ID: 1139551011

View in Genome Browser
Species Human (GRCh38)
Location 16:67673102-67673124
Sequence GGGGATTCCCTCAGAGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139551009_1139551011 -6 Left 1139551009 16:67673085-67673107 CCGTGAATCTAGGCTCTGGGGAT No data
Right 1139551011 16:67673102-67673124 GGGGATTCCCTCAGAGGAACCGG No data
1139551005_1139551011 3 Left 1139551005 16:67673076-67673098 CCACTCTGGCCGTGAATCTAGGC No data
Right 1139551011 16:67673102-67673124 GGGGATTCCCTCAGAGGAACCGG No data
1139551003_1139551011 10 Left 1139551003 16:67673069-67673091 CCATGCACCACTCTGGCCGTGAA No data
Right 1139551011 16:67673102-67673124 GGGGATTCCCTCAGAGGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139551011 Original CRISPR GGGGATTCCCTCAGAGGAAC CGG Intergenic
No off target data available for this crispr