ID: 1139582319

View in Genome Browser
Species Human (GRCh38)
Location 16:67880832-67880854
Sequence GGCCTCCATCAAGCCCGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139582319_1139582327 16 Left 1139582319 16:67880832-67880854 CCAGCTCGGGCTTGATGGAGGCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1139582327 16:67880871-67880893 GCATAATACCCCCTCCCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 190
1139582319_1139582328 19 Left 1139582319 16:67880832-67880854 CCAGCTCGGGCTTGATGGAGGCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1139582328 16:67880874-67880896 TAATACCCCCTCCCTCCTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 157
1139582319_1139582324 -6 Left 1139582319 16:67880832-67880854 CCAGCTCGGGCTTGATGGAGGCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1139582324 16:67880849-67880871 GAGGCCCTGGGGATGGAGATCGG 0: 1
1: 0
2: 7
3: 61
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139582319 Original CRISPR GGCCTCCATCAAGCCCGAGC TGG (reversed) Exonic