ID: 1139581785

View in Genome Browser
Species Human (GRCh38)
Location 16:67878168-67878190
Sequence GAGAGAGGGCTCCTTCACTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139581785_1139581790 -5 Left 1139581785 16:67878168-67878190 CCTCAGTGAAGGAGCCCTCTCTC 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1139581790 16:67878186-67878208 CTCTCCTGATGGGACTGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 224
1139581785_1139581794 30 Left 1139581785 16:67878168-67878190 CCTCAGTGAAGGAGCCCTCTCTC 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1139581794 16:67878221-67878243 ACGATGGCTATGTCAAGTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1139581785_1139581792 14 Left 1139581785 16:67878168-67878190 CCTCAGTGAAGGAGCCCTCTCTC 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1139581792 16:67878205-67878227 CTGGCTACTGCGAGCCACGATGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139581785 Original CRISPR GAGAGAGGGCTCCTTCACTG AGG (reversed) Exonic