ID: 1139569845

View in Genome Browser
Species Human (GRCh38)
Location 16:67804955-67804977
Sequence GCCACCGGCCTGTCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139569845_1139569849 26 Left 1139569845 16:67804955-67804977 CCCTGAGATGACAGGCCGGTGGC 0: 1
1: 0
2: 1
3: 5
4: 89
Right 1139569849 16:67805004-67805026 AGACTCTACTATCTCTTTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139569845 Original CRISPR GCCACCGGCCTGTCATCTCA GGG (reversed) Intronic
900433438 1:2613627-2613649 GCCACAGGCCTCTCCTCTCCTGG - Intronic
904046181 1:27610028-27610050 GTGACCCGCCTGTAATCTCAGGG + Intergenic
908010059 1:59766785-59766807 GCCACCGGCCTGTGAGCTCTTGG + Intronic
912796106 1:112694537-112694559 GCCAGCGCCCTGTCAGCTCCAGG - Exonic
916119560 1:161516137-161516159 ACCAACTACCTGTCATCTCAAGG - Intronic
916129323 1:161597791-161597813 ACCAACTACCTGTCATCTCAAGG - Intronic
919168907 1:193929169-193929191 GCCACCTGACTATCACCTCATGG + Intergenic
922883477 1:229000383-229000405 GCCAGCTGCCTGTCACCTGATGG - Intergenic
1067053350 10:43037717-43037739 GCCACTGGGCTGTCCTCTAAGGG + Intergenic
1070715215 10:78715429-78715451 TCCACTGGTCTGGCATCTCAGGG + Intergenic
1077232538 11:1464483-1464505 GCCACCCACCTGCCATCCCATGG - Intergenic
1078094012 11:8285439-8285461 GCCAGAGCCCTGTCAGCTCAGGG + Intergenic
1081845037 11:46234528-46234550 GGCAGAGGCCTGTCATCTCTAGG - Intergenic
1088390470 11:109308796-109308818 GACATCTGCCTGTCATTTCAGGG + Intergenic
1090736750 11:129617499-129617521 CCCACCTGCCTGTCCTCTCCAGG - Intergenic
1096565429 12:52473742-52473764 GCCACAGCCCTCTCATCTCCTGG - Exonic
1098133883 12:67381034-67381056 GCCAAAGGCTTGTCATCACATGG + Intergenic
1102968388 12:117146822-117146844 GCCACCTTCCTTTCATCCCACGG - Intronic
1103271778 12:119679644-119679666 GCCACGGCCCTGTCCTCTTATGG - Intronic
1103478088 12:121233117-121233139 GGCACAGGCCTCTCATCTCTTGG + Intronic
1103916957 12:124380664-124380686 GCCACCGCCCGGGCAGCTCAGGG - Intronic
1106144125 13:27036622-27036644 GCAACCAGCCTGGAATCTCAGGG - Intergenic
1115559466 14:34570199-34570221 GGCACATGCCTGTAATCTCAAGG - Intronic
1118061451 14:62142261-62142283 GCCACCGGCAAGTCGTCTCAAGG - Intergenic
1122787146 14:104169013-104169035 GCCACTGGCCTCGCATCCCAGGG - Intronic
1129500732 15:76035193-76035215 GCCTCATGCTTGTCATCTCATGG + Intronic
1131540536 15:93271438-93271460 GCCCCCGTCCTGTGACCTCAGGG - Intergenic
1136295609 16:29300348-29300370 GACACCAGCCTGTCTTCTGAAGG - Intergenic
1137734071 16:50711359-50711381 GCCACCTGCCTGTCTTCTCATGG + Exonic
1138124838 16:54430225-54430247 GCCACCAGCATGTCATGACATGG - Intergenic
1139569845 16:67804955-67804977 GCCACCGGCCTGTCATCTCAGGG - Intronic
1142101526 16:88274535-88274557 GACACCAGCCTGTCTTCTGAAGG - Intergenic
1142193022 16:88726526-88726548 GCCACCGTCCTGGCCACTCACGG + Exonic
1143449086 17:7024977-7024999 GCCAAAGGCCTGCCCTCTCAGGG - Intronic
1144579798 17:16452026-16452048 GCGCCCGGCCTGGAATCTCAGGG + Intronic
1145782969 17:27575834-27575856 ACCACCCGCTTATCATCTCATGG + Intronic
1147882905 17:43665407-43665429 GCCAGAGGCCTGTGTTCTCAGGG - Intergenic
1147900303 17:43779122-43779144 GCCACCGCCCTGGAGTCTCAGGG + Intergenic
1163534790 19:17870979-17871001 ACCAACGAGCTGTCATCTCAGGG - Intergenic
1165077988 19:33291349-33291371 GCCACCTGCATGTGATCTCAAGG - Intergenic
1165171052 19:33891886-33891908 GGCACCAGCCTTTCATCTCCTGG - Intergenic
925529009 2:4838887-4838909 GCCATGAGCCTGTCTTCTCATGG + Intergenic
930071777 2:47371410-47371432 GCCACCGGTCCGGCATCTCTTGG + Intronic
930237958 2:48905822-48905844 CCAACCGGCCTGTTGTCTCAAGG - Intergenic
932564088 2:72894760-72894782 CCCACCTCCCTGTCATCACACGG - Intergenic
934650504 2:96088898-96088920 GCCACCGTCCTGCCAGCTCCAGG - Intergenic
936528713 2:113260003-113260025 GCCACAGGCCTCTGACCTCAGGG - Intronic
937154867 2:119711828-119711850 ACCCCAGGACTGTCATCTCAGGG - Intergenic
937224604 2:120360978-120361000 TCCTCCCGCCTGTCCTCTCAGGG + Intergenic
937444933 2:121949807-121949829 GCCACCAGACAGTCACCTCAGGG + Intergenic
937979944 2:127608964-127608986 GCCACCGCTCTGGCTTCTCAGGG - Intronic
941740869 2:169033690-169033712 GCCACTGCCCTGTGAGCTCATGG - Intergenic
948673680 2:239584630-239584652 GCCCCCGCCCAGGCATCTCATGG + Exonic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1174309154 20:49637021-49637043 GCCACTGCTCTGTCACCTCAGGG + Intronic
1175408821 20:58752715-58752737 GGCACCAGGCTGTCATCCCAAGG + Intergenic
1182657899 22:31904289-31904311 GCCACCTGACTGTCCACTCAGGG - Intronic
1182977387 22:34636180-34636202 GCCTCTGTCCTGTCATCTTATGG + Intergenic
1185374934 22:50478157-50478179 GCAACTGTCCTGTCATCTCAGGG + Intergenic
954744224 3:52777929-52777951 ACCACCGGCCTGCCAGTTCAGGG - Intronic
955750581 3:62182535-62182557 CCCACTGGGCTGTCATCTCCAGG + Intronic
962812738 3:138973198-138973220 GCCTCAGGCCTGGCATCACATGG - Intergenic
963040663 3:141067374-141067396 TCCAGCCGACTGTCATCTCACGG + Intronic
966541958 3:181101688-181101710 GCCAACCACCTGTCATCCCAAGG - Intergenic
969440076 4:7211792-7211814 GCCCCCCGCCTCTCCTCTCATGG - Intronic
976178156 4:82374469-82374491 GGCACAGGGCTGACATCTCAGGG - Intronic
981722464 4:147815450-147815472 GCCTCCGGCCAATAATCTCAGGG - Intronic
986929265 5:12797426-12797448 GCCTCCTCCCTGTCATCACATGG + Intergenic
989570233 5:42939289-42939311 GCCACCTGCCAGTATTCTCAGGG - Intergenic
990863859 5:60358615-60358637 GACATAGGCCTGTCATCCCAGGG + Intronic
991950714 5:71944579-71944601 ACCACTGGCCTGACATCCCATGG + Intergenic
1000336188 5:160243322-160243344 GCCACCTGCCTGTCATTCCTTGG + Intergenic
1004084043 6:12426651-12426673 GTCCCCTGCTTGTCATCTCATGG - Intergenic
1004122271 6:12835424-12835446 TCAACCGGCCTTTCTTCTCAAGG - Intronic
1006671536 6:35732286-35732308 GCCCCCAGCCTTTCATCTCTTGG + Intergenic
1009479604 6:64140461-64140483 TCCACCTGCCTCTCATCCCAAGG + Intronic
1011025432 6:82863981-82864003 ATCACAGGCTTGTCATCTCATGG - Intergenic
1015808883 6:137141620-137141642 GCCACAGCCCTGTCTTCACAGGG + Intergenic
1016984942 6:149888146-149888168 GCCACCAGCAAGTCTTCTCAGGG + Intronic
1019550984 7:1602437-1602459 GCCAGCGACCTGTCCTCTCTGGG + Intergenic
1019614517 7:1953083-1953105 GCCACAGGGATGGCATCTCAGGG + Intronic
1020571326 7:9866626-9866648 GCCATAGGACTGGCATCTCAGGG + Intergenic
1022384419 7:29888297-29888319 GCCACAGTGCTGCCATCTCAGGG + Intronic
1023969941 7:44983473-44983495 GTCACAGGCCTCTCAGCTCATGG - Intergenic
1029220115 7:98981976-98981998 GCCACAGGCCTGTGCTCGCATGG - Intronic
1032509196 7:132458627-132458649 GCCACCATCCTGACCTCTCATGG - Intronic
1042200483 8:66275885-66275907 GTCACTGTCCTGTCATCTCCAGG + Intergenic
1042364854 8:67924331-67924353 GCCACGTGCCTGTAACCTCATGG - Intergenic
1049239381 8:141529179-141529201 GCCACCTGCCTGGAATCACACGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1056804315 9:89716661-89716683 GTCACAGCTCTGTCATCTCAAGG + Intergenic
1059379942 9:113915365-113915387 ACCAACGGCCTGACTTCTCAGGG - Intronic
1061051686 9:128200114-128200136 GCCAGCAGCCTGGCATCACATGG - Intronic
1186669774 X:11757598-11757620 GCCACCGGCTTGTCCTCTGAAGG + Intergenic
1189515377 X:41708542-41708564 GGCACCGGGCTTTCATCTTAAGG + Intronic
1190561878 X:51694483-51694505 GTCACTGGCCTCTCAGCTCAGGG - Intergenic