ID: 1139553513

View in Genome Browser
Species Human (GRCh38)
Location 16:67690607-67690629
Sequence ATAGTTCAGAGGTTCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139553513_1139553515 10 Left 1139553513 16:67690607-67690629 CCAGCTGAGAACCTCTGAACTAT 0: 1
1: 0
2: 0
3: 19
4: 251
Right 1139553515 16:67690640-67690662 TGTGAAAAATTATCTACATTTGG 0: 1
1: 0
2: 4
3: 28
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139553513 Original CRISPR ATAGTTCAGAGGTTCTCAGC TGG (reversed) Intronic
904248208 1:29203281-29203303 ATAGGTCAAAGGCTCCCAGCCGG + Intronic
904615778 1:31748770-31748792 ATAGTTATGAGGTTATCAGGTGG - Intronic
904969421 1:34407435-34407457 GTAGTTCAGAGGTTCTCACAGGG + Intergenic
905066198 1:35185853-35185875 ATAGCTCCTGGGTTCTCAGCTGG - Intronic
906124818 1:43421300-43421322 ATACTTCAGAGCTACTCACCGGG - Exonic
907703710 1:56814756-56814778 ATAGTACAGATCCTCTCAGCAGG + Intronic
909401293 1:75234036-75234058 ATACTTCTGAGGTTCATAGCTGG - Exonic
911202708 1:95061844-95061866 ATAGTTCAGGGGTGGACAGCTGG - Intronic
911506840 1:98763613-98763635 CTAATTCTGTGGTTCTCAGCTGG + Intergenic
912309546 1:108606513-108606535 ATAATTCAAAGGATCTCACCTGG + Intronic
912338000 1:108880735-108880757 ATAGTTCAGATGATCTAACCTGG + Intronic
912511669 1:110194193-110194215 GCAGTTCAGAAGTTCTGAGCTGG + Intronic
913280319 1:117179294-117179316 CTAAATCAGTGGTTCTCAGCTGG - Intronic
915285567 1:154849950-154849972 TTAGATCAGAGCTTCTCAACTGG - Intronic
915606137 1:156952399-156952421 AGAGTTCTGTGGCTCTCAGCAGG + Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916838459 1:168574859-168574881 TTAGTAAAGAGGTTCTCAGTAGG + Intergenic
917429206 1:174948052-174948074 TTAGTTCAGTGGTTTTCAGATGG + Intronic
918210982 1:182350399-182350421 CCAGTTCAAAGGGTCTCAGCGGG + Intergenic
918722130 1:187866438-187866460 ATAGTCCAGTGATTCTCAACTGG - Intergenic
919677213 1:200395315-200395337 CTAAATCAGTGGTTCTCAGCTGG - Intergenic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
922776101 1:228214847-228214869 AGAGTTCCGTGATTCTCAGCTGG + Exonic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
924234158 1:241986788-241986810 CTAGACCAGTGGTTCTCAGCCGG + Intergenic
924747424 1:246849063-246849085 GTAGGTCAGAGCTTCTCAACAGG - Intronic
1064665497 10:17646383-17646405 CTAGTGCAGCGGTTCTCAACTGG - Intronic
1065886060 10:30078259-30078281 AGATTTCAGAGCTGCTCAGCAGG + Intronic
1068043062 10:51851269-51851291 TTAGGTCAGAGATTCTCAACTGG + Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1071270916 10:84006540-84006562 ACAGTGCAGACGTTCTCAGGTGG + Intergenic
1072356259 10:94614588-94614610 ATAGATCAGTGATTCTCAGTTGG + Intergenic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1077658433 11:4044824-4044846 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
1078384718 11:10879343-10879365 ATAATTAAGTGGTTCTGAGCTGG - Intergenic
1082251181 11:49982112-49982134 GTAGTTCAGAGGTTTGCAGATGG + Exonic
1083047542 11:59750221-59750243 GTTGTTCTCAGGTTCTCAGCAGG + Intronic
1083486079 11:62983793-62983815 ATACTTCAGAGGTCCTCAAAAGG - Intronic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1084477281 11:69396136-69396158 CTAGATTAGAGGGTCTCAGCAGG + Intergenic
1085796658 11:79547277-79547299 TTAGTTCAGAGTTGCACAGCTGG + Intergenic
1085873364 11:80376849-80376871 ATAGGTGAGTGGTTCACAGCAGG - Intergenic
1086208223 11:84285685-84285707 ATAGGGCAGTGGTGCTCAGCTGG - Intronic
1087802316 11:102517662-102517684 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1094391804 12:29959933-29959955 ATATTTCAGAGGGTTTCAGAGGG - Intergenic
1094617082 12:32045752-32045774 AAAGATCAGAGGATCTCAGCAGG + Intergenic
1095426365 12:42078455-42078477 CTAGGTCAGTGGTTCTCACCTGG - Intergenic
1095689495 12:45070803-45070825 ATATTTCAGAGGTTGGCATCTGG - Intergenic
1095929490 12:47611335-47611357 ACAGGGCAGAGGTTCTCAGGAGG - Intergenic
1097105815 12:56623619-56623641 CTAATACAGAGGTTCTCATCAGG + Intronic
1099520123 12:83650136-83650158 AAAGTTCAAAGTTTCTCTGCAGG + Intergenic
1100277295 12:93082714-93082736 ATAGTTCTGTGGTTCTCCACTGG - Intergenic
1100477532 12:94948411-94948433 CTAGCTCAGTGGCTCTCAGCTGG - Intronic
1101146714 12:101847537-101847559 ATCGTACAGGGTTTCTCAGCAGG - Intergenic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1104336049 12:127896544-127896566 CTAGTTAAGTGTTTCTCAGCTGG + Intergenic
1106972003 13:35152843-35152865 ATTGTACAGAGGTTCAGAGCTGG - Intronic
1108729499 13:53219877-53219899 TGATTTCAGAGGTTCACAGCTGG - Intergenic
1108746424 13:53399670-53399692 TTACTCCAGAGGTTCTCATCTGG + Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1111680925 13:91440466-91440488 ATAGGTCAGAGATTCTCCGCAGG - Intronic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112976309 13:105322801-105322823 GTAGTACCGATGTTCTCAGCTGG - Intergenic
1115326383 14:32144011-32144033 ACAGTGCAGTGGTTCTCAGCTGG - Intronic
1118262459 14:64260323-64260345 ATATTTAACAGGTCCTCAGCTGG - Intronic
1118440599 14:65808348-65808370 ATCGGCTAGAGGTTCTCAGCTGG - Intergenic
1118698538 14:68410203-68410225 GTAGTTCAGTGGTTCTTGGCTGG - Intronic
1119955089 14:78789319-78789341 CTAGTTAAGGGGTTCTCAACTGG + Intronic
1121291634 14:92780384-92780406 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1122896527 14:104760292-104760314 CTAGTCCAGAGCTTCTCAGAGGG - Intronic
1125676915 15:41507057-41507079 AGAGTGCATAGGTTCTCAGAAGG + Intronic
1126263709 15:46727425-46727447 AAAGTTCATATGTTATCAGCTGG - Intergenic
1127323013 15:57865874-57865896 TTAGATCAGAGGTTCTCAAATGG - Intergenic
1128824172 15:70695314-70695336 ATATTTCATTGGTTCTAAGCAGG - Intronic
1129799567 15:78403815-78403837 ATAATGCAGTGGTTCTCAACTGG + Intergenic
1131626724 15:94128295-94128317 ATAGTTCACACGTACACAGCAGG + Intergenic
1132277447 15:100581420-100581442 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1132354300 15:101159752-101159774 ATAGTACAGAGGTTCCCAAAGGG + Intergenic
1133624828 16:7561478-7561500 ATATTTCGGAGTTTCTCAGTAGG - Intronic
1134135398 16:11673662-11673684 CTTGTTCAGTGGTTCTCAACTGG - Intronic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135597819 16:23756649-23756671 ATAGATCAGTGATTCTCAACTGG + Intronic
1136064133 16:27747418-27747440 GGAGTTCAGAGGTTGTCATCAGG + Intronic
1138152872 16:54675385-54675407 ATAGAGCAGAGGTTGCCAGCTGG + Intergenic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1140239873 16:73191197-73191219 ATATTTCTGAGGTTGTCAGCAGG + Intergenic
1140265885 16:73420354-73420376 TTATTTCAGTGGTTCTGAGCTGG + Intergenic
1141065244 16:80908749-80908771 ATAGCTCAGTTGTTCTCAACAGG - Intergenic
1142474931 17:183019-183041 ACAGGTAAGAGGTGCTCAGCTGG + Intergenic
1142891439 17:2946671-2946693 ATAGGTCAGTGGTTCTCACTTGG + Intronic
1143006603 17:3839916-3839938 AAAGTTCAGATGCTGTCAGCTGG - Intronic
1143705087 17:8691898-8691920 CAAGGTCAGTGGTTCTCAGCTGG + Intergenic
1143781458 17:9231676-9231698 GTCTTTGAGAGGTTCTCAGCCGG + Intronic
1144374998 17:14630394-14630416 ATATTTCAGTGGTTCTCAAATGG + Intergenic
1147558030 17:41491911-41491933 ATAGTCCAATGGTTCTCAACTGG - Intronic
1147844603 17:43396089-43396111 AATGTTCAGATGTTCTCTGCAGG + Intergenic
1147933321 17:43996358-43996380 CTAGTTCAGAGTTTCTCATGTGG - Intronic
1148362856 17:47027815-47027837 AGAGAGCAGTGGTTCTCAGCTGG + Intronic
1149043101 17:52213697-52213719 ATAGTCCAGCTTTTCTCAGCTGG - Intergenic
1150408359 17:64921250-64921272 GTATTCCAGTGGTTCTCAGCCGG - Intergenic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151916040 17:77118713-77118735 ATTGTTCAGATGTTCGTAGCAGG + Intronic
1154007769 18:10547287-10547309 AGAGTACAGATGTTTTCAGCAGG - Intronic
1155594058 18:27462149-27462171 ATAGGTCAGAGGTCCACATCTGG + Intergenic
1158212640 18:55068199-55068221 ATAAATAAGTGGTTCTCAGCTGG - Intergenic
1158682565 18:59581859-59581881 TGAGTGCAGTGGTTCTCAGCGGG - Intronic
1158819022 18:61136714-61136736 ATTGAACAGAGCTTCTCAGCTGG - Intergenic
1159819429 18:73120944-73120966 ATATTTCAGAGAATCTCAGAGGG - Intergenic
1160147541 18:76377320-76377342 AAAGTTCACAAGTGCTCAGCGGG + Intronic
1161305637 19:3565998-3566020 CTAGCTCAGTGGTTCTCATCCGG - Intronic
1163047583 19:14655817-14655839 ATAGACCAGTGGTTCTCAACGGG + Intronic
1166026195 19:40087412-40087434 ATAGAACATTGGTTCTCAGCTGG - Intronic
1167064438 19:47173720-47173742 ATAATCCAGTGGTTCTCAACTGG - Intronic
1167474631 19:49692588-49692610 AGTGAGCAGAGGTTCTCAGCAGG - Intronic
1167757716 19:51422825-51422847 ATATTTCAGGGGCTCTTAGCTGG + Intergenic
1168357503 19:55711491-55711513 ATAGAGCAGTGGTTCTCACCTGG + Intronic
926600081 2:14832899-14832921 ATAGAACAGTGGTTCTCACCTGG - Intergenic
927365671 2:22293356-22293378 AGAATTCAGAGGTTCACAGCAGG + Intergenic
929123730 2:38504154-38504176 ACAGTTCAGGGCTTCTCAGTTGG + Intergenic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
933453640 2:82492737-82492759 ATAGTACTGAGGTTCTGAGCTGG - Intergenic
939472917 2:142647664-142647686 ATTGTTGAGAGGTTCTCATTTGG - Intergenic
939698790 2:145362915-145362937 ATTGTTCAGAGGATCTCATATGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
940998080 2:160171887-160171909 ATAATGAAGAGTTTCTCAGCAGG + Intronic
942606541 2:177697895-177697917 TTAGAACAGTGGTTCTCAGCTGG + Intronic
942934148 2:181533628-181533650 CTAGAGCAGTGGTTCTCAGCAGG - Intronic
942937871 2:181579921-181579943 ATAGATCAGTGGATCTCAGATGG - Intronic
944145914 2:196507379-196507401 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
944514478 2:200498649-200498671 CTAGTGCAGTGGTTCTCAACTGG - Intronic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
947173386 2:227335583-227335605 ATAGGTCAGTGGTTTTCAGTAGG - Intronic
1169443784 20:5654756-5654778 AGAGTTCAGAGGATCTCATGTGG - Intergenic
1173745361 20:45432604-45432626 TTAGTTCACAGGTTTTCAGATGG + Intergenic
1174191563 20:48744257-48744279 CTAGAGCAGAGCTTCTCAGCTGG - Intronic
1175122048 20:56723308-56723330 CTAGTCCAAAGGTTCTCAACAGG - Intergenic
1175663579 20:60838744-60838766 ACAGTTCAGTGGCTCTCAACTGG - Intergenic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1177888303 21:26773368-26773390 CTAATTCAGTGGTTCTCAACTGG - Intergenic
1178899774 21:36589531-36589553 ATAGGCCGGCGGTTCTCAGCAGG + Intergenic
1180921031 22:19521775-19521797 ACGGTGCAGAGGTCCTCAGCAGG - Intergenic
1182655011 22:31883198-31883220 CTAGGACAGCGGTTCTCAGCTGG - Intronic
1184573513 22:45342839-45342861 ATAGTAAGGAGGTTCTTAGCAGG - Intergenic
1185104245 22:48858236-48858258 ATAGAGCAGAGGGTCTGAGCTGG - Intergenic
949172819 3:1022342-1022364 ATGGATCAGAGGTTACCAGCTGG - Intergenic
949197858 3:1335134-1335156 TAACTTCACAGGTTCTCAGCTGG + Intronic
951639427 3:24818974-24818996 TTAGGTCAGAGGTCCTCATCTGG + Intergenic
954620551 3:51993017-51993039 AGAGTGCAGAGCTGCTCAGCGGG + Intergenic
955279744 3:57582911-57582933 TTAGAACAGTGGTTCTCAGCAGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
956090738 3:65663893-65663915 ATAGGTCAGTGGTTCACAGTGGG - Intronic
956314326 3:67917075-67917097 ACAGAGCAGAGGTTCTCAACAGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
957895750 3:86419437-86419459 ACTGTTCACAGGTTCCCAGCTGG - Intergenic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
959096396 3:101961175-101961197 ATCTCTCAGAGGTCCTCAGCAGG + Intergenic
959750504 3:109829405-109829427 ATAGGTCAGATGTACACAGCTGG - Intergenic
960466205 3:117998687-117998709 ATAGATAAGAAGTTCTCAACTGG - Intergenic
962853315 3:139323942-139323964 CTAGGACAGAGGTTCTCAACTGG - Intronic
963219039 3:142785793-142785815 AAAGTTCATAGGTTCTAGGCCGG - Intronic
964020501 3:152004872-152004894 ATAGTACAGAGGTTCCAAGCTGG - Intergenic
965197457 3:165620214-165620236 ATAGGACAGTGGTTCTCAGTTGG + Intergenic
965804299 3:172526331-172526353 ATTTTTAAAAGGTTCTCAGCCGG - Intergenic
966140428 3:176750822-176750844 ATTGTTCAGAGGGTATCATCAGG - Intergenic
967671618 3:192242457-192242479 CTACTTCAGTGGTTCTCAACTGG - Intronic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
969249729 4:5959090-5959112 TTGGTCCAGAGGTTCTCAACTGG - Exonic
970732667 4:19125346-19125368 ATTTTTCAGAGTTCCTCAGCTGG - Intergenic
971885626 4:32443717-32443739 ACAGATCAGAGTGTCTCAGCTGG + Intergenic
972020572 4:34308498-34308520 ATAATGCAGAGGCTCTAAGCAGG + Intergenic
972263722 4:37438452-37438474 AGACTTCAGAGGTTCTAAGAGGG - Intronic
972294008 4:37719185-37719207 TTAGTTCACAGGTGCTCAGATGG + Intergenic
973980776 4:56306613-56306635 CTAGAGCAGTGGTTCTCAGCTGG + Intronic
975288197 4:72645270-72645292 ATAGACCAGTGGTTCTCATCTGG - Intergenic
975288389 4:72647204-72647226 AGAGAGCAGTGGTTCTCAGCTGG + Intergenic
975632761 4:76419313-76419335 ATAGTTTACAGGTCTTCAGCTGG - Intronic
977183247 4:93904097-93904119 ATAGGCTAGTGGTTCTCAGCTGG + Intergenic
977560312 4:98526316-98526338 CTAGTTCAGATGTTTTCACCTGG - Intronic
977697992 4:99988578-99988600 ATAGACCAGTGCTTCTCAGCTGG - Intergenic
979225925 4:118284307-118284329 CTAGGTCAGAGGTTCTCAACTGG - Intronic
980027923 4:127788613-127788635 CTAGGGCAGAGGTTCTCAACTGG + Intronic
982081165 4:151791718-151791740 ATAATTCAGAGATACTCATCTGG + Intergenic
982481054 4:155910399-155910421 GTATTTCCGAAGTTCTCAGCAGG - Intronic
983861239 4:172709532-172709554 ACAGTTCAGAGACTGTCAGCAGG + Intronic
983965269 4:173801796-173801818 ATAGTTAAAAGTTTCTCAGTGGG + Intergenic
988318388 5:29660775-29660797 CTAGTTAAGAAGTGCTCAGCTGG - Intergenic
989040568 5:37223584-37223606 AGATGACAGAGGTTCTCAGCTGG - Intronic
989219867 5:38945384-38945406 CTAATTCAGAGTTTCCCAGCTGG - Intronic
990609694 5:57444805-57444827 CTAGAGCAGTGGTTCTCAGCTGG - Intergenic
990858185 5:60295672-60295694 TTAGCTCAGTGGTTCTCAACTGG - Intronic
993704139 5:91150387-91150409 ATAGGTCAGAAGTTGTCACCTGG - Intronic
998573327 5:143285303-143285325 ATAGATCAGTGGTTCTCAAAAGG + Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999335275 5:150710817-150710839 ACAGTACAGAGTTTCTCAGGTGG + Intronic
999626386 5:153525181-153525203 CTAGTGCAGTGATTCTCAGCTGG + Intronic
1000904850 5:166952667-166952689 ATAGAGCAGTGGTTCTCAACTGG - Intergenic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1003030547 6:2597023-2597045 CTGGTGCAGTGGTTCTCAGCCGG - Intergenic
1003507170 6:6749795-6749817 ATAGTTCAGACGTTCAGAGAAGG - Intergenic
1004925984 6:20415567-20415589 CTAGTTCGGTGGTTCTCAGCTGG - Intronic
1005673853 6:28134297-28134319 ATAGAGCAGGGGTTCTCAACTGG - Intergenic
1007757037 6:44106402-44106424 ATAAGGCAGTGGTTCTCAGCTGG - Intergenic
1008129673 6:47706487-47706509 ATAGGACAGTGGTTCTCAACTGG + Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1011556143 6:88573150-88573172 AGAGTTCTTAGGTTCTCAGAAGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1014119769 6:117711503-117711525 CTAGTGCAGTGGTTCTCACCTGG + Intergenic
1016469353 6:144359325-144359347 TTATATCAGGGGTTCTCAGCTGG - Intronic
1017709373 6:157153047-157153069 ATGCTTCAGATTTTCTCAGCTGG + Intronic
1021725564 7:23544972-23544994 GTAGCTCAGAGATTCTCACCTGG + Intergenic
1021940353 7:25672957-25672979 CTTGCTCAGTGGTTCTCAGCTGG + Intergenic
1022031266 7:26493545-26493567 GTATTTCAGAGTTCCTCAGCAGG + Intergenic
1022514019 7:30964134-30964156 AGAGGCCAGAGGGTCTCAGCTGG - Intronic
1023815069 7:43943347-43943369 TTAGGACAGGGGTTCTCAGCCGG + Intronic
1028584798 7:92442304-92442326 ATAGTGCAGAGGATCTCAAGGGG + Intergenic
1029550560 7:101235062-101235084 ATAGGGCAGTTGTTCTCAGCCGG - Intronic
1034397788 7:150840318-150840340 GTAGACCAGAAGTTCTCAGCAGG + Intronic
1036616101 8:10388947-10388969 CTAGTTCAGTGATTCTCAACTGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1037268515 8:17097668-17097690 AGATTTCACAGGTTCTCAGGTGG - Intronic
1038540704 8:28387493-28387515 ATAGGACACTGGTTCTCAGCTGG + Intronic
1039270996 8:35880306-35880328 ATAATGCAGAGGTTGTCAGGTGG + Intergenic
1039731569 8:40284719-40284741 ATTGTTCAGGGATTCACAGCTGG + Intergenic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1043386969 8:79758190-79758212 AGAGGCCAGAGGTTCTCAGGTGG - Intergenic
1045250861 8:100482620-100482642 ATTGTTCATAGATTCTCGGCTGG - Intergenic
1047905966 8:129473729-129473751 CTAGGCCAGTGGTTCTCAGCTGG + Intergenic
1049849072 8:144821110-144821132 GGAGCTCAGAGGTGCTCAGCTGG + Intergenic
1050844696 9:10200290-10200312 ATAGATCAGTGGTTTTCAACTGG + Intronic
1051365741 9:16320231-16320253 AAAGATCAAAGGTTTTCAGCTGG - Intergenic
1051476186 9:17511523-17511545 ACAGTTCAGTTGTTCTCAGTTGG + Intergenic
1051544882 9:18262627-18262649 ATAATTCAGAGATTCTCATTTGG + Intergenic
1051781625 9:20694866-20694888 ATATTTCAGAATTTCTCAGTTGG + Intronic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1053192358 9:36083124-36083146 ATAGTCCAGTGGTTCTCCACAGG - Intronic
1053431560 9:38045060-38045082 CAAGGTCAGAGGTTCCCAGCTGG + Intronic
1055704286 9:78980540-78980562 ATAGGTCAGGGGTTCTCAAAGGG - Intergenic
1056781256 9:89552988-89553010 TTAGTGCAGATGTTCTCAGCTGG + Intergenic
1058257576 9:102787969-102787991 GTAACTCAGTGGTTCTCAGCTGG - Intergenic
1059496454 9:114713717-114713739 ATAGACCAGTGGTTCTCACCTGG + Intergenic
1059641695 9:116223215-116223237 ACACTTCAGAGGTTTCCAGCAGG + Intronic
1059783081 9:117550424-117550446 CTATTTCAGAGGCACTCAGCCGG + Intergenic
1060912340 9:127361075-127361097 AGAATCCAGTGGTTCTCAGCTGG + Intronic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1061247693 9:129409385-129409407 TTAGTTCAGAGGGTCTCTGGGGG - Intergenic
1186444807 X:9618087-9618109 TTATTCCAGAGGTTCTCAACAGG - Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186620803 X:11238051-11238073 ATAGACCAGTGGTTCTCAACTGG - Intronic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187153671 X:16704476-16704498 AAAGATCAGTGGTTGTCAGCGGG + Intronic
1187737225 X:22317156-22317178 TTAAATCAGTGGTTCTCAGCTGG - Intergenic
1187885616 X:23886165-23886187 GTAAATCAGAGGTTCTCAGTGGG - Intronic
1187978472 X:24729386-24729408 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1192258758 X:69490147-69490169 ATAAGTCAGTGGTTCTCAACTGG + Intergenic
1193520861 X:82527873-82527895 ATAGTCCAGAGATTCTGGGCAGG + Intergenic
1195363378 X:104106159-104106181 CTAGTACAGTGGTTCTAAGCCGG - Intronic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1196976931 X:121168513-121168535 ATAGTGCAGAGTTTCTGAGTAGG + Intergenic
1197114348 X:122815288-122815310 GTCTTTCAGTGGTTCTCAGCTGG + Intergenic
1198144855 X:133844903-133844925 ATAACTCAGTGGTCCTCAGCTGG + Intronic
1198416905 X:136429585-136429607 ATGGAGCAGTGGTTCTCAGCAGG - Intergenic
1198417096 X:136431311-136431333 ATGGAGCAGTGGTTCTCAGCAGG + Intergenic
1198741484 X:139847836-139847858 ATAGTTAAGAGGTTCACAGGGGG - Intronic
1199923537 X:152436477-152436499 ATAATTCAGTGGTTCCCAACTGG - Intronic