ID: 1139557095

View in Genome Browser
Species Human (GRCh38)
Location 16:67719229-67719251
Sequence CCTTCCTTAAGGCGGATGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139557095_1139557110 10 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557110 16:67719262-67719284 TGCGCGGGCCCGGGAGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 296
1139557095_1139557114 23 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557114 16:67719275-67719297 GAGTCCAGGGCGCCGCCACCGGG 0: 1
1: 0
2: 0
3: 17
4: 195
1139557095_1139557106 -5 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557106 16:67719247-67719269 GAAGGCTGGCGGGGATGCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 196
1139557095_1139557108 1 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557108 16:67719253-67719275 TGGCGGGGATGCGCGGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 252
1139557095_1139557113 22 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557113 16:67719274-67719296 GGAGTCCAGGGCGCCGCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1139557095_1139557107 0 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557107 16:67719252-67719274 CTGGCGGGGATGCGCGGGCCCGG 0: 1
1: 0
2: 1
3: 16
4: 249
1139557095_1139557105 -6 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557105 16:67719246-67719268 GGAAGGCTGGCGGGGATGCGCGG 0: 1
1: 0
2: 3
3: 21
4: 393
1139557095_1139557109 9 Left 1139557095 16:67719229-67719251 CCACCCATCCGCCTTAAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1139557109 16:67719261-67719283 ATGCGCGGGCCCGGGAGTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139557095 Original CRISPR CCTTCCTTAAGGCGGATGGG TGG (reversed) Exonic
900585056 1:3428668-3428690 CCTTCCTGATGGCGGAGGGCAGG - Intronic
901175021 1:7292870-7292892 GCTTCCTAAAGGCGGAAGCGAGG - Intronic
902260027 1:15218009-15218031 CATTCCTAAAGGAGGGTGGGAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
905238756 1:36568363-36568385 CCTCCCTCAAGGCAGATAGGGGG + Intergenic
905532094 1:38687929-38687951 CCTACCTGAAGGCGGAGGGTAGG - Intergenic
905898943 1:41567863-41567885 CCTGCCTTCAGGCTGATGGATGG + Intronic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
909562428 1:77021522-77021544 CTTATCTTAAGGTGGATGGGAGG - Intronic
910369725 1:86503207-86503229 ATCTCCTTAAGGGGGATGGGAGG - Intergenic
913289671 1:117260488-117260510 CCTGCCTTTAGGCAAATGGGAGG - Intergenic
918696273 1:187550462-187550484 CCTTCCTTCTGGCGGATTCGTGG + Intergenic
920907734 1:210187810-210187832 CCTTCTTAAGGGCGGAGGGGTGG - Intergenic
1064155049 10:12897009-12897031 CCTTCCTAAAGGCAGAAGAGTGG + Exonic
1067768332 10:49106512-49106534 CCTTCCTGAAGACAGATAGGAGG - Intronic
1067797518 10:49331609-49331631 CCTTCCACCAGGTGGATGGGTGG + Intergenic
1070888231 10:79923134-79923156 CCTTCCTTCATGTGGATGGGAGG + Intergenic
1072009623 10:91291743-91291765 CGTTCCTTCAGGCAGAGGGGTGG - Intergenic
1072919509 10:99564089-99564111 CATTCCTTAAGGTTTATGGGGGG + Intergenic
1074977149 10:118590558-118590580 CCCTTCTCAAGGCTGATGGGAGG - Exonic
1079235384 11:18684925-18684947 CCTTAGTTAAGGCTTATGGGAGG + Intergenic
1084273457 11:68040640-68040662 CCTTGCTCAAGGCCGATGTGGGG - Intronic
1085895802 11:80638274-80638296 CCTACCTTGAGGCAAATGGGTGG + Intergenic
1100558465 12:95722218-95722240 CCTTCCTTCCTGCAGATGGGTGG - Intronic
1101554481 12:105795437-105795459 CTTTCCTTAAGTAGGATTGGTGG - Intergenic
1106889478 13:34227867-34227889 GCCTCCTTAATGTGGATGGGTGG + Intergenic
1110713280 13:78673368-78673390 TCTTGCTTAGGGTGGATGGGTGG - Intergenic
1119572520 14:75688213-75688235 CCTTCCTGGAGGCTGAGGGGTGG - Intronic
1120782842 14:88501577-88501599 CCATACTTAAGGCAGATGAGTGG + Intronic
1122346946 14:101066643-101066665 CCATCCTGGAGGCGGGTGGGTGG + Intergenic
1126054927 15:44721010-44721032 CCTTCCCAGAGGTGGATGGGTGG + Intergenic
1126866614 15:52943950-52943972 CCTTTCTGACAGCGGATGGGTGG + Intergenic
1126950353 15:53873704-53873726 CCTTCCATGAGGCGGAAAGGGGG + Intergenic
1135272405 16:21080769-21080791 ACTTCCTTCAGGGCGATGGGTGG - Intronic
1136607791 16:31348257-31348279 CCTTCCTTGAGGCTGAAGTGTGG - Intergenic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1143621748 17:8084781-8084803 CTTCCCTTGAGGCGAATGGGAGG - Intronic
1147559331 17:41499347-41499369 CCTTCCTCAAAGCGGGCGGGGGG - Intergenic
1149410192 17:56396880-56396902 ACTTCCTTTAAGCTGATGGGTGG - Intronic
1152268689 17:79311023-79311045 CCTTTCTTAATGTGGGTGGGTGG + Intronic
1154164225 18:12002257-12002279 CTTTCCTAAAGGAGGATGAGAGG - Intronic
1158690976 18:59660158-59660180 CCTTCCTTTAGGCTGATAGAGGG - Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1162344708 19:10112466-10112488 CCCTCCTTCGGGAGGATGGGGGG - Intronic
1162957404 19:14107050-14107072 CATTCCTTAAGGCGGGTGGCAGG + Intronic
1168554527 19:57326871-57326893 CCTGTCTGAAGGCGGGTGGGGGG - Intronic
927680988 2:25138874-25138896 CCTTCATTAAAGCTGAAGGGAGG - Intronic
928454525 2:31407119-31407141 CCTTCCTAAAGGAGAAGGGGAGG + Intronic
928977718 2:37106036-37106058 ACTTCCTTAAGCTGGATGGTAGG - Exonic
941664650 2:168232274-168232296 CTTTCCTTCAGGGGGATGTGTGG - Intronic
948835782 2:240625413-240625435 CCCTCCTTAAGGTGGGGGGGCGG - Intronic
1172779238 20:37426008-37426030 CCTTCATCAAGGCGAATGGCAGG - Intergenic
1174759039 20:53188206-53188228 CCTTCTTTAAGGGGGAGGGGAGG + Intronic
1178066135 21:28906460-28906482 CCTTCATTGAGGGGAATGGGTGG + Intergenic
1178254904 21:31043692-31043714 CCTTCCTTAGGGCGGATCCTAGG - Intergenic
1178565881 21:33684207-33684229 CCTTCCTTAAAGCAGATGCATGG - Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182490296 22:30667464-30667486 CTCTCCTTCAGGCGGGTGGGCGG + Exonic
1184696078 22:46139824-46139846 CCTGAGTTAAGGCGGGTGGGGGG - Intergenic
949649453 3:6139042-6139064 CCTTCCTTAAGTTAGATGGTTGG - Intergenic
951236693 3:20244529-20244551 CCTACCTTAAGGTGGAAGGTGGG + Intergenic
952369947 3:32712262-32712284 CCTGCCTGAAGGCAGAAGGGTGG - Intronic
953734363 3:45479192-45479214 CCTTCCTTAAGTCATATGGATGG - Intronic
955983678 3:64551561-64551583 CCTTCCTTTAGACAGCTGGGTGG - Intronic
958099403 3:88989428-88989450 CCTTCCCTAGGCCAGATGGGAGG + Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
964760227 3:160128509-160128531 TCCTCCTTAAGGCAGATGTGGGG + Intergenic
967025544 3:185561052-185561074 GTCTCCTTAAGGGGGATGGGAGG - Intergenic
975390298 4:73808466-73808488 CCTTCTTTAAGGTGGAGGGTGGG + Intergenic
976766142 4:88599811-88599833 CTTTCCTAAAAGTGGATGGGTGG - Intronic
979485635 4:121267027-121267049 CCTTCCTTCAGTCTGGTGGGGGG + Intergenic
979888916 4:126065233-126065255 CCTTCCTTAAGGCAGTTGCCAGG - Intergenic
980956150 4:139431038-139431060 CCTCCCTGAAGGCAGACGGGTGG - Intergenic
982724076 4:158887013-158887035 TTTTCCTTAAGGTGTATGGGAGG + Intronic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
985071611 4:186171213-186171235 CCATCATGAAGGCGGATGCGGGG - Intronic
997405500 5:133643482-133643504 ACTTCCTTCAGGCTGATGTGTGG + Intergenic
1002331987 5:178449540-178449562 CCTTCATTTAGGGGGGTGGGGGG - Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1007511024 6:42374434-42374456 CCTTCCTTCTGGCCGAGGGGAGG + Intronic
1007813152 6:44500486-44500508 CCTTTCCTAAGGTGGGTGGGAGG - Intergenic
1008441357 6:51535317-51535339 CTTTTTTTAAGGGGGATGGGAGG + Intergenic
1013853079 6:114539470-114539492 CCCCCCTTAAGGAAGATGGGAGG + Intergenic
1015392880 6:132702608-132702630 CCTTTCTTAAGGCAGAGGGACGG - Intronic
1017124256 6:151051017-151051039 CCTTCCTGGAGGTTGATGGGTGG + Intronic
1019721236 7:2572866-2572888 TCTTCCTTAAGGAGGATAGGTGG - Intronic
1022532692 7:31076793-31076815 CTCCCCTTAGGGCGGATGGGGGG + Intronic
1023523562 7:41073514-41073536 CCTTCCTGAATGAGCATGGGAGG + Intergenic
1031052347 7:116956520-116956542 GCTTCCTTGAGGAGGAAGGGAGG - Exonic
1034790149 7:153960927-153960949 CCTTCCTAAAGGCCCATGTGTGG + Intronic
1038639946 8:29315740-29315762 ATCTCCTCAAGGCGGATGGGAGG - Intergenic
1040652344 8:49463851-49463873 CCTTCCTAAAGGGAGATGTGAGG + Intergenic
1044558796 8:93592320-93592342 CCTGCCTTAAGGCGCTTGGCTGG + Intergenic
1045848444 8:106664019-106664041 TTTTCCTAAAGCCGGATGGGAGG + Intronic
1053001409 9:34578915-34578937 CCCTCCTAAAGGCGGATCTGGGG - Intronic
1055696974 9:78895599-78895621 CCTCCCTTCAGGCGGAGGTGTGG - Intergenic
1057497962 9:95575154-95575176 CCTTCCCTAAGGCTCATGCGAGG - Intergenic
1060206053 9:121683400-121683422 CCATCCTCAAGGTTGATGGGAGG - Intronic
1061410937 9:130421352-130421374 ATTTCCTTAAGGGGCATGGGTGG + Intronic
1061716397 9:132521078-132521100 CCTTCCTGAAGACGAATGAGAGG - Intronic
1186313872 X:8348175-8348197 CCTTACTTAAGGGGGATTGGGGG + Intergenic
1188545102 X:31296591-31296613 CCTACCTAAAGGCAGATGAGTGG + Intronic
1191983306 X:66950081-66950103 CCTACCTGAAGGTGGATGGTGGG + Intergenic
1195639242 X:107155548-107155570 GCTGCCTCAAGGCAGATGGGTGG - Intronic