ID: 1139580923

View in Genome Browser
Species Human (GRCh38)
Location 16:67873200-67873222
Sequence TGCGTGGTGCGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 339}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139580917_1139580923 -2 Left 1139580917 16:67873179-67873201 CCCGTGGCGGGTGAGCGAGGGTG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 41
4: 339
1139580912_1139580923 10 Left 1139580912 16:67873167-67873189 CCGCTGTCTCGCCCCGTGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 41
4: 339
1139580908_1139580923 18 Left 1139580908 16:67873159-67873181 CCGGCGTCCCGCTGTCTCGCCCC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 41
4: 339
1139580916_1139580923 -1 Left 1139580916 16:67873178-67873200 CCCCGTGGCGGGTGAGCGAGGGT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 41
4: 339
1139580918_1139580923 -3 Left 1139580918 16:67873180-67873202 CCGTGGCGGGTGAGCGAGGGTGC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 41
4: 339
1139580910_1139580923 11 Left 1139580910 16:67873166-67873188 CCCGCTGTCTCGCCCCGTGGCGG 0: 1
1: 0
2: 1
3: 1
4: 73
Right 1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 41
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139580923 Original CRISPR TGCGTGGTGCGCGGCGGCGG CGG Exonic
900162796 1:1232289-1232311 TGCGGCGGGCGTGGCGGCGGCGG + Exonic
900190159 1:1349754-1349776 TGCGGGGCGCGCGGGGGCGCGGG + Intergenic
900291216 1:1924349-1924371 TGGGTGGTGAGCTGCGGGGGTGG - Intronic
900349583 1:2228251-2228273 TGGGAGGAGCGGGGCGGCGGCGG + Intergenic
900354613 1:2254283-2254305 TGCGTGGTGCCCGTTGGAGGGGG + Intronic
900414669 1:2529496-2529518 GGGCTGGTGCGCGGCGGCGGCGG + Exonic
901012377 1:6209103-6209125 TGCGTGCAGCGCTGCGGGGGCGG - Exonic
901022177 1:6261043-6261065 TGAGCGAAGCGCGGCGGCGGCGG - Intergenic
901109772 1:6785439-6785461 GGGCGGGTGCGCGGCGGCGGCGG + Exonic
901497312 1:9629462-9629484 AGCGTGGTGGGTGGGGGCGGGGG - Intergenic
902600892 1:17539697-17539719 CGCGTCGCGCACGGCGGCGGCGG + Intergenic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903349796 1:22710843-22710865 TGCTGGCTGCGCGGTGGCGGCGG + Intronic
903389361 1:22953404-22953426 TGCGCGGTGGGCGGCGGAGCCGG + Exonic
903907410 1:26696505-26696527 GGCGGGGGGCGAGGCGGCGGCGG + Exonic
903925250 1:26826987-26827009 TGCGCCGTGGGCGGCGGCCGAGG - Exonic
904402154 1:30263940-30263962 TGCGGGGTGGGGGGCGGTGGAGG - Intergenic
904944250 1:34187778-34187800 TGGGTGGTGGGGGGCGGCGGGGG - Intronic
905414386 1:37794396-37794418 TCCGCGGTGCGGGGCGGCGGCGG - Exonic
905990663 1:42334908-42334930 TGCGGGGTGGGCGGCGGGTGGGG - Exonic
906204390 1:43979327-43979349 TCCATGGCCCGCGGCGGCGGCGG + Intronic
906640506 1:47438217-47438239 GACGTGGTGGGCGGCGGCAGCGG + Exonic
908447106 1:64209674-64209696 TGCGGGGCGGGCGGGGGCGGGGG - Intronic
910758862 1:90716816-90716838 TGCTGGGGGGGCGGCGGCGGCGG + Exonic
912401607 1:109397944-109397966 GGTGTGGCGCGCGCCGGCGGGGG - Exonic
912568865 1:110607402-110607424 TGCGTGGCGCGGTGCGGCTGCGG - Exonic
914393569 1:147243015-147243037 TGCGCGGCGCGCGGGGCCGGCGG + Intronic
914428560 1:147600065-147600087 TTCGTGGCGCGGTGCGGCGGGGG + Intronic
915214105 1:154328768-154328790 GGCATGGGGGGCGGCGGCGGCGG + Intronic
915513656 1:156400676-156400698 TGCGGGGGGCGCGGGGGCTGGGG + Intergenic
916061062 1:161098812-161098834 TGCGTGGTGGGCGGCTGGGACGG + Exonic
920135988 1:203769771-203769793 TGCGGGGGGGGGGGCGGCGGGGG + Intronic
921023737 1:211259313-211259335 CGCGGGGCGGGCGGCGGCGGAGG + Intronic
921909067 1:220528219-220528241 TGACTGAGGCGCGGCGGCGGCGG + Intronic
922110815 1:222553401-222553423 TGTCTTGTGCGGGGCGGCGGGGG - Intergenic
922351393 1:224737201-224737223 TGCGTGCTCCGCTGCGGGGGTGG + Intronic
922502885 1:226110048-226110070 TCCGGGGAGCGCGGGGGCGGGGG + Intergenic
923650249 1:235866911-235866933 TGGGGAGTGCGCGGCGGCGGCGG - Exonic
1062966129 10:1609087-1609109 TGCCTGGTGCCCGGCGTCGCTGG + Intronic
1063423888 10:5936501-5936523 GGCGTGGTGCGCTGCTGCGTGGG + Exonic
1064230811 10:13528536-13528558 TGCGGGGAAGGCGGCGGCGGGGG + Intronic
1064354286 10:14603992-14604014 TGCGGGGGGCGCCGCGGAGGCGG - Intronic
1065069024 10:22003343-22003365 AGCGGCGTCCGCGGCGGCGGCGG + Exonic
1065188924 10:23193227-23193249 TGCGGGGGGCCGGGCGGCGGCGG + Exonic
1066080713 10:31928544-31928566 TGCGGGAGGCGCGGCGGCGGCGG - Intronic
1072810068 10:98454604-98454626 TGTGTGTTGCGGGGCGGGGGCGG + Intergenic
1073063644 10:100746113-100746135 TGCGGGGCGCGCGGGGGCGGGGG - Exonic
1073139166 10:101236483-101236505 TGGGCGCCGCGCGGCGGCGGCGG - Intergenic
1073207231 10:101775713-101775735 GGAGGGGTGCGCGGAGGCGGGGG - Intronic
1073290111 10:102409239-102409261 CACGGAGTGCGCGGCGGCGGCGG + Intronic
1075264682 10:120990302-120990324 TGTGTGGTGGGAGGGGGCGGTGG - Intergenic
1075768765 10:124916624-124916646 TGCGTGGCGCTCGGGGGCGCCGG - Intergenic
1075999787 10:126905574-126905596 GGCGAGAGGCGCGGCGGCGGCGG - Intronic
1076372517 10:129964472-129964494 TCGGTGGCGCTCGGCGGCGGCGG - Intergenic
1076372523 10:129964498-129964520 TGCGTGGCGGGGGGCGGCGGCGG - Intergenic
1076554143 10:131311312-131311334 GAAGGGGTGCGCGGCGGCGGCGG + Exonic
1076624689 10:131814625-131814647 TGCGTGCTCCGCGGAGGGGGAGG - Intergenic
1076673787 10:132137314-132137336 TGCGTGGGGAGCGGAGGCGTGGG - Intronic
1076676170 10:132148828-132148850 TGTGTGGTGCTCGGCAGGGGCGG - Intronic
1076910719 10:133387660-133387682 CGCGTGGTGCACGGTGGCCGTGG - Intronic
1077008314 11:369373-369395 CGCGGGGTGCGGGGCGGAGGAGG - Intergenic
1077674966 11:4187447-4187469 TGCGGCGGCCGCGGCGGCGGCGG + Intergenic
1077867427 11:6234666-6234688 CGTGTGGTGCGCGGGGGCGCGGG - Exonic
1078514275 11:12009148-12009170 TGGGTGAGGGGCGGCGGCGGGGG - Intronic
1078594430 11:12674508-12674530 TGCTTGGTGGGCGCCCGCGGCGG - Intergenic
1078660173 11:13279056-13279078 TGCGGGGTGCGCGGCGGCAGCGG - Intronic
1079428216 11:20363826-20363848 GGCGCTGAGCGCGGCGGCGGCGG + Exonic
1080606577 11:33869397-33869419 GGCGGGGTGCCGGGCGGCGGGGG + Exonic
1081805068 11:45885930-45885952 GGCGAGGCGCGCGGCGGCCGGGG - Intronic
1082740458 11:56905139-56905161 TGCTTGGTGCATGGCGGCGGGGG + Intergenic
1082966216 11:58968543-58968565 TGTGGGGTGAGCGGCGGTGGCGG - Intronic
1082975026 11:59062863-59062885 TGCGGGGTGGGCGACGGTGGCGG - Intergenic
1083171091 11:60924493-60924515 CGCGGGGCGGGCGGCGGCGGCGG + Exonic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083794673 11:65008552-65008574 GGGGTGGTGGGCGGCAGCGGAGG - Intergenic
1083945034 11:65918979-65919001 GGGGTGGGGCGCGGTGGCGGTGG - Exonic
1084295912 11:68213390-68213412 CGCGGGGGGCGCGACGGCGGCGG - Exonic
1084517014 11:69642760-69642782 GGCGGCGTGCGCGGCGGCGCGGG - Intronic
1084943000 11:72623932-72623954 TGCATGGTGCGTGGCAGGGGAGG - Intronic
1085165817 11:74398455-74398477 GGCGGGGCGGGCGGCGGCGGCGG - Exonic
1087014627 11:93543247-93543269 TGGGAGCGGCGCGGCGGCGGCGG - Intronic
1091934299 12:4423177-4423199 TGGGTGGTGGGTGGCGGCTGGGG - Intergenic
1091934312 12:4423211-4423233 TGGGTGGTGGGCGGCGGCTGTGG - Intergenic
1095465292 12:42483286-42483308 TGCAGGGTGCGCGCCGGCGAGGG - Intronic
1095917613 12:47495983-47496005 TGGGGGGTGGGCGGCGGAGGGGG - Intergenic
1095953720 12:47795227-47795249 TGCATGGGGCCCGGCGGTGGGGG + Exonic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1098416776 12:70243513-70243535 AGCGGGGCGCGCGGCGGGGGCGG + Intronic
1100963076 12:99984753-99984775 GGGGAGGAGCGCGGCGGCGGCGG + Intergenic
1101124366 12:101615668-101615690 TGCTTGGTGTGGGGGGGCGGGGG - Intronic
1101605911 12:106247703-106247725 TGCGGCGCGGGCGGCGGCGGCGG + Exonic
1102677559 12:114668862-114668884 GGCGGGGTGCGCTGCGGGGGTGG - Intergenic
1102853962 12:116277522-116277544 TTCGCGCTCCGCGGCGGCGGCGG - Intergenic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1104897233 12:132170425-132170447 TGCCTGGTGCTGGGCGGGGGCGG + Intergenic
1104983385 12:132583612-132583634 TGCGCCGAGGGCGGCGGCGGCGG - Exonic
1105071276 12:133235717-133235739 TGTGAGGGGCGCGGGGGCGGGGG - Exonic
1106517172 13:30465417-30465439 TGCGCGGAGCGCGGCCGGGGCGG - Intronic
1110630151 13:77698100-77698122 GGCGCGGCGGGCGGCGGCGGCGG - Intronic
1112170478 13:96967551-96967573 GGGGTGGGGCGTGGCGGCGGGGG - Intergenic
1113378817 13:109785571-109785593 CGCGGCGGGCGCGGCGGCGGGGG + Exonic
1113808119 13:113121704-113121726 TGCGTGGTGCCCGCCGTGGGAGG + Intergenic
1115320682 14:32076881-32076903 TGCCGGGTGCGCGGCGCGGGAGG + Intronic
1115851782 14:37595133-37595155 CGCGGCGTGCGCGGCGGCGGCGG + Intronic
1115888731 14:38003722-38003744 TGTGTGGTGGGGGGCGGGGGTGG + Intronic
1117157035 14:52951263-52951285 GGCGTGGGGCGGGGCGGCGCGGG + Intronic
1117954368 14:61111284-61111306 CCCGTGGTGGGCGGAGGCGGTGG + Intergenic
1118836822 14:69484086-69484108 TGCGCGCTAGGCGGCGGCGGCGG + Intergenic
1118971595 14:70642217-70642239 TGCGTCCCGGGCGGCGGCGGAGG + Exonic
1119410283 14:74426092-74426114 GGCGGGGCGGGCGGCGGCGGCGG - Exonic
1119410312 14:74426158-74426180 CGAGGGCTGCGCGGCGGCGGCGG - Intergenic
1119683340 14:76609545-76609567 TGCGGGGTGGGTGGCGGGGGAGG + Intergenic
1119743235 14:77027478-77027500 TTGCTGTTGCGCGGCGGCGGCGG + Exonic
1120780152 14:88479541-88479563 CGCGTGGCGCGCGGCGGTGAGGG + Exonic
1122211654 14:100177887-100177909 TGCACTGTCCGCGGCGGCGGGGG + Intergenic
1122270908 14:100568153-100568175 TGCGGGGAGCGCGGCGGCCCGGG - Intronic
1122300145 14:100726871-100726893 GGCGGCGCGCGCGGCGGCGGCGG + Exonic
1122690324 14:103529203-103529225 TCCGCGACGCGCGGCGGCGGCGG - Exonic
1122779155 14:104136364-104136386 GGTGCGGGGCGCGGCGGCGGCGG + Intergenic
1123001927 14:105300481-105300503 TTCGTGGAGAGCAGCGGCGGCGG - Exonic
1123013872 14:105364316-105364338 TGCGCGGTGGGCGGCGGCCCGGG + Intronic
1123901124 15:24878295-24878317 TGCGGGCTGCGTGGCAGCGGTGG - Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1126668428 15:51094719-51094741 TGGGCGGTGCGCGGCGGCAGCGG + Intronic
1127768089 15:62207565-62207587 CGCGTGGTGCTCGCCGGCCGGGG + Intergenic
1127770167 15:62224369-62224391 TGCCTGGTGGGCTTCGGCGGTGG + Intergenic
1128063261 15:64748422-64748444 AGCGTGGAGGGCGGCGGCAGCGG + Exonic
1130370918 15:83284704-83284726 CACGCGGTGCGCGGCGGGGGCGG - Exonic
1131977474 15:97960873-97960895 GGCTGGGTGCGCGGCGGCCGTGG + Exonic
1132580085 16:680698-680720 CGCGGGGAGGGCGGCGGCGGTGG + Intronic
1132849329 16:2017574-2017596 TGCTTGGTCCTCGGAGGCGGAGG - Intronic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1132885170 16:2179259-2179281 GGCGCTGTGGGCGGCGGCGGCGG + Exonic
1133156560 16:3880452-3880474 TGGGGGGGCCGCGGCGGCGGCGG - Exonic
1135735819 16:24931137-24931159 TGCGTAGGGGGCTGCGGCGGTGG + Exonic
1136220118 16:28823296-28823318 TGCGTGGGGGGCGGCTGCTGGGG - Exonic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136588481 16:31202708-31202730 AGCGGGGTGAGCGGCGGCAGCGG - Exonic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1141972391 16:87492566-87492588 CGGCCGGTGCGCGGCGGCGGCGG + Intergenic
1142139810 16:88467862-88467884 TGCGTGCTGTGCGGTGGAGGAGG + Intronic
1142278124 16:89133567-89133589 TGCGTGGGGCCCGGCGTCTGTGG - Intronic
1142614188 17:1125428-1125450 AGCGTAGTGGGCGCCGGCGGCGG + Intronic
1143371511 17:6443750-6443772 TGCGTGGGGCAAGGCGGGGGCGG + Intergenic
1147285782 17:39401739-39401761 GGGGAGGAGCGCGGCGGCGGCGG + Intronic
1147581975 17:41632087-41632109 TGCGTGCTGCGCGGCGGGGTTGG + Intergenic
1148122586 17:45221739-45221761 GGCTGGGTGCCCGGCGGCGGCGG + Intronic
1148549705 17:48543288-48543310 TGCGCGCTGCGCGGGGCCGGCGG - Exonic
1148556184 17:48580166-48580188 CGAGAGTTGCGCGGCGGCGGCGG - Intronic
1149914918 17:60600160-60600182 TGTGTGGTGGGCGCGGGCGGTGG + Intergenic
1150002666 17:61451665-61451687 GGCCGGGTGCGGGGCGGCGGCGG - Intergenic
1150003658 17:61456657-61456679 TACCTGCTCCGCGGCGGCGGCGG - Exonic
1152231385 17:79115624-79115646 TGCGTGGGGTGCGGTGGGGGCGG + Exonic
1152362541 17:79839352-79839374 TGCGGGGCGAGCGGCGGCGGCGG - Exonic
1153238924 18:3013381-3013403 CGCCTGGCGCTCGGCGGCGGGGG - Intergenic
1153382489 18:4454958-4454980 TGGGGCGTGCGCGGCGGCGGCGG - Intronic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1156275718 18:35581482-35581504 TGCGTGCTCGGCGGCAGCGGCGG - Intronic
1156275828 18:35581838-35581860 CGCTAGGCGCGCGGCGGCGGCGG - Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1158277087 18:55780371-55780393 TGCGGGCTGCGCGGAGGCTGCGG - Intergenic
1158436035 18:57435957-57435979 TGCGCGGTTGGAGGCGGCGGAGG - Exonic
1158457686 18:57622211-57622233 GACGGGGTGCGCGGCGGTGGAGG + Intronic
1158954701 18:62526617-62526639 CCCCGGGTGCGCGGCGGCGGCGG - Intronic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160567830 18:79798143-79798165 TGCGCGGTGCGCGCGGGCGCGGG + Intergenic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160853446 19:1205745-1205767 TGCGGTGTCCGCGGCGGCGCAGG + Intronic
1160950204 19:1663085-1663107 GGCGTGGTGGGCGGGGGTGGGGG + Intergenic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1161347368 19:3775026-3775048 GGCGTGAGGCGCGGCGGGGGGGG + Intergenic
1161439050 19:4280112-4280134 TCCGGGGTGGGCGGCTGCGGAGG - Exonic
1161920071 19:7259333-7259355 TGTGGGGTGCGCGGCGGAAGGGG + Intronic
1162027705 19:7903911-7903933 CGGGCGGTGCGCGGCGGCGGTGG + Exonic
1162751762 19:12833860-12833882 CGCGGGGACCGCGGCGGCGGCGG - Intronic
1162778650 19:12995604-12995626 AGCGGCGAGCGCGGCGGCGGCGG + Exonic
1162959493 19:14117620-14117642 AGCGCGCTGGGCGGCGGCGGCGG + Exonic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1164642125 19:29833691-29833713 TGCTTGGTGCGTGGGGGCGGGGG - Intergenic
1164693124 19:30225716-30225738 TGCGGGGGGCGCGGCGCGGGGGG + Intergenic
1164800858 19:31075247-31075269 TGGGTGGTGGGAGGTGGCGGGGG + Intergenic
1164979534 19:32603457-32603479 TGCGTGGAGAGCGGCGGGGAAGG - Intronic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1165129317 19:33622204-33622226 TGCTTGGGGCGCGCAGGCGGCGG - Intronic
1165509437 19:36257570-36257592 TGCGGGGACCGGGGCGGCGGTGG - Intergenic
1166083250 19:40458269-40458291 TCACTGGTGGGCGGCGGCGGCGG + Intronic
1166358630 19:42242380-42242402 TTCGCGGAGCCCGGCGGCGGAGG - Exonic
1166790716 19:45396883-45396905 AGCGGGGTGCGCGGCGACGACGG + Exonic
1166852761 19:45768371-45768393 GGCGTGGTGGGCGGCGGGGAAGG + Exonic
1166853411 19:45770925-45770947 AGCGCGGGGCGCGACGGCGGAGG + Intronic
1167258291 19:48443654-48443676 GTGGTGGGGCGCGGCGGCGGCGG - Exonic
1167377498 19:49119699-49119721 TGCCTGGTCCGCGGCGGCTGCGG - Exonic
1167557474 19:50205308-50205330 TGCCAGGTGGGCGGCGGCGGCGG - Intronic
1167741628 19:51327552-51327574 TGCCTGGAGGGGGGCGGCGGTGG + Intronic
1168443674 19:56393466-56393488 TGCCGGGGGCGCGGCCGCGGTGG - Exonic
925733897 2:6943719-6943741 TGGGTGGTGCTCGGAGGAGGAGG + Intronic
927751456 2:25673715-25673737 TGGGCGGGGCGCGGCCGCGGGGG - Intergenic
931253668 2:60553278-60553300 TGCGGGGCGGGCGGCGGCGGCGG + Exonic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
932314178 2:70768447-70768469 TGAGTGGTGCGGGGCGGGGGTGG - Intergenic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934638288 2:96010473-96010495 TGCGGGGCGGGCGGCGCCGGGGG - Intergenic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
934795365 2:97094937-97094959 TGCGGGGCGGGCGGCGCCGGGGG + Intergenic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
935592700 2:104856109-104856131 CGGGAGGTGCGCGGCGGCGGCGG - Exonic
935746563 2:106194292-106194314 TGCACAATGCGCGGCGGCGGCGG + Exonic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
937301889 2:120847744-120847766 TGCGTGGGGGGCAGGGGCGGGGG + Intronic
938397904 2:130964156-130964178 GGCGTGGTGTGTGGCGGCCGCGG + Intronic
938448505 2:131395273-131395295 TGCGTGGTCAGCGGCGCCAGGGG + Intergenic
940830033 2:158456920-158456942 AGCGGGGCGGGCGGCGGCGGCGG + Intergenic
941905898 2:170716110-170716132 TGCGTGGGGTGCGGTGGCGGGGG + Intronic
942448392 2:176093049-176093071 TTCGGGGCGGGCGGCGGCGGCGG + Exonic
943725153 2:191245393-191245415 TGCGGAGTGCTCAGCGGCGGCGG - Exonic
944412698 2:199458756-199458778 TGGGTGGTGGGCGGAGGCGGTGG - Intronic
945039827 2:205734394-205734416 TGCGGGGTGGGGGGGGGCGGTGG - Intronic
946029068 2:216690885-216690907 GGCGGGGTGGGCGGGGGCGGGGG + Intronic
946216302 2:218186394-218186416 TGCTTGGTGGGGGGAGGCGGGGG + Intergenic
948098859 2:235358081-235358103 TGCGTGGGGCGCTGCAGCCGTGG - Intergenic
948140478 2:235669508-235669530 TCCCGGGAGCGCGGCGGCGGCGG - Intronic
948991761 2:241559161-241559183 TGCGTGGGCGGCGGGGGCGGAGG - Intronic
1169065661 20:2693104-2693126 GGCGCGGAGCTCGGCGGCGGCGG - Exonic
1169673790 20:8132471-8132493 TGCCTGCTGAGCGGCGCCGGAGG + Intronic
1171876901 20:30585683-30585705 GGCGTTCTGCCCGGCGGCGGCGG + Intergenic
1172474451 20:35226646-35226668 GGCGGGGCGCGCGGAGGCGGGGG + Exonic
1172587284 20:36093509-36093531 TGGGCGGTGGGTGGCGGCGGCGG + Intronic
1173807279 20:45934392-45934414 TGGGCGGTGCGCGGCGGGGTTGG - Intergenic
1175057169 20:56208903-56208925 TGTGTGGTGAGTGGCGGTGGCGG - Intergenic
1175057182 20:56208958-56208980 TGTGTGGTGAGTGGCGGTGGCGG - Intergenic
1176150327 20:63587502-63587524 TGAGTGGTCCGGGGCGGGGGTGG + Intergenic
1176550162 21:8217354-8217376 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176569090 21:8400389-8400411 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176577004 21:8444624-8444646 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1178487341 21:33027458-33027480 TGCCGGGTGCGCGGTGGCGGCGG - Exonic
1178707649 21:34888856-34888878 AGCGCGCGGCGCGGCGGCGGGGG - Intronic
1178839866 21:36130043-36130065 TGCGGGGAGCCCCGCGGCGGGGG + Intergenic
1179435485 21:41359529-41359551 TGCGTGGTGCCCACCGGTGGGGG - Intergenic
1179675070 21:42975202-42975224 TGCGGGGCGCGCGGCGGCGCAGG + Intronic
1179817505 21:43917167-43917189 TGTGTGGGGGGCGGGGGCGGGGG - Intronic
1181631969 22:24156228-24156250 CGCCTGGTGCGCCGAGGCGGGGG - Intronic
1181831671 22:25564960-25564982 GGCGCGGCGGGCGGCGGCGGCGG + Exonic
1182355366 22:29720316-29720338 GGCGGGGCGCGCGGCTGCGGAGG - Exonic
1182374727 22:29838214-29838236 ACCGTGGTCGGCGGCGGCGGCGG - Exonic
1183054963 22:35299714-35299736 TGCGGCTTGCTCGGCGGCGGCGG - Intronic
1183524935 22:38317296-38317318 CGAGCGGAGCGCGGCGGCGGCGG - Exonic
1183545377 22:38452549-38452571 TGCAGGGGGAGCGGCGGCGGTGG + Intronic
1184086917 22:42270733-42270755 GGCGGGGCGCGCGGCGGGGGCGG + Intronic
1184347755 22:43923901-43923923 TGCGTCGTACATGGCGGCGGCGG - Exonic
1185154311 22:49183916-49183938 TGCGTGGTACGAGGCGAGGGTGG + Intergenic
1185202840 22:49518562-49518584 AGCCTGGTGCGGGGGGGCGGTGG - Intronic
1185272766 22:49936345-49936367 CGGGGGGTGTGCGGCGGCGGCGG - Intergenic
1185366917 22:50441028-50441050 TGTGTGGGGCGTGGCGGGGGCGG + Intronic
1203255055 22_KI270733v1_random:133686-133708 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203263111 22_KI270733v1_random:178765-178787 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
949970001 3:9396755-9396777 TGCGCGGGGCGCGGGGGTGGCGG - Intergenic
950805772 3:15601905-15601927 GGCGTGGTGCGGCGCGGAGGGGG + Intronic
952908929 3:38165765-38165787 TGGTGGGGGCGCGGCGGCGGCGG + Exonic
953031251 3:39181158-39181180 CCGGTGGTGCGCGCCGGCGGCGG - Intergenic
954291122 3:49650681-49650703 TGTGAGGTGGGCGGCGGCAGGGG - Exonic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
956813597 3:72888216-72888238 TTCATGGTGCGGCGCGGCGGCGG - Exonic
960223983 3:115147971-115147993 TGCGGGGTGAGGGGCAGCGGCGG + Intergenic
961466691 3:127086021-127086043 TGCCTGGTGGGGGGTGGCGGTGG - Intergenic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
962919135 3:139935420-139935442 GGCGTGGGGAGCGGCAGCGGCGG + Exonic
963939707 3:151086338-151086360 TGCGGGGCGCGTGGCGGCGGGGG + Intronic
964252723 3:154737744-154737766 GGGGTGGGGGGCGGCGGCGGGGG + Intergenic
966182196 3:177197554-177197576 CGCGAGGCCCGCGGCGGCGGCGG + Intergenic
966411773 3:179652900-179652922 TGGGCCGGGCGCGGCGGCGGGGG - Exonic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
966883450 3:184362173-184362195 TGCGGGGTGTGCGGGGGTGGAGG + Intronic
967068025 3:185937936-185937958 CGCGTCGTGCGGGGCTGCGGCGG - Exonic
967158927 3:186718146-186718168 TGGGTGGTGGGTGGCGGTGGTGG - Intronic
967159019 3:186718395-186718417 TGGGTGGTGGGTGGCGGTGGTGG - Intronic
968114792 3:196081558-196081580 TGCGCGGCGTGCGGCGCCGGGGG - Intronic
968448453 4:663991-664013 TCCGGGGTGCGCGGGGCCGGCGG - Intronic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
969413353 4:7043474-7043496 TTGCTCGTGCGCGGCGGCGGCGG + Exonic
969436633 4:7192719-7192741 CGCGGCGAGCGCGGCGGCGGCGG - Exonic
969477075 4:7427846-7427868 GGCCTGGTGCGGGGGGGCGGGGG - Intronic
969507216 4:7595527-7595549 TGGCTGGTGCGGGGCGGGGGTGG - Intronic
970333133 4:15004168-15004190 TTCATGGCGGGCGGCGGCGGAGG - Exonic
971257939 4:25030915-25030937 TGCGGCGGGCGCAGCGGCGGCGG - Intergenic
971406013 4:26321176-26321198 TGCGCCGAGCGCGGCGGCGGCGG + Intronic
973110312 4:46390086-46390108 GGCGCGGTGCGCGCCGGCGGTGG + Intronic
973551284 4:52038270-52038292 GGCGGGGAGCTCGGCGGCGGCGG - Exonic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
981498109 4:145416361-145416383 GGCGTGGTGGCCGGCGGCTGTGG - Intergenic
982148870 4:152429369-152429391 TGGGTGGTGGGGGGCGGCGGGGG + Intronic
984892279 4:184504595-184504617 GGCGTGGTGGGTGGGGGCGGGGG - Intergenic
985073636 4:186191749-186191771 GGCGTGGTGCGAGGCGGTGCCGG - Exonic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
987132347 5:14871570-14871592 GGCCTCGGGCGCGGCGGCGGCGG + Exonic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
991054356 5:62306040-62306062 AGCGGGGTGGGCGGCGGCCGCGG - Intergenic
992105520 5:73447208-73447230 GGCGGCCTGCGCGGCGGCGGCGG + Exonic
992716128 5:79513588-79513610 TCCATTGTGCTCGGCGGCGGGGG - Exonic
992939652 5:81750491-81750513 CGCGGGGAGCGCGGCGGCGGGGG - Intronic
995224953 5:109690751-109690773 TGGGCGGCGTGCGGCGGCGGCGG + Intronic
995650365 5:114362188-114362210 TGTGAGGAGCGCGGCGGCGGCGG - Exonic
998033938 5:138897304-138897326 TGTGTGCTGGGCGGGGGCGGGGG - Intronic
999360605 5:150982978-150983000 TGTGGGGTGGGGGGCGGCGGGGG + Intergenic
1001556604 5:172641381-172641403 TGCGTCGGGCGCGGCGTTGGCGG - Exonic
1002105408 5:176877367-176877389 TGCCTGGCCCGAGGCGGCGGGGG + Intronic
1002532822 5:179858848-179858870 TGCGTGGGGCGGGGCCGCGGCGG - Exonic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1006950823 6:37819928-37819950 CCCATGGTGCTCGGCGGCGGCGG - Exonic
1007788916 6:44297793-44297815 TGCCTGGCGCGCAGCGGCAGCGG - Intronic
1011128763 6:84033785-84033807 TGGGCGGTGGGAGGCGGCGGCGG + Exonic
1012475606 6:99613113-99613135 TGCGTGTTCAGCGGCGGTGGAGG + Exonic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1014724950 6:124962560-124962582 AGCACGGTGAGCGGCGGCGGCGG + Exonic
1017505173 6:155062091-155062113 GGGGTGGTGCGCGGGGGCGGTGG - Intronic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1019111962 6:169724080-169724102 CGCGGGGCGCGCGGCGGCAGGGG - Intronic
1019202849 6:170333157-170333179 TGCGGGGGGCGGGGGGGCGGTGG - Intronic
1019399389 7:843386-843408 GCCGTTGTGCGCGGTGGCGGCGG - Exonic
1019676303 7:2314519-2314541 GGCGTGGCGCGCGGGGGAGGGGG - Intronic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1020034884 7:4958913-4958935 GGAGGGGCGCGCGGCGGCGGGGG - Intronic
1020034903 7:4958954-4958976 CGCGAGGTGAGCGGCGGCCGCGG - Exonic
1020204566 7:6104969-6104991 TGGGCTGTGTGCGGCGGCGGCGG + Exonic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1026236938 7:68535127-68535149 GGGGTGGTGGGCGGCGGGGGGGG + Intergenic
1026579058 7:71598872-71598894 TGCGTGGTGGGTGGTGGGGGTGG + Intronic
1026731477 7:72915444-72915466 TGGGAGGTGCGAGGCGGAGGAGG - Intronic
1028160106 7:87475725-87475747 CGCGTGGGGGGCGGGGGCGGGGG - Exonic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029443377 7:100600330-100600352 AGCGTGGTGTGCGGCAGAGGAGG - Intronic
1029738655 7:102479084-102479106 GGCGGGGTGCGGGGTGGCGGGGG - Intergenic
1032013798 7:128363282-128363304 TGCAGGGTGTGGGGCGGCGGGGG + Intergenic
1033099956 7:138461008-138461030 CCCGGGGTGCGCGGCGGGGGAGG + Intronic
1034455390 7:151167430-151167452 TGGCCGGAGCGCGGCGGCGGCGG + Exonic
1034951076 7:155297606-155297628 TGCGGGGCGCGTGGCGGCTGCGG - Intergenic
1034951131 7:155297784-155297806 TGGGCGGTGCGCGCGGGCGGTGG + Exonic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1038204961 8:25457909-25457931 TGCGGGGGGCGCGGGGACGGGGG - Intronic
1038267007 8:26045504-26045526 AGCGTGGCGCGCGCCGCCGGAGG - Intergenic
1039542305 8:38382247-38382269 GGCTTTGTGCGCGGCGGCGGCGG - Exonic
1039996746 8:42541301-42541323 GGCGGGGCTCGCGGCGGCGGCGG - Intronic
1041689913 8:60678755-60678777 TGCTGGGGCCGCGGCGGCGGCGG + Intergenic
1042960641 8:74300401-74300423 TGCGTTGTGGGGGGCGGAGGGGG + Intronic
1044244641 8:89928458-89928480 TGGGTGGTTGGCGGCGGGGGGGG - Intergenic
1045489073 8:102655697-102655719 GGCGCTGAGCGCGGCGGCGGCGG - Exonic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1048981172 8:139703920-139703942 GGCGGCGGGCGCGGCGGCGGCGG + Intergenic
1049109849 8:140635780-140635802 GGCGGGGTCCGCGGCGGCGGCGG + Intergenic
1049194612 8:141308451-141308473 GGCGGGGTGGGCGGCAGCGGAGG - Intergenic
1049569007 8:143359708-143359730 GGCGTCGTGCGCGGAGGGGGAGG + Intronic
1049659997 8:143815608-143815630 AGCGCGGGGAGCGGCGGCGGCGG + Intergenic
1049689639 8:143952993-143953015 TGTGTGCTGCGAGGCGGGGGGGG - Intronic
1053003370 9:34589877-34589899 GTCGTGGCGCGCGGCCGCGGAGG - Intronic
1053034110 9:34810018-34810040 TGAGGCGTGGGCGGCGGCGGCGG - Intergenic
1053152007 9:35749323-35749345 GGCTAGGTACGCGGCGGCGGCGG - Exonic
1053410636 9:37914269-37914291 TGCGTGGTGGTGGGTGGCGGTGG - Intronic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1059191854 9:112333917-112333939 GGCGGGGTGCGCGGCGGAGCGGG - Intergenic
1060979944 9:127786064-127786086 GGCCTGGAGTGCGGCGGCGGCGG + Exonic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061328123 9:129876240-129876262 TGCGTGCGGCGAGGCGGCGCGGG + Intronic
1061453503 9:130681629-130681651 CAGGTGGTGCGCGGCGGCGGCGG - Exonic
1061840722 9:133357070-133357092 TAGGTGGTCCGCGGCGGCGCGGG + Intronic
1062306020 9:135907482-135907504 TCCCGGGTGAGCGGCGGCGGCGG + Intergenic
1203471455 Un_GL000220v1:116826-116848 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203479276 Un_GL000220v1:160798-160820 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1186426071 X:9465136-9465158 TGAGGCGGGCGCGGCGGCGGCGG - Exonic
1186768058 X:12791458-12791480 CGAGGGGCGCGCGGCGGCGGAGG - Exonic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1192503039 X:71665685-71665707 TGCCTGGTGTGCGGCCGCAGGGG - Intergenic
1195716948 X:107826684-107826706 TCCGGGGTGCGGGGCGGGGGCGG + Intronic
1200233652 X:154458283-154458305 TGTGTGGGCGGCGGCGGCGGCGG + Exonic