ID: 1139571980

View in Genome Browser
Species Human (GRCh38)
Location 16:67818654-67818676
Sequence CTGGGCTTCTCGAACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139571980 Original CRISPR CTGGGCTTCTCGAACTGTCC TGG (reversed) Intronic
900013197 1:133126-133148 CTCGGCTTCTCCACCTGTACAGG - Intergenic
900043262 1:489113-489135 CTCGGCTTCTCCACCTGTACAGG - Intergenic
900064699 1:724110-724132 CTCGGCTTCTCCACCTGTACAGG - Intergenic
903229870 1:21915120-21915142 CTGGGCCTCACGATCTGGCCGGG - Intronic
904360728 1:29970059-29970081 CAGGGTTTCTCTAACTGCCCAGG - Intergenic
904506535 1:30960373-30960395 TTGGGATTCTCAATCTGTCCTGG + Intronic
905310063 1:37042957-37042979 CTGTGCTTCTCTGAGTGTCCTGG - Intergenic
905904913 1:41611721-41611743 CTGGCTTTCTCCCACTGTCCTGG + Intronic
910779141 1:90908726-90908748 CTGGGATTCTGGAAATTTCCTGG - Intergenic
910802113 1:91157434-91157456 CTGGGCTACTCCAACTGGCAGGG + Intergenic
911048681 1:93651050-93651072 CTGGTTTTCTGGACCTGTCCTGG - Intronic
917036107 1:170748615-170748637 GTGAGTTTCTCTAACTGTCCAGG - Intergenic
918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG + Intergenic
920715867 1:208339324-208339346 CTGGGCATTTTGAACTGGCCTGG + Intergenic
922099597 1:222470130-222470152 CTCGGCTTCTCCACCTGTACAGG - Intergenic
922261634 1:223949624-223949646 CTCGGCTTCTCCACCTGTACAGG - Intergenic
922613184 1:226944834-226944856 CTGGGCTTTTCCAAATGACCCGG - Intronic
924342798 1:243051798-243051820 CTCGGCTTCTCCACCTGTACAGG - Intergenic
1066733681 10:38453756-38453778 CTCGGCTTCTCCACCTGTACAGG + Intergenic
1069747713 10:70726405-70726427 CTGGGCATCTGGAAATGCCCAGG - Intronic
1075584193 10:123645314-123645336 CTGGGCATCCAGGACTGTCCTGG - Intergenic
1075658469 10:124176926-124176948 CTGCGCTTCTCTATCTGCCCAGG + Intergenic
1076600691 10:131655091-131655113 CCTGGCTTCTCGGCCTGTCCTGG + Intergenic
1077043024 11:532910-532932 CTGGCCATCTCGAAGTGCCCAGG + Intronic
1078037473 11:7822636-7822658 CTGAGCTTCTCAAGCTCTCCAGG + Intergenic
1080062443 11:27971321-27971343 CTGAGCTTCCCAAAATGTCCTGG + Intergenic
1081461682 11:43278291-43278313 CAGGACTTCTCAAACTTTCCTGG + Intergenic
1081914106 11:46719869-46719891 CTGGGCTGCTCGGACGGTGCCGG + Intronic
1084491575 11:69481452-69481474 CAGGGCTTCTCTGACAGTCCAGG + Intergenic
1087712126 11:101566847-101566869 CTGGGCTTTTCCCACAGTCCTGG + Intronic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088522094 11:110711745-110711767 CTGGGCCTCCCGAAGTGGCCTGG - Intronic
1090843513 11:130512981-130513003 CTGGGCTTCCCCAAATGGCCTGG + Intergenic
1096841275 12:54380569-54380591 CTTGGCTTCTCCAACTCTACAGG + Intronic
1097950272 12:65419717-65419739 CTGGGCTCCTCACTCTGTCCAGG + Intronic
1099976870 12:89555300-89555322 CTGGGACTCTCAAACTTTCCTGG + Intergenic
1101198629 12:102411697-102411719 CTGGGCTTCTCTAACTGACATGG - Intronic
1109368225 13:61386121-61386143 CTGGGCTTATCCAAGTTTCCTGG - Intergenic
1114730322 14:24986312-24986334 CTGTGCTTCTTGGACTATCCTGG - Intronic
1115264139 14:31483515-31483537 CTGGGCTTCCAGCATTGTCCTGG - Exonic
1117065057 14:52005054-52005076 ATTGGCTTCTCCAACTGTCAAGG + Exonic
1118693590 14:68362952-68362974 CTGGGGTTCTTGCACAGTCCTGG + Intronic
1119635979 14:76273829-76273851 CTGGGCTCCTGGAACAGCCCTGG + Intergenic
1120813468 14:88828525-88828547 CTGGGCTCCTCTATGTGTCCAGG - Intronic
1123140498 14:106072998-106073020 CTGGGCTTCTGGACCTGTGATGG - Intergenic
1124008095 15:25810694-25810716 CTGGGCTCCTCGTCCTGCCCAGG - Intronic
1124059323 15:26274711-26274733 CTGGGCTTCAAGAACTCTGCTGG + Intergenic
1124121759 15:26894154-26894176 CTGGGCTGCTCGCAGAGTCCGGG - Intronic
1129859675 15:78850872-78850894 CTGGGCTTCACACACAGTCCTGG - Intronic
1130681408 15:86000210-86000232 CTGGGATTCTTGAACTGGTCAGG + Intergenic
1131393728 15:92070156-92070178 CTGAGCATCTCGAAGTTTCCTGG + Intronic
1133754703 16:8753669-8753691 CTGGGTTTCTCCAACTGTTTCGG - Intronic
1135119457 16:19753162-19753184 CTTGGCATCTCGAAATGTCTGGG - Intronic
1136568524 16:31083671-31083693 CTGGGCTTCTGGGCCTGCCCTGG + Exonic
1138213883 16:55186169-55186191 CTGGGATTCTGCAGCTGTCCTGG - Intergenic
1139571980 16:67818654-67818676 CTGGGCTTCTCGAACTGTCCTGG - Intronic
1142004911 16:87685108-87685130 CTGGGCTCCTCATCCTGTCCTGG - Intronic
1142343357 16:89538210-89538232 TTGGGCGTCTCGTGCTGTCCTGG + Intronic
1142451144 16:90173792-90173814 CTCGGCTTCTCCACCTGTACAGG + Intergenic
1145256178 17:21323689-21323711 CTGGCTTTCTCAAACTGCCCTGG - Intergenic
1145320435 17:21764262-21764284 CTGGCTTTCTCAAACTGCCCCGG + Intergenic
1147968294 17:44206036-44206058 CTGGGCTTCAAGAAATGTGCTGG - Exonic
1148581698 17:48748017-48748039 CTGGGCTTCCCGAGTTCTCCAGG - Intergenic
1151652730 17:75480182-75480204 CTGAGCTTATCCAACTGCCCAGG - Intronic
1157012577 18:43669043-43669065 CTGGGCTTCTATAACTGGTCTGG - Intergenic
1160646338 19:195256-195278 CTCGGCTTCTCCACCTGTACAGG - Intergenic
1160962570 19:1730077-1730099 CTCAGCTTCTCCATCTGTCCAGG - Intergenic
1162564294 19:11436652-11436674 CTGGGCTCCTCCAGCTGCCCGGG - Intronic
1165062659 19:33212427-33212449 CTCAGCTCCTCGAAGTGTCCTGG + Exonic
1165510749 19:36265506-36265528 CTGGGCTTCTATAGCTGTCTGGG + Intergenic
927153854 2:20210785-20210807 CTGGGCTTCTGGAACAGGTCTGG - Intronic
932337618 2:70939919-70939941 CTGGGCTTCTCGCAGCCTCCAGG - Exonic
946034009 2:216727490-216727512 CTCTGCCTCTGGAACTGTCCAGG - Intergenic
947111865 2:226727224-226727246 CTGGGCTTCTGAAATTCTCCCGG - Intergenic
1171454118 20:25257353-25257375 CTGTGCGTCTCCAATTGTCCAGG - Intronic
1175319179 20:58073363-58073385 CTGGGCTGCTCAGGCTGTCCTGG - Intergenic
1176279174 20:64290960-64290982 CTCGGCTTCTCCACCTGTACAGG + Intergenic
1181681160 22:24496652-24496674 CTGGGCTTGTTGAGCTGCCCTGG + Intronic
1182118644 22:27773061-27773083 CTGGGCTTCCCGGCCTGTTCGGG - Intronic
1184639511 22:45861924-45861946 ATGGGCTTCTTTCACTGTCCAGG - Intergenic
1185130875 22:49037933-49037955 CTGGGCTTCTCGAAGTGAACCGG + Intergenic
949856792 3:8469281-8469303 CTTGGATTCTAGCACTGTCCAGG + Intergenic
954378475 3:50206943-50206965 CTCAGTTTCTCCAACTGTCCAGG - Intronic
955708524 3:61754228-61754250 ATGGTCCTCTCCAACTGTCCTGG + Intronic
961424794 3:126836560-126836582 CCAGGCTTTTAGAACTGTCCTGG + Intronic
967117759 3:186357013-186357035 CTGGGCCTCTGGGAGTGTCCAGG + Intronic
967118068 3:186360093-186360115 CTGGGCCTCTGGGAGTGTCCGGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968371343 3:198224270-198224292 CTCGGCTTCTCCACCTGTACAGG + Intergenic
968919714 4:3516183-3516205 CTGGGCTCCTCGAACTCTGCAGG + Exonic
969553980 4:7893662-7893684 CTGTGCTTCTCAACCTTTCCTGG + Intronic
970560276 4:17275470-17275492 CTGGTCCTCTAGAACTGCCCAGG - Intergenic
979260029 4:118636743-118636765 CTCGGCTTCTCCACCTGTACAGG + Intergenic
979328350 4:119403884-119403906 CTCGGCTTCTCCACCTGTACAGG - Intergenic
984822223 4:183892025-183892047 CTGGGATTCACACACTGTCCGGG + Intronic
985824517 5:2182333-2182355 CTGGGCTTCTAGAATTCTCAGGG + Intergenic
985963120 5:3318721-3318743 CTGAGCTTCTCTCACTTTCCAGG + Intergenic
987235253 5:15936029-15936051 CTGAGCTCCTGGAACTTTCCAGG + Intronic
988515348 5:31899461-31899483 CTGGACTTCTAGCATTGTCCTGG + Intronic
990487129 5:56270224-56270246 CTGGGTTTCATTAACTGTCCAGG + Intergenic
991492060 5:67193412-67193434 CTGAGATTCTGGAACTTTCCAGG - Intronic
996717730 5:126601161-126601183 CTGGGCTCCTCGCTCTGGCCCGG - Intronic
998047827 5:139003749-139003771 ATGGGCTTCTCTTACTGTTCTGG - Intronic
1001260834 5:170227137-170227159 CTGGGTGTCTCCAACTGTCCAGG + Intergenic
1001407334 5:171485381-171485403 CAGGGCTTTTCAAACTGGCCTGG - Intergenic
1002730581 5:181329816-181329838 CTCGGCTTCTCCACCTGTACAGG + Intergenic
1002753947 6:144288-144310 CTCGGCTTCTCCACCTGTACAGG - Intergenic
1003011365 6:2430429-2430451 CTGGGATTTCTGAACTGTCCAGG + Intergenic
1003287645 6:4748537-4748559 CTTGGCTTCCCGAACTTCCCTGG - Intronic
1019482798 7:1274203-1274225 CTGGGCTTCAGGAGCTGCCCTGG + Intergenic
1023144264 7:37133708-37133730 ATGGGCTTTGTGAACTGTCCAGG + Intronic
1025177057 7:56807354-56807376 CTTGGCTTCTCCACCTGTGCAGG - Intergenic
1025260178 7:57413354-57413376 CTGGGCTTCTGGAGCTGGGCTGG + Intergenic
1025283988 7:57648121-57648143 CTGGGCTTCCATACCTGTCCTGG - Intergenic
1025694735 7:63769032-63769054 CTTGGCTTCTCCACCTGTACAGG + Intergenic
1027053178 7:75032346-75032368 CTGGGCTTCTGGAACTTACCTGG - Intronic
1030081199 7:105780050-105780072 CTGGGCTTCTCAGAGTGTCAGGG - Intronic
1030284212 7:107808961-107808983 CTGGACTTCTGGGACTGGCCTGG + Intergenic
1032052257 7:128656736-128656758 CTTGGCTTCTCCACCTGTACAGG + Intergenic
1032263333 7:130353482-130353504 ATGGGCATCTCCAACTTTCCAGG + Intronic
1032451045 7:132031371-132031393 CTGTGCTTCTCAAACTCTCTTGG + Intergenic
1034163425 7:149008449-149008471 CTGGGCTTCCCAAAGTGTGCTGG - Intronic
1034694187 7:153039532-153039554 CTGGGCTTCTCCCACTCTCATGG - Intergenic
1037644147 8:20774960-20774982 CTATGCCTCTCAAACTGTCCTGG + Intergenic
1038269913 8:26066713-26066735 CTGGACATCTGGATCTGTCCTGG + Intergenic
1039430294 8:37520340-37520362 GTGGGCTTCCCGAATTTTCCAGG - Intergenic
1040097438 8:43459753-43459775 CTGCGCTTTTCCAACAGTCCTGG - Intergenic
1046891792 8:119430235-119430257 GTGTGCTTCTGGAATTGTCCAGG - Intergenic
1049744256 8:144256488-144256510 CTGGGCTTTACGAGCTGGCCTGG - Intronic
1050235568 9:3575754-3575776 ATTGGGTTCTCTAACTGTCCAGG + Intergenic
1051275656 9:15395489-15395511 CTGGGCTTCTCAAACTGCTGGGG - Intergenic
1051352627 9:16212820-16212842 CTGGGGTTCTAGAACTTGCCGGG + Intronic
1057001218 9:91511784-91511806 CTGGGCTTCTTGCACTGGCTGGG - Intergenic
1057325400 9:94058735-94058757 CTGGGCCTCCCAAAATGTCCGGG - Intronic
1060231774 9:121830772-121830794 CTGGCCTTCTGGAACCTTCCAGG - Intronic
1060414312 9:123419917-123419939 CTGGTCTTCTCCAGCTGCCCTGG - Intronic
1060785698 9:126450296-126450318 CTGAGCTTCCAGATCTGTCCGGG + Intronic
1062729144 9:138098899-138098921 CTGGGCCCCTCGGCCTGTCCTGG - Intronic
1062754992 9:138282326-138282348 CTCGGCTTCTCCACCTGTACAGG + Intergenic
1203578900 Un_KI270745v1:26495-26517 CTCGGCTTCTCCACCTGTACAGG + Intergenic
1198340621 X:135710139-135710161 CTGCCATTCTCCAACTGTCCTGG + Intergenic
1202381524 Y:24279113-24279135 CTTGGCTTCTCCAACTGTACAGG + Intergenic
1202489261 Y:25391013-25391035 CTTGGCTTCTCCAACTGTACAGG - Intergenic