ID: 1139575987

View in Genome Browser
Species Human (GRCh38)
Location 16:67842412-67842434
Sequence CCGGCTGCGCCGAGCGGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139575975_1139575987 17 Left 1139575975 16:67842372-67842394 CCGGCAGGAAGCGTATTCTGGGC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1139575987 16:67842412-67842434 CCGGCTGCGCCGAGCGGCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139575987 Original CRISPR CCGGCTGCGCCGAGCGGCAG TGG Exonic
900215362 1:1478778-1478800 CCGGCTGCGGGGAGCGGCCTGGG + Intronic
900222623 1:1517445-1517467 CCGGCTGCGGGGAGCGGCCTGGG + Intronic
900783578 1:4633582-4633604 CCGGGTGCCCAGTGCGGCAGAGG + Intergenic
901022190 1:6261080-6261102 GCTGCTGCGCCGGGCGGCCGGGG + Intergenic
901491481 1:9598511-9598533 CCGGCCGTGCCAAGCGGCTGTGG + Exonic
906940587 1:50251957-50251979 CCGGCCGAGCAGCGCGGCAGAGG - Intergenic
907444565 1:54499515-54499537 CCCGCCTCGCCGAGCGGCGGCGG + Intergenic
907450297 1:54542103-54542125 CCGCCTGCGCCCAGCGCCCGGGG + Intergenic
914255305 1:145957713-145957735 CCGGCGGCGCCGGGGGGCAGGGG + Exonic
914373341 1:147050669-147050691 CCGGGCGGGCCGGGCGGCAGTGG + Intergenic
916171331 1:162003526-162003548 CAGGCTGCACTGGGCGGCAGCGG + Intronic
918001606 1:180502469-180502491 TCGACTGGGCAGAGCGGCAGAGG - Exonic
919918279 1:202152597-202152619 CCTGCTGCGCCTAGTGGCAGAGG - Exonic
922315084 1:224434695-224434717 GCGGCGGCGGCGGGCGGCAGCGG + Intronic
922505266 1:226122269-226122291 CCGGCGGCCCCGAGAGGCCGGGG - Intergenic
922619533 1:226981426-226981448 CTGGCTGCACTGAGCTGCAGGGG + Intronic
923543727 1:234908832-234908854 CAGGCAGCGGCGAGTGGCAGGGG - Intergenic
1063417864 10:5889066-5889088 CCTGCTGGGCCGGGGGGCAGCGG - Exonic
1064553111 10:16521712-16521734 CCGGGTGCGCCCAGCGGCGGCGG + Exonic
1065483590 10:26216670-26216692 CCGGCGGGGCCGAGCGGCGAGGG - Exonic
1065727101 10:28677338-28677360 CCGGCGGCTCCGAGCGGCGCCGG - Exonic
1072913428 10:99522814-99522836 CCGGCTCCGCCGTGCTGCAGGGG + Intergenic
1073323700 10:102630505-102630527 CCTGCTGGGCTGTGCGGCAGGGG - Exonic
1075024212 10:118972044-118972066 CCGGCTGCCCCTGGTGGCAGGGG + Intergenic
1076735093 10:132455460-132455482 CCGGCTGCCCCGAGTGGCCGAGG + Intergenic
1077049518 11:560560-560582 CCGCCTGCGTCCAGGGGCAGCGG - Intronic
1078987966 11:16613283-16613305 CCGGCTGATCTGAGTGGCAGGGG - Intronic
1079122606 11:17696212-17696234 CCGGCTGCGCCCAGCTCCAGGGG + Intergenic
1083430679 11:62612466-62612488 CGGGTTGCTCCGAGCGGCGGCGG + Exonic
1083644916 11:64166400-64166422 GCCGCGGGGCCGAGCGGCAGAGG - Intergenic
1083650858 11:64203910-64203932 CCCGGGGCGCCGAGCTGCAGAGG - Intronic
1083895916 11:65619673-65619695 CCAGCTGTGCCGAGGGGCACCGG + Intronic
1084321051 11:68373541-68373563 CCGGCCACGCTGGGCGGCAGAGG - Intronic
1085395809 11:76206614-76206636 CCGGCCGGGCGGAGCGGGAGGGG - Intronic
1085683775 11:78603169-78603191 GCGGCTTTGCCGAGCTGCAGTGG + Intergenic
1087175301 11:95090190-95090212 CCGGCGGCGCCGAGCAGCGATGG + Exonic
1089622449 11:119729496-119729518 CCGGCGGCGCCGAGGCGCGGCGG + Intergenic
1090454169 11:126833377-126833399 CTGGCTGCGCAGACCTGCAGTGG - Intronic
1096221167 12:49828692-49828714 CGGGCTGGGCCGAGCGGGGGTGG + Intronic
1097293732 12:57941725-57941747 CCGGCGGGGCCCCGCGGCAGGGG + Exonic
1098105956 12:67069297-67069319 CCGGCGGCTCCGGGCGGCGGCGG + Intergenic
1098288501 12:68933170-68933192 CCGGCCCCGCCGGGCGGCCGCGG - Exonic
1100505574 12:95217358-95217380 CAGGCTGCGCCGCGGGGCGGCGG - Exonic
1102197162 12:111033992-111034014 GCGGCGGCGGCGAGGGGCAGCGG + Intergenic
1102518529 12:113465494-113465516 CCGGCGGTGGCGACCGGCAGCGG - Intronic
1103623555 12:122203397-122203419 CCTCCTCCGCCGAGCGGCACTGG - Exonic
1103691039 12:122774584-122774606 GCGCCTGCCCCGAGCGGCGGGGG - Exonic
1104865283 12:131949956-131949978 CCGGATGCACTGAGCGGCTGCGG + Intronic
1105322715 13:19344445-19344467 CCGGCTGCTGCGGGCTGCAGAGG + Intergenic
1106087636 13:26557737-26557759 GCGGGTGCGCCGGGCGGCCGCGG + Exonic
1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG + Exonic
1113930690 13:113967471-113967493 CCGGCTGCCCCAAGGGCCAGGGG - Intergenic
1122418186 14:101560378-101560400 ACGGGTGCGCCCAGCGGCCGGGG + Intergenic
1129116419 15:73367787-73367809 CGGGCTGCGCCGAGGCGCCGGGG + Exonic
1129540346 15:76342848-76342870 CCCGCGGCGCCGAGCGAGAGTGG - Intergenic
1130283909 15:82540225-82540247 CCGGCTGCGCTGAGCCGGAGAGG + Intronic
1132055240 15:98647471-98647493 GCGGCTGCGGGGAGCGGCCGGGG - Intergenic
1134073939 16:11277473-11277495 CCGGCAAGGCCGAGCGGGAGGGG - Intronic
1139475184 16:67199458-67199480 CGGGCTGCCCCGAGGGCCAGGGG - Intronic
1139575987 16:67842412-67842434 CCGGCTGCGCCGAGCGGCAGTGG + Exonic
1140221644 16:73048251-73048273 CCCGGGGAGCCGAGCGGCAGCGG - Exonic
1141452731 16:84116680-84116702 CCCGCTCCGCCTAGCGGCGGCGG - Intronic
1141608790 16:85170001-85170023 CCGGCTGCGCGGGGCCGCGGAGG + Intergenic
1142060753 16:88027679-88027701 CCAGCTGCCCCGAGCGGGGGAGG - Intronic
1142625743 17:1190802-1190824 CCTGCAGCGCCGTGGGGCAGAGG - Intronic
1142694782 17:1627836-1627858 CCAGCGGCGCCGATGGGCAGTGG + Exonic
1143078533 17:4365617-4365639 CCGGCTGCGCCGCCCGGCTGGGG - Intronic
1143176253 17:4956845-4956867 CCAGACGCTCCGAGCGGCAGGGG - Exonic
1146183012 17:30709265-30709287 GCGGCGCCGCCGAGCGGCGGGGG + Intergenic
1146547533 17:33751854-33751876 CCGGGTGTGCTGAGAGGCAGCGG + Intronic
1149431067 17:56595920-56595942 CAGGCTGGGCCGAGGGGCGGGGG + Intergenic
1149626497 17:58083866-58083888 CGGGCTGCGCCGAGAGGGAGGGG - Intronic
1150692375 17:67377483-67377505 CGGGCAGAGCCGAGCGGCGGCGG + Intronic
1151667053 17:75551020-75551042 CGGGCTGGGCAGAGAGGCAGGGG - Intronic
1152244704 17:79179253-79179275 AAGGCTCCGCCGAGGGGCAGGGG - Intronic
1153382494 18:4454976-4454998 CGGGCTGCGCCGCGGGGCTGGGG - Intronic
1154070755 18:11149512-11149534 CCGGCTGCGCCGCGAGGGCGAGG - Intergenic
1156502171 18:37566857-37566879 CGGGCCGCGCCGGGGGGCAGAGG + Intergenic
1157842136 18:50968277-50968299 GCGGCGGCGCCGGGCGGCCGAGG - Intronic
1158954396 18:62524487-62524509 CCGGCAGCTCCCAGCGCCAGAGG + Intronic
1160806531 19:994615-994637 CCAGCTGGGCCGAGCAGCAGGGG - Intronic
1160934004 19:1584717-1584739 CCGGCGGCGCGGAGCCTCAGGGG + Intronic
1163273202 19:16266577-16266599 CCGGCTGCGGTCAGGGGCAGAGG - Intergenic
1163462661 19:17448334-17448356 CGGGCCGCGCCGAGCTGCGGGGG - Exonic
1163878929 19:19900941-19900963 CCGGCTGCACCGAGAGACAAAGG - Intronic
1164763265 19:30743946-30743968 CCGGCTGCCCCCAGGGCCAGTGG + Intergenic
1165157335 19:33796462-33796484 TCGGCTGCGCCGCGGGGCAGAGG - Intronic
1166364384 19:42271053-42271075 CAGGCTGCCCAGAGGGGCAGAGG + Intronic
1166762606 19:45234437-45234459 CCGGGAGCGCCTAGAGGCAGCGG - Intronic
1167347307 19:48954790-48954812 CCGGCGGCGCTGCGGGGCAGCGG + Intergenic
1167368093 19:49065092-49065114 GGGGCGGCGCCGGGCGGCAGAGG + Intergenic
1168339531 19:55615197-55615219 CCCGCGCCGCCGAGCAGCAGCGG - Exonic
927690387 2:25204238-25204260 ACGCCTGCGCCGAGCGCCCGTGG + Intergenic
928089797 2:28367113-28367135 CCGGCTGCTACAAGCCGCAGTGG + Intergenic
932288253 2:70554219-70554241 CTGCCAGCGCCGTGCGGCAGCGG + Intergenic
932812277 2:74835055-74835077 CCGGCGGCCCCACGCGGCAGCGG - Intronic
934754461 2:96816038-96816060 CCGGATGCGCGGGGTGGCAGTGG - Intergenic
934897163 2:98128927-98128949 CCGGCTCAGCCGGGAGGCAGAGG - Intronic
935046662 2:99489604-99489626 CCGGCGGCTGCGAGCGTCAGGGG + Intronic
937203346 2:120219967-120219989 CCGGCAGCCCTGAGCAGCAGTGG - Intergenic
940987322 2:160062483-160062505 CCGGCCCCGCCGCGCGGAAGCGG + Exonic
941111710 2:161423961-161423983 TCGGCGGCGCCGGGCGGCAGCGG - Exonic
946248820 2:218401092-218401114 GCGGCTGGGCCCAGAGGCAGGGG - Intronic
1168819528 20:763670-763692 CCAGGTGCGCCGGGCAGCAGGGG + Exonic
1176178773 20:63740183-63740205 GGGGCTGCGCCGGGCGGCCGGGG + Intronic
1176377075 21:6092052-6092074 CGGGCGGGGCCGAGCGGCCGCGG + Intergenic
1178843625 21:36156978-36157000 CCGGCTTCGCCCAGCGGCTGAGG - Intronic
1179746400 21:43446192-43446214 CGGGCGGGGCCGAGCGGCCGCGG - Intergenic
1180612372 22:17106361-17106383 CCGGCTGCCCTGAGCCACAGGGG + Intronic
1183386877 22:37519767-37519789 CGGGCTGCGCCGGGCGTGAGCGG - Intergenic
1183744726 22:39685912-39685934 CAGGCGGCGGCGAGCGGCGGGGG - Exonic
950054012 3:10011215-10011237 CAGGCGGCGGCGAGCGGCGGCGG - Intergenic
952816586 3:37452384-37452406 CCGGCTGCGCCGAGGGGCGCCGG + Exonic
954277948 3:49554645-49554667 CCGGCGCCGCCGGGCGGCAGCGG - Exonic
955387663 3:58492230-58492252 ACGTCTGCGCCGAGCGGCCAGGG + Intronic
959534631 3:107470767-107470789 ACGGCTTTGCCGAGCTGCAGTGG - Intergenic
960289607 3:115867508-115867530 CCCGCTGTGCTGAGGGGCAGAGG + Intronic
961734691 3:128993986-128994008 GCGGATGCGCTGGGCGGCAGCGG + Exonic
965245105 3:166258011-166258033 CAGGCTGCGCCAGGCAGCAGTGG - Intergenic
968701332 4:2059485-2059507 CCGGCCGGGCGGCGCGGCAGCGG - Intergenic
969319983 4:6405829-6405851 ACGGCTTCGCGGAGGGGCAGGGG + Intronic
970727198 4:19060546-19060568 GCGGCTTTGCCGAGCTGCAGTGG - Intergenic
972532964 4:39977301-39977323 CCGGAGGCGCCAAGCGGCCGGGG - Intronic
972740366 4:41881764-41881786 GCGGCTGAGCCGCGCGGCTGCGG - Intergenic
985403480 4:189614770-189614792 CAGGCTGCCCCAAGCAGCAGTGG - Intergenic
985530206 5:429573-429595 CCTGCAGCGCCGAGGGGCCGAGG - Intronic
992506449 5:77391721-77391743 TCGGCTGGCCCGAGGGGCAGAGG + Intronic
992528952 5:77637422-77637444 CCGGCTGCGGCGAGGGCAAGGGG - Intronic
993501831 5:88674535-88674557 CCGGCGGGGCTGAGCGCCAGCGG - Intergenic
993885175 5:93407672-93407694 TCTGCAGCGCCGAGCAGCAGTGG - Intergenic
993987897 5:94618877-94618899 GCGGCTGGGGTGAGCGGCAGCGG + Intronic
996329463 5:122312428-122312450 TCGGCTGCTCCGGGCAGCAGAGG + Intronic
996341597 5:122444621-122444643 CCCAGAGCGCCGAGCGGCAGGGG + Exonic
1003416871 6:5917580-5917602 GCGGCTTTGCCGAGCTGCAGTGG + Intergenic
1003624110 6:7727102-7727124 GCGGCTGCTCCGTGCGGCCGGGG - Exonic
1005988435 6:30888989-30889011 CCTGCTGTGGCGGGCGGCAGTGG - Exonic
1005993144 6:30915748-30915770 CCGGCTGCCCCAAGCTACAGGGG + Exonic
1006929771 6:37680747-37680769 CCAGCTGGGCCAAGTGGCAGGGG - Intronic
1007553395 6:42746731-42746753 CAGGCCGCGCCGAACTGCAGTGG - Intergenic
1016923211 6:149317059-149317081 CCGGCGGCGCCGCGCGGGTGGGG - Intronic
1018261900 6:161978743-161978765 CCAGCTGTGCTGAGCGACAGTGG + Intronic
1019400089 7:847573-847595 CCCGCAGCGCCGTGCGCCAGCGG + Intronic
1019400119 7:847659-847681 CCCGCAGCGCCGTGCGCCAGCGG + Intronic
1019400150 7:847745-847767 CCCGCAGCGCCGTGCGCCAGCGG + Intronic
1019400181 7:847831-847853 CCCGCAGCGCCGTGCGCCAGCGG + Intronic
1024313104 7:47988003-47988025 CTGGCTGTGCCGAGGAGCAGGGG + Intronic
1032068739 7:128791337-128791359 CGGGCGGCGGCGAGCGGCGGGGG + Intronic
1032841213 7:135714805-135714827 CCGGCGGCACCAGGCGGCAGCGG + Intronic
1033243797 7:139702248-139702270 CTGGCTGCTCTGAGCTGCAGAGG + Intronic
1034272696 7:149811124-149811146 ACGGCTGTGCCGAGGGGCTGGGG - Intergenic
1034447831 7:151122495-151122517 GCGGCGGCGGCGGGCGGCAGCGG - Intronic
1034618347 7:152436871-152436893 CGGGCTGCGCCGGGCGACCGCGG - Intergenic
1034962936 7:155373827-155373849 CCGGCAGCGCGGACCGGCCGAGG - Intergenic
1039845743 8:41324281-41324303 CCAGCTGAGCCCAGCAGCAGGGG + Intergenic
1048214080 8:132480296-132480318 GCGGCCGCGACGAGGGGCAGCGG - Exonic
1060695686 9:125707145-125707167 CCGGCGGCGGCGAGCAGCAGGGG - Exonic
1060770243 9:126327030-126327052 CCGGCTCCGCCGAGCCTCCGCGG - Intronic
1062493675 9:136821688-136821710 CTGGCTGCGCTGAGCGCCTGCGG + Intronic
1185457620 X:318712-318734 CCCGCGGAGCCGAGCGGCCGCGG + Exonic
1187915597 X:24149960-24149982 CCGGCTGCCCCGAGCGGCGGCGG + Intronic
1195808394 X:108801319-108801341 CAGGCTGTGCTGAGCTGCAGTGG - Intergenic
1199696508 X:150346319-150346341 CAGGCTGCTCTGAGAGGCAGTGG + Intergenic
1200088380 X:153622965-153622987 CCAGCTTCGCCTAGGGGCAGGGG + Intergenic
1200333245 X:155319965-155319987 GCGGCTTTGCCGAGCTGCAGTGG - Intronic