ID: 1139582319 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:67880832-67880854 |
Sequence | GGCCTCCATCAAGCCCGAGC TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 111 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1139582319_1139582327 | 16 | Left | 1139582319 | 16:67880832-67880854 | CCAGCTCGGGCTTGATGGAGGCC | 0: 1 1: 0 2: 0 3: 7 4: 103 |
||
Right | 1139582327 | 16:67880871-67880893 | GCATAATACCCCCTCCCTCCTGG | 0: 1 1: 0 2: 0 3: 14 4: 190 |
||||
1139582319_1139582328 | 19 | Left | 1139582319 | 16:67880832-67880854 | CCAGCTCGGGCTTGATGGAGGCC | 0: 1 1: 0 2: 0 3: 7 4: 103 |
||
Right | 1139582328 | 16:67880874-67880896 | TAATACCCCCTCCCTCCTGGAGG | 0: 1 1: 0 2: 0 3: 14 4: 157 |
||||
1139582319_1139582324 | -6 | Left | 1139582319 | 16:67880832-67880854 | CCAGCTCGGGCTTGATGGAGGCC | 0: 1 1: 0 2: 0 3: 7 4: 103 |
||
Right | 1139582324 | 16:67880849-67880871 | GAGGCCCTGGGGATGGAGATCGG | 0: 1 1: 0 2: 7 3: 61 4: 568 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1139582319 | Original CRISPR | GGCCTCCATCAAGCCCGAGC TGG (reversed) | Exonic | ||