ID: 1139581857

View in Genome Browser
Species Human (GRCh38)
Location 16:67878506-67878528
Sequence GCAACAAGGCAGTGAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139581857_1139581861 0 Left 1139581857 16:67878506-67878528 CCAGTCACTCACTGCCTTGTTGC 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1139581861 16:67878529-67878551 CTTGCAGTGTCCCTTTCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 215
1139581857_1139581859 -3 Left 1139581857 16:67878506-67878528 CCAGTCACTCACTGCCTTGTTGC 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1139581859 16:67878526-67878548 TGCCTTGCAGTGTCCCTTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 221
1139581857_1139581864 14 Left 1139581857 16:67878506-67878528 CCAGTCACTCACTGCCTTGTTGC 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1139581864 16:67878543-67878565 TTCTGGAGGTTCCTTATTACTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139581857 Original CRISPR GCAACAAGGCAGTGAGTGAC TGG (reversed) Intronic