ID: 1139576584

View in Genome Browser
Species Human (GRCh38)
Location 16:67846326-67846348
Sequence GACTCAAATGTCCCTCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139576584_1139576593 20 Left 1139576584 16:67846326-67846348 CCCACCTGAGGGACATTTGAGTC 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1139576593 16:67846369-67846391 GCCTGCTCGAAACCAGCTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 67
1139576584_1139576592 19 Left 1139576584 16:67846326-67846348 CCCACCTGAGGGACATTTGAGTC 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1139576592 16:67846368-67846390 AGCCTGCTCGAAACCAGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139576584 Original CRISPR GACTCAAATGTCCCTCAGGT GGG (reversed) Intronic
902538144 1:17133535-17133557 GACACAAAGGTCACACAGGTGGG + Intergenic
903740347 1:25555059-25555081 GGCTCCAATGTCACCCAGGTAGG - Intronic
905813835 1:40932410-40932432 GACTCAAATGGATCTCGGGTGGG - Intergenic
909741367 1:79033340-79033362 AACAGAAATGTCCCTGAGGTTGG + Intergenic
910825988 1:91407646-91407668 AACTCAAATGTCCCTTAGCCAGG - Intergenic
910975285 1:92900079-92900101 GACTGTAATGTGCCTCAGGAAGG + Intronic
911234822 1:95401076-95401098 TAGTAAAATGTCCCTCAGTTTGG - Intergenic
912866198 1:113259379-113259401 TTGTCAAATGTCCCTCAGCTGGG + Intergenic
917301325 1:173577451-173577473 TATTCAAATATCCTTCAGGTTGG - Intronic
918215660 1:182390905-182390927 CACTGAAATGTCCCTAAAGTGGG + Intronic
921062965 1:211601416-211601438 AACTCAAATGTCCCTCGGTTGGG - Intergenic
922404324 1:225296939-225296961 GACTGTAATGTTCCTCAGATAGG + Intronic
1066344291 10:34568107-34568129 GACTCAAATGTGGTTCAGGGTGG - Intronic
1072222409 10:93337718-93337740 GACTAAAAGGTCCCTTGGGTGGG - Intronic
1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG + Intergenic
1078048814 11:7943973-7943995 GACTATAATGTGCCTCAGGAAGG + Intergenic
1078817741 11:14844009-14844031 GCTACAAATGCCCCTCAGGTAGG + Exonic
1079717790 11:23770589-23770611 GACTCAAACTTGCCCCAGGTTGG + Intergenic
1081482499 11:43502944-43502966 GACTCAATTTTCCCACAGGTGGG + Intergenic
1084426656 11:69087723-69087745 GACTCAGATGAGCCTCAGGATGG - Intronic
1084473556 11:69376589-69376611 GTCTCAAATGGGCCTCAGGCTGG + Intergenic
1085451105 11:76633996-76634018 CACTCAAATGTCCATCAGTAGGG - Intergenic
1086487597 11:87325118-87325140 GACTGAGATGACCCTCAGATTGG + Intergenic
1086518996 11:87648054-87648076 GACTATAATGTGCCTCAGGGAGG + Intergenic
1088844419 11:113652798-113652820 GGCTGAAATGTTCCTCATGTGGG - Intergenic
1089482413 11:118817353-118817375 GACTGAAAAATCCCTCAGTTGGG + Intergenic
1093655213 12:21687172-21687194 GAGTCAAATGTCCATCAAGAGGG - Intronic
1099196586 12:79624088-79624110 GACTCAAAAATCCCTCACCTAGG + Intronic
1099449302 12:82789698-82789720 GAACCAAATGTCCATCAGTTAGG - Intronic
1102360080 12:112278371-112278393 GAATTAAATGTTCCTCAGGCTGG - Intronic
1103052420 12:117791689-117791711 CATTCAAATGTCCTTCAAGTTGG - Intronic
1104334948 12:127885512-127885534 CAAGCAAATGTCCATCAGGTAGG - Intergenic
1112446869 13:99472162-99472184 GACTCAAATAGTCCTCAGATGGG - Intergenic
1113278721 13:108764786-108764808 GATTCAAATGTCACTCAAGCTGG + Intronic
1113361146 13:109632673-109632695 GACTCAAGTGTTCCACATGTTGG - Intergenic
1113654564 13:112059587-112059609 AAATCAGATTTCCCTCAGGTTGG - Intergenic
1116511248 14:45749680-45749702 GACTTAAATGTCCATTAGGAGGG - Intergenic
1117184368 14:53225598-53225620 GACTCAAATTTGGCTCAGATAGG + Intergenic
1117825431 14:59697189-59697211 GGCTCAAATATCCCTCATTTTGG + Intronic
1119152638 14:72376525-72376547 GACTAAAATGTGCCTCAGAGAGG - Intronic
1119253249 14:73175683-73175705 TTCTCAAATGTCCCTGATGTTGG + Intronic
1122089713 14:99330295-99330317 GACTCAGATGGCCCTCAGCACGG - Intergenic
1129074437 15:72980075-72980097 AACTCAAATGTTCTTCAGCTGGG + Intergenic
1131982593 15:98009622-98009644 AACTCAAATGTCCCTCAAGAGGG - Intergenic
1133656378 16:7868556-7868578 AACTCAAAAGACCCTCAGCTTGG - Intergenic
1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG + Intergenic
1139576584 16:67846326-67846348 GACTCAAATGTCCCTCAGGTGGG - Intronic
1140355532 16:74302711-74302733 GTCTCAACTGTCGCACAGGTTGG - Intronic
1141216916 16:82033491-82033513 GACTCAAATGTCCATGTGGCTGG + Intergenic
1141375396 16:83525675-83525697 ATCTGCAATGTCCCTCAGGTAGG - Intronic
1141732624 16:85833195-85833217 GTGTCAAATGCCCCTCAGTTTGG + Intergenic
1142502815 17:342450-342472 AACTCAAATGTCCATCAACTGGG + Intronic
1143704794 17:8689298-8689320 CACTTAAATGTCCCTCAAGTGGG - Intergenic
1143968714 17:10776808-10776830 GAGTCAGATGACCCCCAGGTGGG + Intergenic
1150278746 17:63916738-63916760 AACTCAAATGTCCCACCGGTTGG + Intronic
1151050122 17:70968813-70968835 AACTCAAATGTCCTTCAGCCTGG + Intergenic
1151271650 17:73001078-73001100 AACTCAAATGTCCATGAGGAGGG - Intronic
1153762879 18:8348573-8348595 AAACTAAATGTCCCTCAGGTGGG - Intronic
1156925225 18:42569233-42569255 GAGGCAAATGTGCCTCTGGTTGG + Intergenic
1157949525 18:52019012-52019034 GGCTAATATGTCCCTTAGGTTGG + Intergenic
1160141790 18:76330045-76330067 GACTATAATGTGCCTCAGGGAGG - Intergenic
1162328504 19:10012370-10012392 GCCTCAGATGTCCCTGGGGTGGG - Intergenic
1163190827 19:15675361-15675383 GACTCTAATGTCCATCAGGATGG - Intronic
1163202208 19:15777493-15777515 GACTCTAATGTCCCTCAGGATGG + Intergenic
1164955328 19:32377993-32378015 TTGTAAAATGTCCCTCAGGTTGG - Intronic
1166510261 19:43403109-43403131 GTCTTTAATATCCCTCAGGTAGG + Intronic
1166941410 19:46368450-46368472 GACTGATATGTCCCTGAGGCAGG - Intronic
1167561970 19:50231386-50231408 GACTCAAAAGTCCCTGCGGAGGG + Intronic
930712853 2:54565439-54565461 GCCTCAGATGACCCTCAGGTGGG + Intronic
931133043 2:59360699-59360721 AACTCAAATGCCCATCAGGAGGG - Intergenic
931328580 2:61254758-61254780 GATTCACATGTTCCCCAGGTTGG - Intronic
941393303 2:164943335-164943357 GACACAAATGTCCCTGAACTGGG + Intronic
941662014 2:168204527-168204549 GACTGAACTGTCCCACTGGTAGG + Intronic
941773474 2:169366758-169366780 TACTTAAATGTCCCTTAGTTTGG - Intergenic
941799340 2:169639246-169639268 GACTCAATTATCCCTAATGTGGG - Exonic
943369382 2:186998806-186998828 AACACAAATGTCCCTCACTTGGG - Intergenic
943712834 2:191116916-191116938 AACTCAAATATCCCTCCCGTTGG + Intronic
944635665 2:201673926-201673948 TTCTGAAATGGCCCTCAGGTGGG - Intronic
1168790797 20:574570-574592 GACTCAGGTGACCTTCAGGTTGG + Intergenic
1169684759 20:8259159-8259181 GAAACAAATGTCCTTCAAGTGGG - Intronic
1169842457 20:9955072-9955094 AACTCAAAAGTCCTTCAGCTTGG - Intergenic
1170610205 20:17906653-17906675 GACCCAAATGCCCCTCAAGAAGG + Intergenic
1174305638 20:49612464-49612486 GACTCAAGTTTCCCTGGGGTGGG + Intergenic
1179876503 21:44271633-44271655 TACCCAAATGTCCCTCAGTGGGG - Intergenic
1180252030 21:46596346-46596368 GAATCAAATTTCCCCCAGGCTGG - Intergenic
1181471666 22:23144277-23144299 GACTCCAATTTCCCTGAGGGTGG + Intronic
1182476789 22:30580933-30580955 GATGCAAATGTCCCTAAGCTGGG + Intronic
1184117005 22:42428093-42428115 ATCACAAATGCCCCTCAGGTAGG - Intronic
1185371625 22:50463519-50463541 GACCCAAATGCCTTTCAGGTGGG + Intronic
950705120 3:14774735-14774757 GAATCAAATGTACCTTAGGGAGG + Intergenic
952817122 3:37455220-37455242 GACTGACATGTCCCTCAAGCAGG - Intronic
953146631 3:40282298-40282320 GACCCAAATGTCCATTAGTTTGG - Intergenic
953780292 3:45863181-45863203 GCGTCTAATGTCCTTCAGGTAGG + Intronic
959219888 3:103504369-103504391 GACCCAAATGTCCCTCAGAAAGG + Intergenic
961648373 3:128404803-128404825 GTGTCACATGTCCCTCAGGCAGG + Intronic
962284118 3:134072638-134072660 CACTCAAATGTCCCTGGGGGTGG - Intronic
964755774 3:160089678-160089700 GACTCAAATGACCTTCACGTTGG + Intergenic
971296953 4:25402842-25402864 GACTTAAATGTCACCCAGATAGG + Intronic
972067009 4:34960218-34960240 GTCTCAATAGTCTCTCAGGTTGG - Intergenic
972642972 4:40942462-40942484 GAGTTAAGTGTCCCTCAGCTGGG - Intronic
974182042 4:58396831-58396853 GACTAAAATGTGCCTCAGAGAGG - Intergenic
975767599 4:77685285-77685307 AACTCAAATGTCCCCTAGCTGGG + Intergenic
979693574 4:123586659-123586681 AACTCAAATGTCTCTCAACTGGG + Intergenic
981793228 4:148563719-148563741 AACCCAAATGTCCCTCAACTAGG - Intergenic
982789770 4:159577299-159577321 AAATCAAATGATCCTCAGGTTGG + Intergenic
986778388 5:11041066-11041088 TATTCCAATGTCGCTCAGGTTGG - Intronic
994628944 5:102257452-102257474 GACTTAAAGGTCCATCAAGTAGG + Intronic
995107008 5:108386284-108386306 AACTCAAATCTACCTCAGGTTGG - Intergenic
999519641 5:152338123-152338145 GCCACAAATGTGCTTCAGGTAGG + Intergenic
1000795788 5:165662699-165662721 GACTCAAAGCCCCCTGAGGTAGG + Intergenic
1003324813 6:5084200-5084222 GACTTAGATGGCCCTCAGGGTGG + Intergenic
1004456737 6:15798411-15798433 GATTCCCATGACCCTCAGGTTGG - Intergenic
1005060467 6:21772353-21772375 GACAAAAATATCCCTAAGGTAGG - Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1009350336 6:62667839-62667861 TAGTTAAATGTCCCTCAGTTTGG - Intergenic
1010712627 6:79192882-79192904 TACTCAAATATCCCTGAAGTAGG - Intergenic
1010716230 6:79233642-79233664 GACACAAATCTCCCTCGGGGTGG - Intronic
1013451529 6:110286413-110286435 GATTAAAATGTCACTCAGGCAGG - Intronic
1013875614 6:114823369-114823391 GAGGCAGATGTCCCTCTGGTTGG - Intergenic
1018956735 6:168415484-168415506 GACTCACTTCTCCCTGAGGTAGG + Intergenic
1022608629 7:31844761-31844783 GACTCAAATTGCCCTTATGTTGG + Intronic
1022889383 7:34681181-34681203 GACCCAGCTCTCCCTCAGGTTGG - Intronic
1023753232 7:43391574-43391596 ATCTCAAGTGTCCCTGAGGTTGG + Intronic
1025724577 7:64045211-64045233 AATACAAATGTCCCTCAGGCAGG + Intronic
1027800883 7:82747521-82747543 GACCCACATGTCACTCAGGATGG + Intergenic
1036643361 8:10597670-10597692 GACTCTGATGTCCCCCAGGCCGG - Intergenic
1043293108 8:78628586-78628608 GTCTCACATGTCTCTCAGGCTGG - Intergenic
1044952866 8:97450807-97450829 GATTAAACTGTCCCACAGGTGGG - Intergenic
1045337167 8:101216487-101216509 GACTATAATGTGCCTCAGGAAGG - Intergenic
1046758208 8:117992996-117993018 AACTCATATGTCCCTCTGGTTGG - Intronic
1046795995 8:118372686-118372708 AACTCAAATGTCCCACAGCTGGG + Intronic
1047425271 8:124739591-124739613 GACTCACCTGCCACTCAGGTGGG - Intergenic
1049594153 8:143475787-143475809 GGCCAAAATGTCCCTGAGGTGGG - Intronic
1051527099 9:18057511-18057533 GTCACAAATATCCCTCAGCTAGG - Intergenic
1052665833 9:31494353-31494375 AACTCAAATTTCTTTCAGGTGGG - Intergenic
1056503030 9:87229341-87229363 GACTAAAATATCTCTCAGGCTGG + Intergenic
1057578144 9:96260865-96260887 GACTCCCATCCCCCTCAGGTCGG + Intronic
1057951763 9:99374522-99374544 TTCTCAAATATGCCTCAGGTTGG + Intergenic
1061668828 9:132176587-132176609 AGCTCAAATGTCCATCAGTTAGG - Intronic
1062001044 9:134215814-134215836 AACCCAGATGTCCCTCAGCTGGG + Intergenic
1187350086 X:18505587-18505609 TAGTAAAATGTCCCTCAGCTTGG + Intronic
1189918979 X:45884993-45885015 GACTCAGATAGCCCTAAGGTAGG - Intergenic
1191916126 X:66203354-66203376 ATCTCAAATGTCCCTGAGGGAGG - Exonic
1193269662 X:79514751-79514773 GACAAAAATGTGTCTCAGGTGGG - Intergenic
1194379793 X:93177999-93178021 GACACAAAGGTGCCTCAGGAGGG - Intergenic
1195147092 X:102028922-102028944 GACTCATGTGGCTCTCAGGTGGG - Intergenic
1195889355 X:109675193-109675215 GGCTCTCATGTCCTTCAGGTCGG + Intronic
1197028562 X:121785417-121785439 AACTCAAATGTGTCTCAAGTGGG + Intergenic
1200811623 Y:7491396-7491418 GACTCAAATGGCCCTGAAGGCGG + Intergenic