenic
1171418299 20:24998728-24998750 TGGAGTTCTGCAGTGGAGGGAGG - Intergenic
1172815400 20:37682234-37682256 TTGAGAGCAGCAGGGGAGGATGG - Intergenic
1172868999 20:38123299-38123321 TTGAGCCCAGAAGAGGAGGAGGG - Intronic
1173178657 20:40784976-40784998 TGGTTACCAGAGGTGGAGGAGGG - Intergenic
1173820110 20:46014108-46014130 TGGCGCCCTGCAGGGGAGGAGGG - Exonic
1174160874 20:48549554-48549576 TGGAGAACAGGAGTGGAGTTGGG - Intergenic
1175219194 20:57407319-57407341 AGGAGACATGGAGTGGAGGAGGG + Intronic
1176300620 21:5097310-5097332 GGGAGACCAGCAGAGGTGGAGGG - Intergenic
1178185248 21:30211243-30211265 TGGAGCCCAGGAATGAAGGAAGG - Intergenic
1178627051 21:34227136-34227158 TGGAGAGCAGCATCGGAGGCAGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179508622 21:41858037-41858059 TGGGGTCCAGCGATGGAGGAGGG + Intronic
1179856423 21:44164671-44164693 GGGAGACCAGCAGAGGTGGAGGG + Intergenic
1179913243 21:44461077-44461099 TGGGGTCCAGCAGTGGGGGATGG + Exonic
1179978806 21:44885794-44885816 TATAGACCAGCAGGTGAGGAAGG + Intergenic
1180189857 21:46157666-46157688 GGGAGACCAGGAGGGGAGGATGG + Intergenic
1180189878 21:46157741-46157763 TGGAGGCCAGGAGGGGAGGATGG + Intergenic
1180826044 22:18862347-18862369 GGGAGACCATCAGGGGAGGGAGG + Intergenic
1181117199 22:20639605-20639627 TGGCTTCCAGCAGAGGAGGATGG - Intergenic
1181186690 22:21112204-21112226 GGGAGACCATCAGGGGAGGGAGG - Intergenic
1181212512 22:21298290-21298312 GGGAGACCATCAGGGGAGGGAGG + Intergenic
1181661292 22:24351083-24351105 TGGAAAGCAGCAGTGGAGAGTGG - Intronic
1182882632 22:33746832-33746854 TGGAGCCCAGGAGAGGAGGAGGG + Intronic
1183306421 22:37085553-37085575 TGGAGCTCAGGAGGGGAGGATGG - Intronic
1183362076 22:37387958-37387980 GGGAGAGAAGCAGGGGAGGAGGG - Intronic
1183480144 22:38059290-38059312 TCGGGATCAGCATTGGAGGAGGG + Exonic
1183667265 22:39253179-39253201 TAAAGACCACCAGTGGGGGAGGG + Intergenic
1184080299 22:42214632-42214654 TGGTAACCAGCAGCAGAGGATGG + Exonic
1184300662 22:43557103-43557125 TGGAGCCCAGCATGGGAAGATGG + Intronic
1184824283 22:46936522-46936544 TGGAGATCATCAAAGGAGGATGG - Intronic
1203276186 22_KI270734v1_random:88253-88275 GGGAGACCATCAGGGGAGGGAGG + Intergenic
949609086 3:5685728-5685750 TGAAGACCACCAGTGGGGTATGG + Intergenic
949856528 3:8467003-8467025 TGAGGTCCAGCAGTGGAGGTGGG - Intergenic
950153990 3:10708495-10708517 GGGAGACCCGCTTTGGAGGAGGG + Intergenic
950521074 3:13498487-13498509 TGGAGACAAGCAGAGGGTGAGGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
953227717 3:41035538-41035560 TGCAGGCCAGCAGTACAGGAAGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953853131 3:46480990-46481012 TGCCTATCAGCAGTGGAGGAGGG - Intronic
954259756 3:49430105-49430127 TGGAAATCAGCAATGGATGAGGG - Intergenic
954373874 3:50184236-50184258 TGCAGTCCAGCTGTGCAGGAGGG + Intronic
954614541 3:51962894-51962916 TGGAGATGAGCAGTGGATGCAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955536371 3:59928069-59928091 AGGACACCAGCTGTGGAGCAGGG - Intronic
956199557 3:66692110-66692132 TGGGGAGCAGGGGTGGAGGAAGG + Intergenic
956304572 3:67809738-67809760 TGGACACCTGCAGTGGTGGGAGG - Intergenic
957629293 3:82697905-82697927 TTGTCACCAGCAGTGTAGGAGGG - Intergenic
958964424 3:100542872-100542894 TGGGGACCACTAGAGGAGGAAGG + Intronic
959730534 3:109596351-109596373 TGGAATCCAGGAGTGAAGGAGGG + Intergenic
961803092 3:129467847-129467869 TGGGGACCAGTAAAGGAGGAAGG + Intronic
962852116 3:139315854-139315876 TGCTGAGCTGCAGTGGAGGATGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
965118701 3:164522505-164522527 TGGGCACCAGCAGTGGAGAGAGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965472920 3:169117444-169117466 TGGGAACCAGCAATGCAGGATGG - Intronic
966758087 3:183390253-183390275 TGGAGATAAGTAGGGGAGGAAGG - Intronic
967263842 3:187672579-187672601 TGGTGAGAAGCAGTTGAGGAGGG - Intergenic
967856487 3:194121644-194121666 TGGAGAGCAGGAGAGCAGGAGGG - Intergenic
968032657 3:195514331-195514353 TGGATACCAGGAGTGGATCATGG - Intergenic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968761526 4:2444742-2444764 TGGAAGCCAGCAGTGGAGAAAGG - Intronic
969137256 4:5040026-5040048 TGAAGACCTGCTGGGGAGGACGG - Intergenic
969518598 4:7662431-7662453 TGGAGCCCAGCAGAGGTGGCTGG - Intronic
972863135 4:43196466-43196488 TGGAGAACTGCAGTAGAGGTTGG - Intergenic
973240792 4:47954109-47954131 TGGAGAGCAGCAGAGCAGCACGG + Intronic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
977277961 4:95002137-95002159 TGGAGACTACCAGAGGTGGAGGG - Intronic
977457344 4:97277972-97277994 TGGAGACCAGAAGTGCAAAATGG - Intronic
977930121 4:102741761-102741783 TGGAGACTTGCAGGGAAGGATGG + Intronic
978238312 4:106487241-106487263 TGGTGACAAGCAGTGGAGGGTGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978595495 4:110373227-110373249 GGGAGAGCAGCAGTGAAGGCAGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980212516 4:129808082-129808104 TGGAGAGCAGGAGAGAAGGAAGG - Intergenic
980874249 4:138645003-138645025 TGGAGAGCAGCAGCAGAAGAGGG - Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
981240875 4:142474508-142474530 TGGATACCAGCAGTGGGAGTGGG - Intronic
981460805 4:145011510-145011532 TGGAGACCAGGATTCGAGGGAGG + Intronic
981542820 4:145863280-145863302 TGCCCACCAGCAGTGGATGAGGG - Intronic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982112016 4:152065549-152065571 TGCAGAACTGCAGTAGAGGAAGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983202550 4:164877101-164877123 AGGAGAAGAGGAGTGGAGGAGGG + Exonic
984404311 4:179307492-179307514 TGGAGACAGACAGTGGAGGTAGG + Intergenic
984937008 4:184898285-184898307 TGGAGCCCAGCACTCCAGGAGGG + Intergenic
985267285 4:188161862-188161884 TGGAGACCAGGACTTCAGGAGGG + Intergenic
986074941 5:4326839-4326861 TGGAGGGCAGCAGAGGTGGAGGG - Intergenic
986074949 5:4326869-4326891 TGGAGGGCAGCAGAGGTGGAGGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
986988748 5:13527467-13527489 TGGAGAAGAGAAATGGAGGAAGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987985427 5:25140160-25140182 TCAAAACCAGCAATGGAGGATGG - Intergenic
988487337 5:31677874-31677896 AGGACAGCAGCAGAGGAGGAAGG + Intronic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990665417 5:58066701-58066723 TGGAGAACAGTAGAGGAAGAAGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991445723 5:66698312-66698334 TTGAGACAAGGAGAGGAGGAGGG - Intronic
992017369 5:72589519-72589541 TGGAGAGTAAAAGTGGAGGAAGG + Intergenic
993083085 5:83326825-83326847 TGGGGACAAGCAATTGAGGAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993498909 5:88641032-88641054 TGGAGACTAGAAGTCCAGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994576981 5:101590563-101590585 TGGAAACCACCAGTGGAGCCTGG + Intergenic
995242585 5:109901853-109901875 TGGAGACCAGGAGCAGGGGAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996900061 5:128534838-128534860 TGGAGAGCAGCCGAGGAGGAGGG - Intronic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997065786 5:130556949-130556971 TGAAGAGCAGCGGTGGTGGAGGG - Intergenic
997525073 5:134547805-134547827 TGGAGCCCAGCAGTGCAAGCAGG - Intronic
999201130 5:149817026-149817048 TGGTGACCAGGGGTGGGGGATGG - Intronic
999623081 5:153491578-153491600 TGGAGACCACCAGCGCAGCATGG - Intronic
1001635533 5:173207508-173207530 TGGTGACCAGGAGTGGGAGATGG + Intergenic
1002419702 5:179139233-179139255 AGGAGACAGGCAGTGGAGGAGGG + Intronic
1004872308 6:19919251-19919273 TGGAGACTACCAGAGGGGGAGGG + Intergenic
1006175125 6:32116904-32116926 AGGAGACCCCCAGTGGAGGAGGG + Intronic
1006389643 6:33750984-33751006 GGGAGCCCAGCATGGGAGGAGGG - Intergenic
1006494765 6:34414385-34414407 TGGAGACCAACCCTGGAAGATGG + Intronic
1006813948 6:36838575-36838597 TAGAGTCCAACAGAGGAGGAGGG - Intronic
1007081614 6:39109188-39109210 TGGAGGTCAGGAGTGGTGGATGG + Intronic
1007135930 6:39521981-39522003 GGGAGGCCAGCAGTGGAAGGAGG - Intronic
1007925408 6:45646003-45646025 TGGAGACCAGTAGGAGAAGAGGG + Intronic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009325798 6:62346377-62346399 TGGTGACAAGCAGTGGGGTAGGG - Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009731220 6:67609619-67609641 GGCAGACCTGCAGTGGAAGAAGG + Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010828792 6:80505771-80505793 TGGACTCAAGCAGTGAAGGAGGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1012069439 6:94594041-94594063 TGGAGCCGCTCAGTGGAGGACGG + Intergenic
1012220093 6:96638598-96638620 TGGGTATCAGCAGTGGAGGCTGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1015339709 6:132084444-132084466 TGAAGACCAGCTGAGGAGGCCGG + Intergenic
1015602912 6:134927947-134927969 GGGAGACCAACAGTTGTGGATGG - Intronic
1015859977 6:137665727-137665749 TGGAGAGCACCAGGTGAGGATGG + Intergenic
1016027271 6:139300097-139300119 TTGTGATCAGCAGGGGAGGAGGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016894459 6:149038487-149038509 TGGAAACTAGAAGAGGAGGAAGG + Intronic
1018980317 6:168596570-168596592 CGGAGAGCAGCAGCTGAGGATGG - Intronic
1018992842 6:168687166-168687188 GGGAGCACAGCAGGGGAGGAGGG - Intergenic
1019184387 6:170212646-170212668 TGGAGCCCAGCAGAGGACGCTGG - Intergenic
1019262747 7:91323-91345 TGGAGAACAGCAGGTGAGGGTGG + Intergenic
1019308461 7:347441-347463 TGGAGGTCAGCATTGGTGGAGGG - Intergenic
1019912692 7:4110347-4110369 TGGAGGCCATCAGTGATGGAGGG - Intronic
1019922439 7:4171640-4171662 TGGCCACCACCAGTGGATGAGGG - Intronic
1023821120 7:43981032-43981054 TGGAGACCAGAAGGCCAGGAAGG + Intergenic
1023834326 7:44059479-44059501 TGGGGGACAGCAGTGGAGAAGGG + Intronic
1023897425 7:44445504-44445526 TGGAGGTCAGCAGTTGAGAAGGG - Intronic
1024571911 7:50730194-50730216 TGGAGGGCAGCAGTTGGGGAGGG - Intronic
1024715866 7:52078601-52078623 TGGAGAGCAGCAGGGGACCATGG - Intergenic
1025159614 7:56643631-56643653 TGGAGACCACTAGCGGAGGAAGG - Intergenic
1025727091 7:64075718-64075740 TGGAGACCACTAGTGGAGGAAGG + Intronic
1026788482 7:73316911-73316933 TGGGGACCAGCAGTGTTGGTTGG + Intronic
1027047797 7:75002682-75002704 TTGAGGCCAGGAGTGGAAGAGGG + Intronic
1027374387 7:77536664-77536686 TGGAGTCCAGGAGTGGGGGCGGG - Intergenic
1027614235 7:80401653-80401675 GGGAGGCCAGGAGAGGAGGATGG + Intronic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1029157574 7:98528266-98528288 TGGAGAGAAGCAGAGGATGACGG - Intergenic
1029385199 7:100238964-100238986 TTGAGGCCAGGAGTGGAAGAGGG - Intronic
1029749393 7:102534471-102534493 TGGAGACCAGAAGGCCAGGAAGG + Intergenic
1029767339 7:102633576-102633598 TGGAGACCAGAAGGCCAGGAAGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030756291 7:113291477-113291499 TGCTGACCAGCATTGGAGGGAGG + Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031070422 7:117155446-117155468 TGGAGAGCAGGAATGGAGGCAGG + Intronic
1031423038 7:121572234-121572256 TGCACACAAGCAGTGTAGGAAGG - Intergenic
1031870687 7:127087193-127087215 TGGAACCCTGCAGTGGAGAAGGG - Intronic
1031916166 7:127564884-127564906 AGGAGTCCAACAGTGGAAGAAGG - Intergenic
1034089399 7:148350044-148350066 GGGAGACCATGAGTGGAGGCAGG + Intronic
1034925625 7:155119118-155119140 TTGAGACCAGCAGTGGCAGAAGG + Intergenic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1035421312 7:158731086-158731108 TAGAGAACAGCGGTGGGGGATGG - Exonic
1036121215 8:6019957-6019979 TGGCCTCCAGCAGTGGAGGTGGG + Intergenic
1036766075 8:11550069-11550091 TGGGGACAGGCAGTGCAGGAGGG + Intronic
1037776892 8:21841428-21841450 TGGAGCCCAGTGCTGGAGGAAGG + Intergenic
1037835845 8:22214302-22214324 TGGAGAGGAGGAGGGGAGGAAGG + Intergenic
1038036058 8:23687949-23687971 TGGAGGGTAGCAGTGGAGGCAGG - Intergenic
1038159382 8:25022429-25022451 GGGAGGGCAGCAGTGGAGGCTGG + Intergenic
1038259519 8:25980828-25980850 TGGAGGAAAGCAGTGGGGGAGGG + Intronic
1038636987 8:29295494-29295516 TTGAGACCAGCTGTAGAGGCAGG - Intergenic
1039923058 8:41906619-41906641 GGGAGACCTGCAGGGGAGGGAGG - Intergenic
1040072123 8:43196760-43196782 TGGAGACTAACAGAGGAGCATGG - Intronic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041789424 8:61676369-61676391 TGGAAAAAAGAAGTGGAGGAAGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042721353 8:71830152-71830174 GAGAGCCCAGCAGTGGAGGCAGG - Intronic
1042781337 8:72494428-72494450 TGAACACAAGCAGTAGAGGAAGG - Intergenic
1043493195 8:80770335-80770357 TGGTTACCAGGAGTGAAGGAGGG - Intronic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045586562 8:103544397-103544419 TGGCTACCAGCAGTGGAGGTGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1046102945 8:109635481-109635503 TGGTGACCAGCAGAAGTGGAGGG - Intronic
1046643165 8:116755348-116755370 TGGAGACCAGCAGCTAACGAAGG - Intronic
1047000983 8:120572006-120572028 TGAAGACCAGCAGCGGGGGTGGG - Intronic
1047201883 8:122774057-122774079 TGGAAACCAGGAGTGGGGAAAGG + Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047401690 8:124553539-124553561 GGGAGGCCAGCAGTTGAGGCTGG + Exonic
1047614269 8:126550257-126550279 TGCACCCCAGAAGTGGAGGAGGG - Intergenic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048500269 8:134968985-134969007 GGGAGACAAGCAGAGGAGCAGGG - Intergenic
1048991282 8:139761667-139761689 TGGAGCCAGGAAGTGGAGGATGG - Intronic
1049033170 8:140052056-140052078 AGGTGACCACCAGAGGAGGAAGG + Intronic
1049051827 8:140203822-140203844 TGGGTACCAGGAGTGGTGGAAGG + Intronic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1052077272 9:24158787-24158809 AGGAGAGCAGGAGGGGAGGAGGG - Intergenic
1053001707 9:34580353-34580375 TGGGGCCCAGGAGAGGAGGAAGG - Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053519975 9:38767464-38767486 TGGAGAGTAGCTGTTGAGGACGG + Intergenic
1054904987 9:70406811-70406833 AGGATTCTAGCAGTGGAGGAAGG + Intronic
1055375927 9:75648261-75648283 GGGAGAGGAGCAGGGGAGGAGGG + Intergenic
1056232403 9:84559893-84559915 TGGAGAAAAGGAGTTGAGGAAGG + Intergenic
1056719226 9:89058823-89058845 TGGAGGACAGTGGTGGAGGATGG + Intronic
1056719310 9:89059186-89059208 TGGAGGACAGTGGTGGAGGACGG + Intronic
1056877673 9:90350009-90350031 TGGCTACCAGCAGTAGAGGTGGG - Intergenic
1057165014 9:92918679-92918701 TGGAGACCAGCGGCTGAAGAAGG + Intergenic
1058139553 9:101342619-101342641 TGGGGACCAGGAGAGGGGGAAGG + Intergenic
1058176212 9:101738498-101738520 GGGTGGCCAACAGTGGAGGAAGG - Exonic
1058919861 9:109603312-109603334 GGGAGACTAGCAGTGGGGAAGGG + Intergenic
1059041532 9:110820555-110820577 TGTGGACCAGCAGTGCAGGATGG + Intergenic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1060190573 9:121589750-121589772 TGTAGAGCACCAGTGTAGGAAGG - Intronic
1060462901 9:123875511-123875533 TGGAGAAAAGCAGTGGTGCAGGG + Intronic
1060904043 9:127288455-127288477 TGGAGAGGAGCAGTGGTAGATGG + Intronic
1061230103 9:129310785-129310807 TGGAGACCAGCAGGAGAGACAGG - Intergenic
1062288089 9:135782349-135782371 TGGAGACCAGGGGAGGTGGACGG - Intronic
1062328519 9:136024598-136024620 TGAGGACCAGCAGGGGAGAATGG + Intronic
1062550199 9:137082613-137082635 TGGAGACGAGCAGGGGACAATGG - Intronic
1062686381 9:137815563-137815585 AGGAGGCCAGGAGTGCAGGAGGG + Intronic
1186155228 X:6718584-6718606 TGGAGACCAGGAAAGGTGGAAGG + Intergenic
1187498054 X:19813553-19813575 TGGAGACCTGCTGTGCAGCACGG - Intronic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188517815 X:31006079-31006101 TAGAGATCAGCAAAGGAGGAAGG - Intergenic
1188869669 X:35358898-35358920 TGGTGATGAGCAGTGGGGGATGG + Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190705109 X:53020957-53020979 GGGGGACCAGCAGTGAGGGATGG - Intergenic
1190732773 X:53235875-53235897 TGGAGCCCAGCAGGGTAGGGGGG - Intronic
1191040135 X:56069540-56069562 TGGCTACCAGCAGTGGGGGTGGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194816946 X:98454156-98454178 TGGTTACCAGAAGTGGAGAAGGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195210664 X:102650869-102650891 TGGAGCCACGCAGGGGAGGAAGG - Intergenic
1195216806 X:102711834-102711856 TGGAGCCACGCAGGGGAGGAAGG - Intergenic
1195220950 X:102745446-102745468 TGGAGCCACGCAGGGGAGGAAGG - Intronic
1195710937 X:107773417-107773439 TGGAGAGTGGCAGTGGGGGAGGG - Intronic
1195996742 X:110739309-110739331 TGGGTGCCAGGAGTGGAGGATGG - Intronic
1196438435 X:115695295-115695317 TGGAGACCTGTAATGCAGGAGGG + Intergenic
1196697717 X:118631846-118631868 GTGAGACCTACAGTGGAGGAGGG - Intronic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197520500 X:127491003-127491025 TGGAGAACAGCACTAGGGGATGG + Intergenic
1198018485 X:132635352-132635374 TGGAGACCTGAAGAGTAGGACGG - Intronic
1199210663 X:145206261-145206283 TGAAGCCCAGGATTGGAGGAGGG - Intergenic
1199303576 X:146240992-146241014 TGGTGTCCATCAGTGGAGGATGG - Intergenic
1199648682 X:149934520-149934542 TGGAGAGCAGTGGTGGGGGAAGG - Intronic
1200146874 X:153930899-153930921 ACGATACCAGGAGTGGAGGAGGG - Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic