ID: 1139576644

View in Genome Browser
Species Human (GRCh38)
Location 16:67846556-67846578
Sequence CAGCTGGGCCAGCTTGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 523}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139576636_1139576644 -4 Left 1139576636 16:67846537-67846559 CCAGGGGCCCAGGGAGGGGCAGC 0: 1
1: 0
2: 15
3: 145
4: 1561
Right 1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG 0: 1
1: 0
2: 4
3: 67
4: 523
1139576635_1139576644 -3 Left 1139576635 16:67846536-67846558 CCCAGGGGCCCAGGGAGGGGCAG 0: 1
1: 2
2: 20
3: 114
4: 755
Right 1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG 0: 1
1: 0
2: 4
3: 67
4: 523
1139576623_1139576644 30 Left 1139576623 16:67846503-67846525 CCCAAGGGGAGGGGGTTTCGTGA 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG 0: 1
1: 0
2: 4
3: 67
4: 523
1139576624_1139576644 29 Left 1139576624 16:67846504-67846526 CCAAGGGGAGGGGGTTTCGTGAG 0: 1
1: 0
2: 0
3: 11
4: 251
Right 1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG 0: 1
1: 0
2: 4
3: 67
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139576644 Original CRISPR CAGCTGGGCCAGCTTGGGGC CGG Intronic
900142478 1:1144522-1144544 CAGCTGGGCCAGGTGTGGCCAGG - Intergenic
900205548 1:1430654-1430676 CAGCTGGGCCTGGTGGGGGTGGG + Intergenic
900623819 1:3599152-3599174 CTGCGGGGCCAGCCTGGGGAGGG + Intronic
900642244 1:3693373-3693395 CCGCTGGGCCAGCCTGGCCCTGG + Intronic
901054659 1:6443583-6443605 CAGCTGGGCCTGCTTGGGTGAGG - Intronic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902479697 1:16705021-16705043 CAGCTGGGCCTGCTTGAGTGAGG + Intergenic
902717448 1:18282323-18282345 CACCTGGGCCAGAGTGGGGGTGG - Intronic
903101556 1:21035114-21035136 CAGCTGTGCCAGGGTGGGGGTGG - Intronic
903184338 1:21620711-21620733 CGGCTGGCCCGGCTCGGGGCTGG + Intronic
903215615 1:21841961-21841983 CAGGTGGGCAAGCTGGGGGCAGG - Intronic
903516232 1:23912814-23912836 CAGGTGGGCCTGTCTGGGGCAGG - Intronic
903754897 1:25653783-25653805 GAGCAGGGCCAGGTCGGGGCGGG + Intronic
903846432 1:26282196-26282218 CAGCTGGGCCAGGGAGGGGGCGG - Intronic
904078716 1:27858655-27858677 CAGCTGTGCCAGGTTGGGCCTGG + Intergenic
904566481 1:31431543-31431565 CAGCTGTGCCAGGTCGGGGAGGG - Intronic
904575982 1:31505351-31505373 CAGCTGGGCCTGGGTGGGGGTGG + Intergenic
904617122 1:31755968-31755990 CAGCAGGGCCTGGGTGGGGCGGG - Intronic
904928286 1:34065487-34065509 CAGCCGGCCCTGCTTAGGGCTGG - Intronic
905043180 1:34976898-34976920 CCGCTGGGCAAGCTCGGGGCTGG - Intergenic
905270053 1:36781816-36781838 CAGCTGGGTGACCTTGGGCCGGG + Intergenic
905477419 1:38238870-38238892 TCGCTGGCCCAGCTTGGGCCAGG - Intergenic
905627343 1:39497831-39497853 CAGGTGGGACAGAGTGGGGCCGG + Intronic
905954494 1:41981027-41981049 CAGCTGGGCAAGCTTGAGAGAGG + Intronic
906131595 1:43462093-43462115 TGCCTGGGCCAGCTTGGGTCAGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906513321 1:46423871-46423893 CTGCTGGCCCTGCTGGGGGCTGG + Intergenic
907431348 1:54413938-54413960 CAGCTGGCCAAGCTTGGCACTGG + Intergenic
908103930 1:60820949-60820971 CTTCTGGGTCAGCTTGGGGTTGG - Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910145664 1:84077889-84077911 CAGCTGGCAGAGCCTGGGGCGGG - Intergenic
910209953 1:84782673-84782695 CTGTTGGGCCAGGTTGGGGGCGG + Intergenic
910773345 1:90851442-90851464 CAGAGGGCCCTGCTTGGGGCGGG - Intergenic
911652716 1:100408073-100408095 CACTTGGGCCAACTTGGGGATGG - Intronic
912493434 1:110075871-110075893 CAGCTGTCCCAGCTTTGGGCTGG + Intergenic
913130494 1:115834286-115834308 CCGCTGGGCCAGCTGGGGCTAGG + Intergenic
914490355 1:148147364-148147386 GAGCTTGGCCATCCTGGGGCAGG + Intronic
915273519 1:154772461-154772483 CAGGTGGGGCAGGCTGGGGCAGG + Intronic
915367363 1:155323645-155323667 CAGCAGTGCCAGCTCGGGGCTGG - Intronic
915512718 1:156395181-156395203 CAGCTGGCCCAGCAGGAGGCAGG + Intergenic
916934796 1:169616595-169616617 CAGCTGTGTCACCTAGGGGCAGG + Intronic
917224693 1:172768928-172768950 CAGCTGGCTCAGGTTGGAGCGGG + Intergenic
917334845 1:173916353-173916375 CCGTTGGGCAAGCCTGGGGCTGG + Intronic
917450993 1:175147107-175147129 CAGCTGTGGCAGCTTGGGGCGGG + Exonic
917645730 1:177026850-177026872 CAGCAGGGTGAGCTTGAGGCAGG - Intronic
918133007 1:181645621-181645643 CAGGTGGGCCTGCATGGGTCCGG - Intronic
919687056 1:200493567-200493589 CAGCTGTGACAGCTGGGAGCAGG + Intergenic
920085241 1:203410807-203410829 CAGTTGAACCAGCTTGGGGCTGG + Intergenic
921390181 1:214607850-214607872 GAGCTTGGCCATCCTGGGGCAGG - Intronic
922765994 1:228157070-228157092 CAGCGGGACCAGCCGGGGGCTGG + Intronic
923561905 1:235047882-235047904 CAGCTGAGGCTGCTTAGGGCTGG - Intergenic
923615182 1:235531409-235531431 CAGCAGGCCCATCATGGGGCTGG + Intergenic
1063257283 10:4342273-4342295 CAGCAGGGTCAGCCTGGTGCAGG + Intergenic
1063558981 10:7108861-7108883 CAGCTGAGGCAGGTTGGGGCAGG + Intergenic
1065521700 10:26579829-26579851 CAGCTGGCCCTGCTTGGGGCTGG - Intergenic
1065522525 10:26586394-26586416 GAGCTGGCCCGGCTTGTGGCTGG - Intergenic
1065522837 10:26588832-26588854 GAGCTGGCCCCGCTTGTGGCTGG - Intergenic
1065527519 10:26638093-26638115 GAGCAGGCCCCGCTTGGGGCTGG - Intergenic
1065559318 10:26946295-26946317 GTGTTGGCCCAGCTTGGGGCTGG + Intergenic
1067348769 10:45456947-45456969 CAGCTGGGCGGGCATGTGGCCGG + Exonic
1067385752 10:45816659-45816681 CAGGTGGGCCAGCTGAGGCCAGG - Intronic
1067557057 10:47279732-47279754 CAGCAGGGCCACCTGGGGGGAGG + Intergenic
1067672277 10:48333999-48334021 GAGCTGGCCCCACTTGGGGCTGG + Intronic
1067768465 10:49107340-49107362 GGGCTGGGCCATGTTGGGGCAGG + Intronic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1070425199 10:76280343-76280365 AAGCTGGTTCAGCTTGGGGTAGG + Intronic
1070826682 10:79394317-79394339 CTCCTGGGCCAACATGGGGCAGG - Exonic
1071225715 10:83526226-83526248 CAGCTGGGCCAGGATTGGGTGGG + Intergenic
1072209381 10:93232573-93232595 CAGCTCGGTCAGTTTGAGGCAGG + Intergenic
1072618342 10:97064139-97064161 CAGCCGGGGCAGCTGGGAGCGGG - Intronic
1072739782 10:97902479-97902501 CAGCTGGGCTATCCTGGGCCTGG - Intronic
1073295424 10:102435684-102435706 CAGAAGAGCCAGCATGGGGCGGG + Intergenic
1073435697 10:103514478-103514500 CAGATGGCCCAGGCTGGGGCAGG - Intronic
1075490407 10:122862959-122862981 CAGAAGGGCCAGCTTGGGAGGGG + Intronic
1075520791 10:123142569-123142591 CTTCTGGGCCAGCTAGGGCCTGG + Intergenic
1075539627 10:123301233-123301255 CAGCTGGACCAGAAAGGGGCGGG - Intergenic
1075545514 10:123351761-123351783 CACCTGGGCCGGGTTTGGGCCGG - Intergenic
1075869865 10:125763419-125763441 CTGCTGGGCCAGCTTGCCGCCGG + Exonic
1076365109 10:129916633-129916655 CAGCAGGGCCAGCGAGAGGCTGG + Intronic
1076757283 10:132579175-132579197 AAGCTGGGCTAGCTGGAGGCGGG + Intronic
1076887888 10:133270903-133270925 CTGCTGGGCCAGTGTGGGACAGG + Exonic
1076945062 10:133640843-133640865 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
1077042222 11:529885-529907 CAGCTAGGCCAGTGTGTGGCAGG - Intergenic
1077091839 11:782210-782232 AGGCTAGGCCAGCTTGGGACAGG - Intronic
1077108007 11:850195-850217 CGCCTGGGCCGCCTTGGGGCCGG - Intronic
1077146860 11:1050316-1050338 GAGCCGGGCCAGCTGGGGACAGG + Intergenic
1077222412 11:1423658-1423680 CAGCGGGGGAGGCTTGGGGCAGG - Intronic
1077406901 11:2386775-2386797 CAGCTGGGCCAGGAGGGGGTGGG - Intronic
1077439470 11:2561310-2561332 CAGCTGGGCCAGCACGGGACGGG + Intronic
1077442986 11:2577407-2577429 CACCTGGGCCACCTTCCGGCAGG + Intronic
1077504245 11:2922772-2922794 CACCTAGCCCAGCTGGGGGCAGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077865668 11:6219129-6219151 TGGTTGGGCCAACTTGGGGCTGG - Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1078460841 11:11514274-11514296 CTGCAGGGCCAGCCTGGGGCAGG - Intronic
1078718480 11:13861653-13861675 GAGCTGGCCCAGGTTGAGGCAGG + Intergenic
1079088402 11:17463405-17463427 CACCTGGGCCAGGGTGGGGTGGG - Intronic
1079296907 11:19241954-19241976 CAGGTGAGCCGGCCTGGGGCTGG - Intergenic
1079527975 11:21413659-21413681 CAGTTGGGCCACCTTGGAACAGG - Intronic
1081536777 11:44002313-44002335 CAGGTAGGCCAGCTCGGGGTGGG - Intergenic
1081621963 11:44624062-44624084 CAGATGGGACAGCTGGGGGCCGG - Intergenic
1081642325 11:44764713-44764735 CAACGGGGCCACCTTGGTGCAGG + Intronic
1082890978 11:58138255-58138277 CAGCTGGGGCTGCCTGAGGCTGG + Intronic
1083306372 11:61764112-61764134 TAGCTGGGCGAGCTGGGGGTGGG + Intronic
1083325551 11:61871266-61871288 CATCTGCGCCAGTGTGGGGCGGG - Intergenic
1083327605 11:61880894-61880916 CAGCTTGGCCACCTGGGGTCAGG - Intronic
1083373684 11:62202606-62202628 AGGCTGTGCCAGCTTGGGGTGGG - Intergenic
1083672244 11:64305928-64305950 CTGGTGGGCCGGCCTGGGGCAGG + Intronic
1083952985 11:65967034-65967056 GAGCTGGGCAACCTTGGGGAAGG + Intronic
1084189424 11:67492250-67492272 CACCTGGGCCAGCTGGAAGCGGG - Exonic
1084397372 11:68921345-68921367 CACCTTGGCCACCTTGGTGCTGG + Intronic
1084464123 11:69312427-69312449 AAACAGGCCCAGCTTGGGGCGGG + Intronic
1085035653 11:73298272-73298294 CAGCTGGGCCAGCCTCGTGCTGG + Exonic
1085477325 11:76796608-76796630 GTGCAGGGCCACCTTGGGGCTGG - Exonic
1086412153 11:86553702-86553724 CAGCTGAGTGAGCTTGAGGCAGG - Intronic
1088678688 11:112221038-112221060 CAGCTAGGCCTCCTTGGGGCAGG + Intronic
1089322090 11:117633295-117633317 CACCTTGGCCAGCCTGGGTCTGG + Intronic
1089365507 11:117918701-117918723 CAGCTGGGACACCTCCGGGCCGG - Exonic
1089457146 11:118632305-118632327 CACCTGGCCCAGCTTAGTGCTGG + Intronic
1089634632 11:119804325-119804347 CACCAGGGACAGCTTGGGGAGGG - Intergenic
1090247484 11:125226840-125226862 CAGCTGGGCCAGCCTGCAACAGG - Intronic
1091689741 12:2587903-2587925 CAAATGGGCATGCTTGGGGCTGG - Intronic
1091804454 12:3346033-3346055 CAGCTGGGCCCTCGTGGGGTGGG + Intergenic
1091980495 12:4860464-4860486 CAGCTTTGCCCTCTTGGGGCTGG - Intergenic
1092904616 12:13090409-13090431 CAGGTAGGCCCGCTTAGGGCTGG - Intronic
1093296761 12:17400879-17400901 TAGCTGGGATAGCCTGGGGCCGG - Intergenic
1093969981 12:25367274-25367296 CTGTTGGGCCAGTATGGGGCAGG - Intergenic
1095956893 12:47812110-47812132 CTGCTGTGCCAGCTTGGGGAGGG - Intronic
1096245268 12:49981386-49981408 CAGCCAGGCCAGCGTGTGGCAGG + Intronic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096677540 12:53233715-53233737 CAGCTAGGCCACCTGGGGACGGG - Intergenic
1096687127 12:53295628-53295650 CAGCTGGACCAGGTGGGGACGGG + Exonic
1096757078 12:53808610-53808632 CAGCTGGGAAAACTTGGAGCCGG + Intergenic
1096785361 12:54014279-54014301 CAGCTGGGGCAGCTTTGAGCAGG + Intronic
1097188490 12:57208406-57208428 CAGCTGGGCCTGCTTGGGCAGGG + Intronic
1098050282 12:66445823-66445845 CAGCTGGGGAACCTTGGGGTAGG + Intronic
1098140098 12:67442517-67442539 CAGCTTTGCCAGCCTGGAGCCGG + Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1101587921 12:106101164-106101186 CAGCAGGGGCAGGTAGGGGCAGG + Intronic
1101700483 12:107169296-107169318 GCCCTGGGCCAGCTGGGGGCGGG + Intergenic
1102046133 12:109831546-109831568 CACCTGTGCCAGCTCTGGGCTGG - Intronic
1102171029 12:110842653-110842675 CCGCTGGGAGAACTTGGGGCAGG - Intergenic
1102797960 12:115705675-115705697 CTTCTGGGTCAGCTTGGAGCTGG - Intergenic
1103366132 12:120384788-120384810 CAGCTGGGACAGCTGCAGGCAGG - Intergenic
1103459188 12:121090145-121090167 CTGCAGGCCCAGCCTGGGGCCGG + Intergenic
1103913064 12:124362676-124362698 CAGCTGGGCCAGGTTCTGGGAGG - Intronic
1103913108 12:124362823-124362845 CAGCTGGGCCAGGTTCTGGGAGG - Intronic
1104945781 12:132414356-132414378 CAGCTGGGACAGGGTGTGGCGGG - Intergenic
1105407059 13:20142007-20142029 CAGCAGGGCCAGCAGCGGGCGGG - Exonic
1105855269 13:24366276-24366298 GAGCCTGGCCAGCTTGGTGCCGG - Intergenic
1106328238 13:28715338-28715360 CAGCTGGGCCAGGCTGGAGGTGG + Intronic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1108130759 13:47297637-47297659 CACCAGGGCCAGTTTGGGGTAGG + Intergenic
1110710032 13:78640569-78640591 CAGGTGGGCCAGCTGAGGTCAGG + Intronic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1111602604 13:90494101-90494123 CTGCTGTGCCAACTTGGGGAAGG + Intergenic
1111798138 13:92949550-92949572 GAGCTGGGACAGCTGGGGCCAGG - Intergenic
1113543006 13:111123390-111123412 CAGCTGTGCCTGCTCTGGGCAGG - Intronic
1113789742 13:113022043-113022065 CAGCAGGGCAGCCTTGGGGCAGG - Intronic
1114332559 14:21652128-21652150 CTGCTGGGCCAGCTGGGAGAGGG + Intergenic
1114540153 14:23449408-23449430 CAGTTGGGCCAGCTTATGGAGGG - Intergenic
1115481238 14:33863176-33863198 CTGGTGGGTCAGCTGGGGGCTGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116096248 14:40373027-40373049 CAGCTTGCTCAGCCTGGGGCTGG + Intergenic
1117929974 14:60831333-60831355 CACCAGGGCCTGCTGGGGGCAGG - Intronic
1118456090 14:65946746-65946768 CAGGTGGGACAGAATGGGGCAGG + Intergenic
1119128321 14:72149024-72149046 CAGCTGGGGGAGCCTGAGGCTGG + Intronic
1121111090 14:91313638-91313660 CATCTGTGCCAGCTTGGTGCTGG + Exonic
1121231688 14:92363246-92363268 CAACCAGGTCAGCTTGGGGCTGG + Intronic
1121664325 14:95660410-95660432 CAGCTGGGGCTGGATGGGGCTGG - Intergenic
1121974890 14:98393789-98393811 CAGCTTTGCCAGCCTGTGGCTGG - Intergenic
1122129276 14:99595765-99595787 CAGCAGGGGCAGGGTGGGGCTGG - Intronic
1122235103 14:100326980-100327002 CAGCTGGGCTGGGTTGGGCCTGG + Intronic
1122417480 14:101557369-101557391 CATCTGGGCCAGCCTGGGAGGGG + Intergenic
1122635977 14:103129864-103129886 CACCTGGGCCAGGGAGGGGCAGG + Intronic
1122693191 14:103541144-103541166 ATGCTGGGCCAGCTGTGGGCGGG + Intergenic
1122881237 14:104691357-104691379 CAGCTGGCCCAGCTCTGGACGGG + Intronic
1123449688 15:20351916-20351938 CACCTTGGCCATCTGGGGGCAGG - Intergenic
1125403866 15:39332884-39332906 CAGCTGGGCCAGCCGTGGGCAGG - Intergenic
1127643170 15:60934239-60934261 CCACTGGGCCAGCATAGGGCAGG - Intronic
1127868284 15:63048838-63048860 CACCTGGGCCAGCTGGCGGCGGG + Intronic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128314966 15:66654671-66654693 CAGCAGGACCAGCTCAGGGCTGG + Intronic
1128544514 15:68558126-68558148 GAGCTGGGCCAGCCTGGCGGAGG + Intergenic
1128667370 15:69548262-69548284 CAGAAGAGCCAGCTTGGGCCAGG + Intergenic
1128688189 15:69702795-69702817 CATCTGGCCCAGTCTGGGGCTGG - Intergenic
1128766024 15:70251674-70251696 CAGCTGGGGCACTTGGGGGCAGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129171798 15:73812417-73812439 CAGATGAGCCAGCCTGGGCCAGG + Intergenic
1129238137 15:74236089-74236111 CAGCTTGAGCAGCATGGGGCTGG + Intergenic
1129520119 15:76180543-76180565 CGGCTGGGGCAGCGTGGGTCAGG + Intronic
1131179505 15:90230368-90230390 AAGCTGGCCCAGCCTGGAGCTGG - Exonic
1131559909 15:93430633-93430655 TTGCTGGTCCAACTTGGGGCTGG + Intergenic
1132582049 16:689296-689318 CAGCTGGTCCTGCTTGTTGCGGG + Exonic
1132598350 16:763201-763223 CAGAGGGGACAGCTTGGGGGAGG - Intronic
1132694502 16:1195863-1195885 CAGGTGGTCCAGGGTGGGGCTGG - Intronic
1132731774 16:1366430-1366452 CAGCTGGCCCAGCCTGGGCAGGG - Intronic
1133087090 16:3373310-3373332 AAGTGGGACCAGCTTGGGGCTGG + Intronic
1133203284 16:4217814-4217836 CAGCAGAGCCAGCTTCGGACAGG + Intronic
1133322908 16:4925235-4925257 CTGGAGGGCCAGCTTGGGGGAGG + Intronic
1133924694 16:10183001-10183023 CTGCTGGGCCAGCTCCGCGCCGG + Intergenic
1133972249 16:10576867-10576889 ATGCTGGCCCATCTTGGGGCGGG - Intronic
1134062862 16:11209596-11209618 CAGATGGGACAGCTGGGGTCTGG + Intergenic
1134490866 16:14694349-14694371 AAGCAGAGCCAGCTAGGGGCGGG + Exonic
1134496247 16:14733467-14733489 AAGCAGAGCCAGCTAGGGGCGGG + Intronic
1135056413 16:19235600-19235622 CATCTGGGCCATCTTGTGGTTGG - Intronic
1136188010 16:28599455-28599477 AAGCTGGACCAGGCTGGGGCCGG + Intergenic
1136190482 16:28612449-28612471 AAGCTGGACCAGGCTGGGGCCGG + Intronic
1137499260 16:48997842-48997864 CAGCTGGCCCAGGCTGGGGGTGG - Intergenic
1138122693 16:54413215-54413237 CTGCTGGGCCAGTCTGGGGCAGG + Intergenic
1138219827 16:55241189-55241211 CAGCTGGGGCAGCTTTAGGCTGG + Intergenic
1138318461 16:56090533-56090555 CAGGTGGGACAGGTTGAGGCAGG - Intergenic
1138453466 16:57107156-57107178 CAGCTGTGCCAAGTTGGGGTGGG - Intronic
1139523524 16:67499159-67499181 GAGCAGGGCCAGGTTGGGGAGGG - Intergenic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1139644369 16:68317404-68317426 CAGATGAGCCAGATTGTGGCTGG + Intronic
1140480709 16:75261465-75261487 CAGTCGGGCCAGCACGGGGCAGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141184707 16:81779194-81779216 CGGCTGGGCGCGCCTGGGGCGGG + Intronic
1141475717 16:84271835-84271857 CAGAAGGACCAGCTTTGGGCTGG + Intergenic
1141671899 16:85496529-85496551 CAGCCAGGCCAGCTGTGGGCAGG + Intergenic
1141749445 16:85948381-85948403 CACCTGGGCCAGCTTCTGGCCGG - Intergenic
1141813846 16:86395780-86395802 CAGCTGGGAGATCTTGGTGCTGG + Intergenic
1141956565 16:87375888-87375910 CGGCAGGGGCAGCTTGGAGCTGG - Intronic
1142263128 16:89051718-89051740 CAGGTGGGCCAGCGTGGAGCTGG - Intergenic
1142277916 16:89132656-89132678 GGGCTGGGGCAGCTTGGAGCGGG - Intronic
1142499997 17:326939-326961 GCCCTGGGGCAGCTTGGGGCTGG + Intronic
1142693469 17:1620814-1620836 CACCTGGGCCACCGTGGGTCAGG + Intronic
1143335523 17:6169160-6169182 CAGCTGGGACAGTTTAGGGCAGG - Intergenic
1144696183 17:17305354-17305376 ATACTGGGCCAGCTTGGGGTAGG - Intronic
1144802098 17:17936356-17936378 AACCTGGCCCAGGTTGGGGCAGG - Intronic
1145023171 17:19447725-19447747 GAGCTGTGCTAGCTTGGGACAGG + Intergenic
1145190949 17:20841967-20841989 GAGCTTGGCCATCCTGGGGCAGG + Intronic
1145261068 17:21355175-21355197 CAGCTGGGCCGGCTGGGGAAGGG - Intergenic
1146062046 17:29612777-29612799 CAGCAGAGCCTGCTTGAGGCGGG + Exonic
1146161983 17:30565011-30565033 GATCTTGGCCACCTTGGGGCAGG - Intergenic
1146225409 17:31061957-31061979 CAGCTGGGCCAGCTGTGGCTGGG - Intergenic
1147585961 17:41654223-41654245 CAGCTGAGCCAGCTCAGCGCTGG - Intergenic
1148049787 17:44764171-44764193 CATCTGAGCCAGCTAGGGGAGGG + Intronic
1148111193 17:45145334-45145356 CAGCAGGGCCACCTTGGTGGGGG + Intergenic
1149614444 17:57987282-57987304 CAGCCGGGCCGGCCCGGGGCAGG - Intronic
1150280986 17:63929530-63929552 CTGCTGGGCCAGGCTGGGGAGGG + Intronic
1151277117 17:73043518-73043540 CAGCTTAGCCAGCATGGAGCAGG + Intronic
1151562244 17:74876916-74876938 GAGCTGCCCCAGCTGGGGGCTGG - Intergenic
1151655961 17:75496131-75496153 CAGATGGGCCTGCGTGGGGCTGG + Intronic
1151759017 17:76090242-76090264 CAGCTGGGCCAGGCAGGAGCAGG + Intronic
1151821284 17:76498251-76498273 CAGCTGAGCCAGGCTGGGGGAGG - Intronic
1151894728 17:76972306-76972328 CATCTGACCCAGCCTGGGGCAGG - Intergenic
1151977283 17:77489964-77489986 CAGCTGGGCAAGCCGAGGGCGGG + Intronic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1152252848 17:79220778-79220800 CTGCTGCTCCAACTTGGGGCTGG - Intronic
1152368615 17:79871406-79871428 CTGCTGGGCCAGCCCGGGGGAGG + Intergenic
1152613110 17:81325272-81325294 CAGCTAAGCCTCCTTGGGGCAGG - Intronic
1152811019 17:82382925-82382947 CACCTGGGTCAGGGTGGGGCCGG - Intergenic
1156036366 18:32771139-32771161 CAGTTGGCCCAGTTTGGGGGAGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157294497 18:46433098-46433120 CACCCGGGGCAGCCTGGGGCTGG - Intronic
1159837188 18:73352611-73352633 CTGCTGGGCCAGAATGGGGGAGG + Intergenic
1160024652 18:75208194-75208216 CAGCTGGGCCAGGGTCGGGGTGG - Intronic
1160222996 18:76990824-76990846 CACCTGGGGCAGCTACGGGCTGG + Intronic
1160498976 18:79393257-79393279 CAGGTGCGCCAGCCAGGGGCAGG - Intergenic
1160525255 18:79532104-79532126 CTGCTGGGGAAGCTAGGGGCAGG - Intergenic
1160583264 18:79899683-79899705 CTGCAGGGCCGGCTCGGGGCTGG - Exonic
1160995255 19:1879456-1879478 GAGCTTGGCCATCCTGGGGCAGG - Intronic
1161312037 19:3600169-3600191 CGCCTGGGCCACCGTGGGGCTGG - Exonic
1161314842 19:3613002-3613024 CAGTGGGGCGAGCTGGGGGCGGG - Intronic
1161457170 19:4375228-4375250 CAGCTGGGCCAGGTGGGGGCTGG - Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1162465171 19:10835484-10835506 CCACTGGGACAGGTTGGGGCGGG - Intronic
1162733213 19:12731324-12731346 GAGGTGAGCCAGCTTGGTGCAGG - Exonic
1162930270 19:13954007-13954029 CAGGTGGCCCAGCGTGGGACAGG + Intronic
1163268225 19:16234108-16234130 CTGCTGGGGCAGCCTGGGGCTGG - Intronic
1163585230 19:18160369-18160391 CAGCTGGGGCAGTTTGAGGCAGG - Intronic
1163770286 19:19186896-19186918 GTGCTGGGCCAGCTCGGGGAGGG + Exonic
1164543845 19:29142726-29142748 CAGCTGGATCAGGTGGGGGCGGG + Intergenic
1165060271 19:33201724-33201746 CAGATGGACCAGCGTGGGGAAGG + Intronic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1166054267 19:40279279-40279301 CAGCCTGGCCCCCTTGGGGCAGG - Intronic
1166193703 19:41193201-41193223 CGGCTGGGCTAGTTAGGGGCGGG - Exonic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1166985767 19:46659468-46659490 AAGCCGAGCCAGCTTGGGGTGGG + Intronic
1167357654 19:49014135-49014157 CAGCGGGGCCAGCCCAGGGCTGG - Intronic
1167722818 19:51190564-51190586 CAGTGGGGCCAGGTTGAGGCGGG - Intergenic
1167743281 19:51337404-51337426 CAGATGGGCCTGCTCTGGGCAGG - Exonic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
1202713733 1_KI270714v1_random:30927-30949 CAGCTGGGCCTGCTTGAGTGAGG + Intergenic
925379367 2:3414543-3414565 CAGCGGGGACAGCTGGGGGATGG - Intronic
925898185 2:8489078-8489100 CAGCTGGGCCACCCTAGGGAAGG + Intergenic
925908827 2:8558002-8558024 TAGCTGTGCCAGCTTGGGGAAGG - Intergenic
926153151 2:10435629-10435651 AGGCTGGGCCAGCTCGGGGGTGG - Intergenic
926170002 2:10547166-10547188 CAGCTGGGCCACTCAGGGGCTGG + Intergenic
927515180 2:23668089-23668111 CAGTTGGGCCAGCTGGGTGCGGG - Intronic
927787071 2:25981699-25981721 CAGGTCGGCCTGCTTGGAGCTGG + Exonic
928279179 2:29929246-29929268 CAGCTGGGCCAGCAAGGTACTGG - Intergenic
929385360 2:41400263-41400285 CGTCTGGGCCAGCAGGGGGCAGG - Intergenic
929575824 2:43051080-43051102 CAGCTGGTCCTGCCTGGGCCTGG - Intergenic
929799198 2:45085021-45085043 CAGCTGGGCCAGTATGTGGAAGG + Intergenic
932586898 2:73036153-73036175 GAGCAGGGCCAGCCTGGGCCAGG + Intronic
932606487 2:73169196-73169218 CAGGTGGGCCAGCCCGGGGTCGG + Intergenic
932756689 2:74414618-74414640 CTGCTGGGCGAGCTGTGGGCTGG - Exonic
932868190 2:75369045-75369067 CACCTGGGCCAGTTAGGGGGTGG - Intergenic
933433567 2:82215400-82215422 GTGCTGGGCCCGCTTGGGTCTGG - Intergenic
933726670 2:85431018-85431040 CTCCTCGGCCAGGTTGGGGCAGG + Intronic
933925941 2:87091235-87091257 CAGGTGGGCCAGCCCGGGGTCGG - Intergenic
934080955 2:88467404-88467426 CAGGTGGGCCACCTGGGGTCAGG + Intergenic
934561938 2:95317996-95318018 CAGAAGGGACAGCTTTGGGCCGG + Intronic
934704981 2:96470917-96470939 CAGCGGTGCCAGCCTGAGGCAGG + Intergenic
935020420 2:99224995-99225017 CATCTGGGTCATCTTGGGGTTGG + Intronic
935815978 2:106846019-106846041 CGGCTGGAACAGCTTGGGGCTGG - Intronic
936047807 2:109200641-109200663 CAGCTTGGCCAGGTAGGGGTGGG - Intronic
936695541 2:114943055-114943077 CACCTGGGCCTGCTGGGGGGTGG - Intronic
937239650 2:120451900-120451922 CAGCAGGGCTAGCGTGGGCCTGG + Intergenic
938378626 2:130824340-130824362 GAGCTGGGACAGCTAGGCGCTGG - Intergenic
938402321 2:131004090-131004112 AAGCTGGGCCAGTGTGGTGCAGG + Intronic
938985487 2:136571343-136571365 CTGTTGGGCCAGATTTGGGCAGG - Intergenic
941994723 2:171591475-171591497 CAGGTGGGTCAGGTTGGGCCTGG + Intergenic
942171943 2:173297814-173297836 CAGGTGGCCCAGCTTGGTGACGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
945245317 2:207711934-207711956 GCGCCGGCCCAGCTTGGGGCTGG - Exonic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
946389874 2:219408892-219408914 CAGCTGCTCCAGCTGGGGGAAGG + Intergenic
947577148 2:231284769-231284791 CACTGGGGCCACCTTGGGGCTGG + Intronic
947585986 2:231357290-231357312 CAGCCGGTCCATCTGGGGGCTGG - Intronic
947713730 2:232329872-232329894 CAGCAGGGCCTGCTCGGGGAAGG - Exonic
947714165 2:232331535-232331557 CATCAGGGCCTGCTTGGGCCTGG + Intronic
947733375 2:232442914-232442936 CATCAGGGCCTGCTTGGGCCTGG + Intergenic
948839505 2:240642140-240642162 CAGCAGGGCCCGCTTGGGCCAGG - Intergenic
1169068489 20:2707674-2707696 GAGCTGGCTCTGCTTGGGGCAGG - Intronic
1169277876 20:4245749-4245771 CAGCTGGGCAAGGCTGGAGCAGG + Intronic
1169346222 20:4829960-4829982 CAGCTGGGCCCACTTGGCTCTGG - Intergenic
1169498813 20:6139658-6139680 CACCGGGGCCTGCTGGGGGCTGG - Intergenic
1170178670 20:13502921-13502943 GAGCTGTGCCACCTTGGGGGAGG - Intronic
1170627529 20:18041073-18041095 CAGCTGTGTCACCTTGGGCCAGG - Intronic
1170817058 20:19722314-19722336 CAGCTGGGCCGGCTTGGCGGAGG - Exonic
1170883468 20:20317916-20317938 CAGCTGGGGCTGCTAGTGGCTGG - Intronic
1170900370 20:20456678-20456700 TAGCTGGAACAGCTTGGGGCTGG - Intronic
1171200236 20:23234824-23234846 CTGTTGGGCCAGCTGAGGGCTGG + Intergenic
1171374255 20:24681387-24681409 CTGCTGTGCCAGCTGGGTGCAGG - Intergenic
1171725874 20:28620545-28620567 AAGCTGGCCCTGCTTGGGGCTGG - Intergenic
1171782392 20:29430831-29430853 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
1171790072 20:29515030-29515052 AAGCTGGCCTCGCTTGGGGCTGG - Intergenic
1171857637 20:30361815-30361837 AAGCTGGCCTCGCTTGGGGCTGG + Intergenic
1172014223 20:31863409-31863431 CAGCAGAGCCAGCTTGAGCCTGG + Intronic
1172336704 20:34122600-34122622 CAGGTGGCCCAGCTTGGTGACGG - Intergenic
1172696876 20:36829013-36829035 CAGCAGGGCCAGCCTAGGGCAGG - Intronic
1172930227 20:38581213-38581235 AAGCTGGGCCAGCCTGGGCTGGG - Exonic
1173190993 20:40875446-40875468 CAGCTGGGCCAGCTCTGGACCGG - Intergenic
1173249524 20:41357287-41357309 CTGGTGGGCCATCCTGGGGCTGG + Intronic
1174076432 20:47940765-47940787 CAGCTGGGCGACCTTGGTCCAGG + Intergenic
1174188925 20:48726178-48726200 CAGCAGTGTCAGCTTTGGGCCGG - Intronic
1174481090 20:50832027-50832049 CAGCTGGGCCAGCCCAGGCCAGG - Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1174781252 20:53391050-53391072 CAGCTGGGCCAGATTTGTCCTGG + Intronic
1175172962 20:57092795-57092817 CAGCTGGGCCTGCGTGGAGGAGG - Intergenic
1175317221 20:58057117-58057139 CACCTGGGCCAGCTGGTGACAGG + Intergenic
1175399495 20:58692639-58692661 CGGCAGGGCCTGCTCGGGGCCGG + Exonic
1175701488 20:61140832-61140854 CAGGGGGGCCAGCTTGGGGGTGG + Intergenic
1176419040 21:6499447-6499469 CAGCAGGGCCAGCGCCGGGCGGG - Intergenic
1178971028 21:37177030-37177052 CAGCTGGTCCTGCTTGGGCTCGG + Intronic
1179182887 21:39060904-39060926 CAGCAGGACCAGCTGGGGACAGG - Intergenic
1179694533 21:43107769-43107791 CAGCAGGGCCAGCGCCGGGCGGG - Intergenic
1180022621 21:45137925-45137947 AGGCTGGGCCTGCTGGGGGCAGG + Intronic
1180090581 21:45531819-45531841 CAGCTGGCCCAGCACGGAGCTGG + Exonic
1180235365 21:46456211-46456233 GAGCTGGGAAAGTTTGGGGCTGG - Intergenic
1180390773 22:12280151-12280173 AAGCTGGCCTCGCTTGGGGCTGG - Intergenic
1180698955 22:17771426-17771448 CAGCTTGGCCAGGGTGGGGGTGG - Intronic
1181121332 22:20669996-20670018 GAGCTTGGCCATCCTGGGGCAGG - Intergenic
1181334289 22:22117021-22117043 GAGCTTGGCCATCCTGGGGCAGG - Intergenic
1181434501 22:22902508-22902530 GAGCTGGGCCAGGCTGGGTCAGG + Intergenic
1182103407 22:27672594-27672616 GAGCTGGGCCAGGGTGGGGTGGG - Intergenic
1182153462 22:28047702-28047724 CACCTGGGCCTGCTTTGGGCTGG - Intronic
1182175429 22:28281553-28281575 CATCTGGGTTATCTTGGGGCTGG + Intronic
1182442434 22:30372220-30372242 CTGCTGGGCCAGCACGGAGCTGG + Exonic
1182518090 22:30870250-30870272 AGGCTGGGCCAGGATGGGGCAGG + Intronic
1183467381 22:37986524-37986546 CAGCTGTGCCAGGATGGGGGTGG + Intronic
1183988647 22:41583574-41583596 AAGTTGGGGCAGCCTGGGGCTGG + Intronic
1184033285 22:41907023-41907045 CAGCAGGGCCACCTTGATGCAGG + Exonic
1184091875 22:42297170-42297192 CAGCTGGGCGACCTTGGGCAAGG + Intronic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184769564 22:46589433-46589455 CAGATGGCCCAGTGTGGGGCTGG + Intronic
1185081475 22:48711795-48711817 CAGCTGGGCAGGCTGGGAGCGGG - Intronic
1185314150 22:50171503-50171525 CAGGGGGGCTAGCATGGGGCAGG + Intronic
1185322620 22:50208955-50208977 CTGCAGGGCCAGCTTGGGGCGGG + Intronic
1185340865 22:50290535-50290557 CTGCTGGGCCTGCTGGGCGCAGG - Exonic
1185399447 22:50608348-50608370 CAGCGGGGCCAGCTCTGGGGTGG + Intronic
1185399492 22:50608514-50608536 CAGCGGGGCCAGCTCTGGGGTGG + Intronic
1185402874 22:50627618-50627640 CAGCTGGTCCAGGTTGGGAGTGG + Exonic
950017668 3:9765715-9765737 AGGCAGGGTCAGCTTGGGGCAGG + Intronic
950422204 3:12905802-12905824 CAGCTTGGCCAGGGAGGGGCAGG + Intronic
950437228 3:12987203-12987225 CAGCTGGTCCTGCTGGGGGCGGG + Intronic
950568184 3:13783821-13783843 TCGCTGGGCTGGCTTGGGGCAGG + Intergenic
950789388 3:15460487-15460509 CATCTGGGGCAGCCAGGGGCTGG + Intronic
951269369 3:20606496-20606518 GGGCTGTGCCAGCTTGGGACAGG - Intergenic
951424062 3:22521305-22521327 CACCAGGGCCAGCTGGGGGAGGG + Intergenic
951827836 3:26888041-26888063 CAGCTGGGCCTGCTGGAGGGTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953412246 3:42697134-42697156 AGGCTAGGCCAGCTGGGGGCAGG + Exonic
953626020 3:44572201-44572223 CAGCTGGTCCAGCTGGGGAGGGG - Intronic
954659347 3:52218699-52218721 GAGCTGGGCCAGGGTGGGGCTGG - Intergenic
954765589 3:52912985-52913007 CAGCTGAGCCTTCTTGTGGCTGG + Intronic
954787398 3:53104041-53104063 CAGCAGGGCCAGCTTGAGCAGGG + Exonic
954806418 3:53223548-53223570 CAGCTGAGCCTGATAGGGGCGGG - Intergenic
954876072 3:53803949-53803971 CGGCTTGGCCAGCCTGGAGCTGG + Intronic
955626158 3:60921802-60921824 CATCTGGGGCAGCTTAGGGAAGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956308759 3:67855842-67855864 CAGCTGGGGCAGCTTGTTGAAGG + Intergenic
956542523 3:70357571-70357593 CACCAGGGCCTGCTGGGGGCTGG + Intergenic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
960592313 3:119378217-119378239 CAGCTGGGGCAACTGGGGGATGG - Intronic
961396672 3:126598174-126598196 TAGCTGGGCCTGCTTGTGGTGGG - Intronic
961440818 3:126952281-126952303 CAGCTGGACCAGCTGGGTGTTGG + Intronic
962386663 3:134937584-134937606 ATGATGGGCCAGCTTGAGGCTGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963263509 3:143216297-143216319 TAGTTGGTCCAGCTTGGGTCAGG - Intergenic
963939885 3:151087080-151087102 CCGCTGGGCCAACTTGGCCCCGG - Intronic
965176846 3:165345876-165345898 AAGCTGGGCCAGATTTGTGCAGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
965695423 3:171403137-171403159 CAGATAGTCCAGCCTGGGGCTGG + Intronic
965993135 3:174845288-174845310 CAGGTGGGCCACCTCTGGGCTGG + Intronic
968574221 4:1357514-1357536 CAGCTCGGCCTGCTTGGGTGAGG + Intronic
968656405 4:1780187-1780209 CAGCTGGGCCCCCGAGGGGCAGG - Intergenic
968911460 4:3478768-3478790 CAGCAGGGCCTGCTGGGGACAGG - Intronic
969116090 4:4871656-4871678 CGGCTGTGCCAGCCCGGGGCGGG + Intergenic
969296987 4:6276040-6276062 GCGCTGCGGCAGCTTGGGGCTGG + Intronic
969457340 4:7307530-7307552 CAGCAGAGCCAGGCTGGGGCAGG + Intronic
969527798 4:7712851-7712873 CAGGTGGGCCGGCATGAGGCTGG + Exonic
969681971 4:8648224-8648246 CACCTGGGCCAGCTGAGGACAGG - Intergenic
971158340 4:24106804-24106826 CTGGTGGGTCAGCTGGGGGCTGG - Intergenic
971372418 4:26029307-26029329 CAGCAGGGCCAGCCTGGGGAGGG - Intergenic
971457899 4:26861169-26861191 CTCCTGGCCCAGCGTGGGGCTGG + Exonic
971470864 4:27025003-27025025 GAGCAGGACCAGCTGGGGGCCGG + Intronic
971792333 4:31185104-31185126 CAGCTGCCCCACCATGGGGCAGG - Intergenic
971999959 4:34019107-34019129 CACCTGGGCCAGTTGGGGGTAGG - Intergenic
977654686 4:99507063-99507085 GAGCTGTGCCAACTTGGGGGAGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
980152494 4:129063942-129063964 GAGCTGTGCCATCTTGGGGCAGG + Intronic
980404999 4:132344640-132344662 CAGCTGGATCAGTTTGTGGCGGG - Intergenic
980824456 4:138057029-138057051 CAGCTGGGACAGATAGAGGCAGG + Intergenic
984253783 4:177365980-177366002 CATCTGGGCCATCTTAGGGTGGG - Intergenic
984724804 4:183010264-183010286 CTGCTGGTCCTGCTAGGGGCAGG - Intergenic
985434682 4:189917250-189917272 GAGCTGGCCCCGCTTGGGGCTGG + Intergenic
985448445 4:190041353-190041375 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
986177562 5:5365002-5365024 CAGCGGGGGCTGCTGGGGGCAGG + Intergenic
986302734 5:6491009-6491031 CAGATAGGGCAGCCTGGGGCTGG - Intronic
986830350 5:11570224-11570246 CAGCCAGGCCAGATTGGAGCAGG - Intronic
986856410 5:11873859-11873881 CAGCTGGTCCCGCTTTGGGATGG - Intronic
987171499 5:15263827-15263849 GAGCTGTGCCAGCTTGGGGGAGG - Intergenic
988999533 5:36745573-36745595 CAGGTGGCCCAGCTTGGGGTGGG + Intergenic
990439510 5:55830654-55830676 CTGCTGTGCCATCCTGGGGCAGG + Intergenic
992105526 5:73447240-73447262 CATCGGGGGCAGCTTGGGCCCGG - Exonic
992230153 5:74656069-74656091 AAGCTGGGCCACCTTGGGGTTGG + Intronic
992379957 5:76227246-76227268 CAGCTGGGCCAGCTCCTTGCAGG + Intronic
993173422 5:84451447-84451469 GTGCTGTGCCAGCTTGGGGAGGG - Intergenic
994279537 5:97885417-97885439 GTGCTGTGCCAGCCTGGGGCAGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995106300 5:108381193-108381215 CTTCCTGGCCAGCTTGGGGCCGG - Exonic
995132499 5:108645193-108645215 CAGCTGGGCAAGATAGGGTCAGG - Intergenic
998204063 5:140146533-140146555 GCGCGCGGCCAGCTTGGGGCCGG - Intergenic
998208436 5:140175702-140175724 GAGCTGGGCCAGCCGGGGGCAGG + Intronic
998415298 5:141941592-141941614 CAGCAGGGCCAGCCTGGGTCAGG + Exonic
998464120 5:142329477-142329499 CAGCTGTTTCAGCTTTGGGCTGG + Intergenic
998674811 5:144395527-144395549 CAGCTGGGCCAGCTGCCTGCAGG + Intronic
999246543 5:150158005-150158027 CAGCCAGGCCAGCCTGGGGGAGG + Intergenic
999270728 5:150295049-150295071 CAGCTAGGCAAGCTCTGGGCTGG + Intergenic
999875582 5:155802074-155802096 CATCTGACCCAGCTTGGGTCAGG - Intergenic
1003612493 6:7626357-7626379 CAGCTGGGCGAGCGGTGGGCTGG + Intergenic
1003852850 6:10242562-10242584 CAGTTTGCCCAGCTTTGGGCAGG - Intergenic
1004753404 6:18586300-18586322 CAGCTGGTCCAGCTTTTGACTGG + Intergenic
1006912983 6:37576084-37576106 GGGCTGGGCCAGGCTGGGGCTGG + Intergenic
1007752409 6:44078354-44078376 CAGGTGGGGCAGCTGTGGGCAGG + Intergenic
1008491159 6:52088603-52088625 GTGCTTGGCCAGATTGGGGCAGG + Intergenic
1010177908 6:73051191-73051213 CAGCAGTGGCAGCGTGGGGCAGG - Intronic
1010202968 6:73299178-73299200 CAGCTGGACCAGCACGGGGGAGG + Intronic
1011603586 6:89081373-89081395 CAGCGGGGCAAGGTCGGGGCTGG - Exonic
1013292726 6:108732766-108732788 CATCTGGGCGGGCCTGGGGCTGG + Intergenic
1016449956 6:144172313-144172335 GAGGTGGGTCAGCTGGGGGCTGG + Intronic
1016969623 6:149749985-149750007 CAGCTGGGGCAGGCTGGGCCTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018712205 6:166505254-166505276 TAGCTGGGACAGCTCAGGGCTGG + Intronic
1019036420 6:169063338-169063360 GAGCTGTGCCAGCCTGGGGATGG + Intergenic
1019564145 7:1671228-1671250 CAGCTGTGTGACCTTGGGGCAGG + Intergenic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1019621146 7:1992673-1992695 CTGCTGGGGGAGCTTGGGGAAGG + Intronic
1019978400 7:4603070-4603092 AAGCTGGGTCAGCACGGGGCAGG - Intergenic
1020088457 7:5324104-5324126 GGGCTGGGCTAGCTGGGGGCAGG - Intronic
1020115768 7:5475564-5475586 CAGCTGAGACAGCCTTGGGCTGG - Intronic
1021891966 7:25194887-25194909 CAACAGTGCCAGCTTGGGGCAGG + Intergenic
1022926116 7:35057716-35057738 CAGCTGTGACAGCTGGTGGCGGG - Intergenic
1023494234 7:40777647-40777669 AAGCTGGGTCTGCTTGGGACTGG + Intronic
1023852433 7:44157893-44157915 GAGCAGGGGCATCTTGGGGCAGG + Intronic
1023905086 7:44516267-44516289 CACCAGGACCAGCGTGGGGCAGG + Intronic
1024109723 7:46133115-46133137 CAGCAGGGACAGCCTAGGGCAGG - Intergenic
1024245906 7:47470572-47470594 CAGGTGGGCCAGGTCAGGGCTGG - Intronic
1024283956 7:47741244-47741266 CTGCTGGGGCAGTTTGGGGCGGG - Intronic
1024555907 7:50603533-50603555 CACCTGGGCCAGCTTGGCTGGGG - Intronic
1025976734 7:66376568-66376590 CAGAGGGGCCAGCGTGAGGCAGG + Intronic
1026022289 7:66718406-66718428 CATCTGTGCCATCTTGGGGTTGG + Intronic
1027050412 7:75018116-75018138 AAGCTGGGTGAGCTGGGGGCGGG + Exonic
1028920445 7:96304832-96304854 CAGCTTTCCCTGCTTGGGGCAGG - Intronic
1029382632 7:100223554-100223576 AAGCTGGGTGAGCTGGGGGCGGG - Exonic
1029581959 7:101442253-101442275 AAGCTGGGCCTGCTTTCGGCTGG + Intronic
1029954133 7:104619856-104619878 CAGGTGGGGCAGCAGGGGGCGGG + Intronic
1032717306 7:134520607-134520629 CACCGGGGCCTGCTGGGGGCTGG + Intergenic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1034182208 7:149147658-149147680 CGGCCGGGCCTGCTTGGAGCCGG + Exonic
1034256246 7:149726063-149726085 GAGCTGGGCCAGCCCGAGGCTGG + Intronic
1034259931 7:149748687-149748709 CAACTGGCCCAGCTTGGGCTGGG + Intergenic
1034279472 7:149842723-149842745 CAGCCTGTCCAGATTGGGGCAGG - Intronic
1034336946 7:150329996-150330018 CAGCTGCCCCAGCCTGGAGCAGG + Exonic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1035334013 7:158114112-158114134 CAGCTGGTCCAGTTTGGGAGTGG + Intronic
1035720701 8:1789465-1789487 CAGTGAGGCCAGCTTGGGGCAGG - Intergenic
1035957981 8:4104022-4104044 CAGAAGGGCCAGGCTGGGGCAGG - Intronic
1036683274 8:10891667-10891689 GTGATGGGCCAGCCTGGGGCAGG + Intergenic
1036758236 8:11486107-11486129 GAGCTGTGCCAGCTTGGGATTGG - Intergenic
1037531922 8:19784687-19784709 CAGCAGGGCCTGTTGGGGGCTGG + Intergenic
1037581251 8:20247157-20247179 CATCTGGGCCGGCCTGGGACAGG + Exonic
1038205227 8:25458808-25458830 TAGCTGGGCCGGCTTGTGGGCGG - Intergenic
1040059921 8:43095100-43095122 CAGCGTGGTCAGCTAGGGGCTGG - Intronic
1041632945 8:60108652-60108674 CAGCAGAGCAAGCCTGGGGCAGG + Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1047262587 8:123275205-123275227 CAGCGGGGCCAGCGAGGGCCAGG + Intronic
1048571403 8:135660004-135660026 CTTCTGGGGCAGCTTGGGGCTGG - Intergenic
1048999599 8:139816308-139816330 CAGCTGGGCCAGCCAGATGCTGG + Intronic
1049351209 8:142165748-142165770 CGGCAGGGCCAGCCTGGGGCTGG - Intergenic
1049372384 8:142274015-142274037 CCCCTGGGCCAGCTGGGGCCAGG - Intronic
1049601547 8:143510013-143510035 CAGGAGGGGCAGCTTGGGGCAGG + Intronic
1049602813 8:143515764-143515786 CAGCTGGGCCAGGCAGGGGCTGG + Intronic
1049682672 8:143926610-143926632 CAGGTGGGGCAGCCTGGGGCAGG + Intronic
1049687909 8:143946340-143946362 CAGCTGGGCCAAGGTAGGGCAGG - Intronic
1049778682 8:144417762-144417784 CACCTGGCCGAGCTTGGGTCAGG + Intergenic
1051694802 9:19756574-19756596 CAGCTGGGCCATGCTGGGCCTGG - Intronic
1052830597 9:33212179-33212201 CAGTTAGGCCAGGTTGGGGAAGG + Intergenic
1052843165 9:33311036-33311058 CAGCTGGGACAGCTTTGTTCGGG + Intronic
1053072708 9:35110642-35110664 CAGCTGTGCCAGGCTGTGGCTGG + Exonic
1053169007 9:35865083-35865105 CAGCAGGGCCCTCCTGGGGCAGG - Intergenic
1053723737 9:40975323-40975345 AAGCTGGCCCCGCTTGGGGCTGG + Intergenic
1054342223 9:63876676-63876698 AAGCTGGCCCCGCTTGGGGCTGG - Intergenic
1055454321 9:76459090-76459112 CACCTGCGCGAGCTCGGGGCTGG - Intronic
1056070310 9:82979374-82979396 CAGGTAGACCAGCTTGGGACAGG - Intergenic
1056601811 9:88052766-88052788 CAGCTGTGGCAGCTGGGGGTGGG - Intergenic
1056767649 9:89454828-89454850 CCACTGGGTCAGCTGGGGGCTGG - Intronic
1056887648 9:90458732-90458754 CAGCTGGGCTAGCTTGCTGATGG + Intergenic
1057076394 9:92140421-92140443 CAGCTCGGCCACCCTGAGGCTGG - Intergenic
1057851384 9:98569253-98569275 CACATGGGCCAGGTTGTGGCGGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058731557 9:107855090-107855112 AAGCTGGGCCATATTGGGCCTGG + Intergenic
1059434330 9:114267108-114267130 CAGCTTAGCCAGCGTGAGGCGGG - Intronic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060526884 9:124325905-124325927 CTCCTGGGCCAGGCTGGGGCTGG + Intronic
1060918280 9:127403910-127403932 CAGGTGGGCCAGCTGAGAGCTGG - Intronic
1061043617 9:128152968-128152990 CAGCTGGGCCAGGTGGGGCAGGG + Intronic
1061209341 9:129181826-129181848 CTGCTGGGGCAGCATGGAGCTGG + Intergenic
1061438559 9:130582862-130582884 TAGCTGGTCCAGCTTGTGGAAGG - Intronic
1061954993 9:133956742-133956764 CAGCTGGGCCAGCCAAGGTCAGG + Intronic
1062461108 9:136662924-136662946 GTGCAGGGCCAGCTTGGTGCAGG - Intronic
1062591799 9:137277772-137277794 CTCCTGGGCCAGCTTCGGCCTGG - Exonic
1062629045 9:137455456-137455478 CAGCAGGGCCTGCTGGGAGCTGG - Intronic
1062733062 9:138120196-138120218 CCGCTGGGCCAGCGTGGAGATGG - Exonic
1203451422 Un_GL000219v1:120675-120697 AAGCTGGCCTCGCTTGGGGCTGG - Intergenic
1185499397 X:585391-585413 CAGGTGGCCCAGGTGGGGGCCGG - Intergenic
1185548392 X:964596-964618 CACCAGGGCCTGTTTGGGGCTGG - Intergenic
1185612610 X:1401712-1401734 TGGCTGGGCCAACCTGGGGCTGG - Intergenic
1185677959 X:1864022-1864044 CACCTGGGCCTGTTGGGGGCTGG - Intergenic
1186334511 X:8572290-8572312 CACCAGGGCCTGCTTGGGGGAGG - Intronic
1187042596 X:15612554-15612576 CAGATGGGCCAGCATTGGGTAGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187253718 X:17622595-17622617 CATCTGTACCTGCTTGGGGCGGG + Intronic
1190275001 X:48893745-48893767 TAGCTGGGGTAGCCTGGGGCCGG + Exonic
1191130473 X:57002959-57002981 CAGTTGGGCCAGCATGGTTCTGG - Intergenic
1191878594 X:65822190-65822212 GCGCCGGCCCAGCTTGGGGCTGG + Intergenic
1193455272 X:81724385-81724407 CAGCTGGGGCAGCCAGGGGAGGG + Intergenic
1193566049 X:83078354-83078376 GAGCTGTGCCAGATTGGGGTAGG + Intergenic
1195744798 X:108105866-108105888 GAGCTGTGCCAGCTTGGGAGAGG + Intronic
1197573232 X:128176132-128176154 CACTTGGGCCTGCTTGGGGGTGG + Intergenic
1197770287 X:130085102-130085124 GAGCTGTGCAAGCATGGGGCAGG - Intronic
1198518158 X:137428577-137428599 CAGCAGGGCCTGCCTGGGCCGGG + Intergenic
1198960248 X:142175253-142175275 CAGCAGGGGCAGCGTGTGGCGGG + Intergenic
1199062854 X:143379457-143379479 TAGCTGGGTCAGCTTTGGTCAGG + Intergenic
1199300229 X:146204745-146204767 GAGCTGGGCCACCTGGGGGTAGG + Intergenic
1199944211 X:152652638-152652660 CAGCTGGGCCTGCTCGGAGGTGG - Exonic
1200065532 X:153502632-153502654 CTGCTGGGCCGGCCTGAGGCTGG + Intronic
1200988711 Y:9328408-9328430 CTGGTGGGGCAGCGTGGGGCAGG - Intergenic
1201005556 Y:9506764-9506786 CAGTTGGGCCTGCTGGGGACCGG - Intergenic
1201986446 Y:19973716-19973738 CACCAGGGCCTGCTGGGGGCTGG + Intergenic
1202095484 Y:21244770-21244792 CATCTGGGCCAACAAGGGGCTGG + Intergenic