ID: 1139584521

View in Genome Browser
Species Human (GRCh38)
Location 16:67893355-67893377
Sequence CCCGCCGCCCGCGCGAGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139584515_1139584521 5 Left 1139584515 16:67893327-67893349 CCGGCAGAGCCGCCGAGACGCCG 0: 1
1: 0
2: 3
3: 16
4: 82
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1139584514_1139584521 15 Left 1139584514 16:67893317-67893339 CCGGAGATGGCCGGCAGAGCCGC 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1139584516_1139584521 -4 Left 1139584516 16:67893336-67893358 CCGCCGAGACGCCGAAGAGCCCG 0: 1
1: 0
2: 1
3: 5
4: 32
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1139584513_1139584521 16 Left 1139584513 16:67893316-67893338 CCCGGAGATGGCCGGCAGAGCCG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1139584512_1139584521 22 Left 1139584512 16:67893310-67893332 CCATTGCCCGGAGATGGCCGGCA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1139584517_1139584521 -7 Left 1139584517 16:67893339-67893361 CCGAGACGCCGAAGAGCCCGCCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1139584509_1139584521 28 Left 1139584509 16:67893304-67893326 CCGCTGCCATTGCCCGGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139584521 Original CRISPR CCCGCCGCCCGCGCGAGGTG AGG Exonic
900116984 1:1033175-1033197 CCCGACTCCCGCGCGGGGCGGGG - Intronic
901836264 1:11926006-11926028 CCCGCAGGCCGCGCCAGGCGCGG + Exonic
903455691 1:23484836-23484858 CCCGCCGCCCCGGGGATGTGTGG + Intergenic
903628222 1:24745974-24745996 CCCGGCGCCCGGGCGGGGGGTGG - Intronic
904050236 1:27634372-27634394 CCTGCCGGGCGCGCGAGGCGTGG - Intronic
913615765 1:120558342-120558364 CCCGCCCCCTGCCCGAGGGGCGG - Intergenic
914574510 1:148952560-148952582 CCCGCCCCCTGCCCGAGGGGCGG + Intronic
915629093 1:157138177-157138199 CCCGCCCCCCGCACTGGGTGAGG + Intronic
920660595 1:207911158-207911180 CCCTCCGCCCGGGAGAGGGGTGG + Exonic
922804312 1:228377738-228377760 CCTGCCCCCCGCCCCAGGTGAGG - Intronic
923744403 1:236686815-236686837 CGGGCCGCCCGCGCGTGGTGGGG + Intronic
1066135908 10:32446145-32446167 CCCGCCGCCGGCGCCGGATGGGG - Exonic
1066464505 10:35640788-35640810 ACCGCCGCCGCCGCGAGCTGGGG + Exonic
1070079168 10:73168407-73168429 CCCGCCGCCCGCCCCGGCTGGGG - Intronic
1072151781 10:92689996-92690018 CCCGCCGCCGGCCCGGGGTGCGG - Exonic
1073123231 10:101134395-101134417 CCGGCCGCCCGCGAGCGGCGCGG + Intronic
1073326048 10:102644422-102644444 CCCGCTGCGCGCGCGGCGTGAGG + Intergenic
1074923813 10:118046793-118046815 CCCGGCGCCGGCGGGACGTGGGG + Intergenic
1077360993 11:2139998-2140020 CCCGGAGCCCCCGCCAGGTGCGG + Intronic
1081774098 11:45665808-45665830 CCCGCCGGCCGCCCGAAGTCCGG - Intergenic
1081967208 11:47177173-47177195 CCCGCAGCCTGCGCGGCGTGGGG - Intergenic
1085396880 11:76210846-76210868 CCCGCCCCCCGCGCGCGGCCGGG - Intergenic
1086337133 11:85811182-85811204 CCCGCCCCCGGCGGGCGGTGCGG + Intergenic
1094218525 12:27970399-27970421 CGCGCCGCCCGAGCGAGTGGAGG + Intronic
1094753488 12:33439767-33439789 CCCGCCGCGCGAGCGAGCCGAGG + Exonic
1096073574 12:48788943-48788965 CCCGCCGCCCCCGCGGGCTCCGG + Intronic
1096127701 12:49131550-49131572 CCCCGCGGCCGCGCGAGGGGAGG - Intergenic
1096465698 12:51847035-51847057 CCGGGCGGCCGCGCGAGCTGCGG - Intergenic
1100444821 12:94650586-94650608 GCCGCCGCCGCCGCGGGGTGGGG + Intergenic
1101351069 12:103930357-103930379 TCCCCCGCCCGCGGGAAGTGGGG + Exonic
1103828870 12:123762802-123762824 CCCGCACCCCGTGCCAGGTGCGG + Intronic
1107086465 13:36432054-36432076 GTCTCCGCCCGGGCGAGGTGGGG - Intronic
1112505063 13:99970531-99970553 CCAGCCGCCCCTGGGAGGTGGGG + Exonic
1113082910 13:106535838-106535860 CCCGCCGCCCGCGGGAGCCAGGG - Intergenic
1118186456 14:63542847-63542869 CCCGCCGCCCGCCCCCGCTGCGG - Exonic
1122126666 14:99582102-99582124 CCCCCCGCCCCCGCTGGGTGTGG - Intronic
1122130853 14:99604033-99604055 CCCCCCGCCCGCGCGCGGACCGG - Intergenic
1122486834 14:102087379-102087401 CCGCCCGCCCGCGGCAGGTGGGG - Intronic
1122975451 14:105168933-105168955 CCCGCCGCCCGGGCGCCCTGGGG - Intergenic
1202858106 14_GL000225v1_random:63975-63997 CACGCCGCCCGGGCGACCTGGGG + Intergenic
1124376474 15:29132180-29132202 CCCGCAGCCCGGGCGAGGCAGGG - Intronic
1125509055 15:40283091-40283113 CCCGGCCCCCGCGAGAGGGGAGG - Intronic
1125674491 15:41494919-41494941 CCCAGCGCCCGCACGAGGCGTGG + Intronic
1126823637 15:52528847-52528869 GCGGCCGCCCAGGCGAGGTGCGG - Exonic
1127545767 15:59993482-59993504 GCCGCAGCCCGCGCAAGCTGAGG - Intergenic
1128547530 15:68578494-68578516 CCCCGGGCCAGCGCGAGGTGGGG + Intergenic
1129267957 15:74404086-74404108 ACAGCCGCCCGCGCCAAGTGGGG - Intergenic
1129356649 15:74996144-74996166 TCGGCCGCCCGAGGGAGGTGAGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132893279 16:2214914-2214936 CCCGCAGCCCGCGGGAGGCGGGG - Intergenic
1133771538 16:8869312-8869334 CTCGCCACGCGCGCCAGGTGCGG + Intergenic
1133972589 16:10578545-10578567 CCCTCCTCCAGCCCGAGGTGGGG + Intronic
1134531899 16:14989929-14989951 CCCGCAGGCCGCGCCAGGCGCGG + Intronic
1136559894 16:31033139-31033161 CACACGGCCCCCGCGAGGTGGGG - Intronic
1138327879 16:56191089-56191111 CGCGCCGCCGGCGCGTGGGGCGG + Intergenic
1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG + Exonic
1141839700 16:86566956-86566978 CCCTCGGCCCGCGCGAGGAGGGG - Intergenic
1142234363 16:88914961-88914983 CCCGCTGCCGGGGCGGGGTGGGG + Intronic
1144784428 17:17823817-17823839 CCCGCCGCCGTGGGGAGGTGGGG - Intronic
1147015678 17:37489837-37489859 CCCTCCGCCCGCGCCCGGGGCGG - Exonic
1148936328 17:51166718-51166740 CCCCGCGGCCGCGCGTGGTGGGG + Exonic
1149461691 17:56834244-56834266 GCCTCCACCCGCGCGAGGTAGGG + Exonic
1152468241 17:80477289-80477311 CGCCCCGCCCGCACGGGGTGGGG - Intronic
1152631565 17:81412984-81413006 CCCACTGCCCCCGCAAGGTGAGG - Intronic
1152782084 17:82231127-82231149 CCCGCCAGCCGCGGGACGTGGGG - Intronic
1155928845 18:31685226-31685248 ACCGCCGCGCGCCCGGGGTGAGG + Intronic
1160768968 19:821909-821931 GGCGCCGGCCGCGCCAGGTGAGG - Exonic
1160930282 19:1567081-1567103 CCCGCCGCCTGTGCTGGGTGTGG + Intronic
1165278162 19:34772788-34772810 TCCGCAGCCCGCGCGAGCTCGGG - Intronic
1168113237 19:54206765-54206787 CCCACCACCCAAGCGAGGTGAGG - Intronic
927652423 2:24920406-24920428 CCCGCCGCCCGCGCCGGATCGGG - Intergenic
928549391 2:32356849-32356871 CCCCCTGCCCCCGCGAGGAGCGG + Intergenic
930096820 2:47571622-47571644 CCCGCCACCCGAGGCAGGTGCGG + Intergenic
932144690 2:69307075-69307097 CCCGCCGGCCGAGCCGGGTGCGG - Intergenic
936038392 2:109129977-109129999 CCCGCCGCCCGCGAGCGTGGGGG - Exonic
937993145 2:127675157-127675179 CGCTCCGCCCGCGAGAGGGGTGG + Intronic
940420979 2:153478797-153478819 CCCGGCGCTCGCTCGAGGGGGGG + Exonic
944058499 2:195547590-195547612 CCCGCCGGCCGCGCCTAGTGCGG + Intergenic
948473785 2:238203617-238203639 GCTGCCGCCCGCCCGGGGTGTGG - Exonic
1174804443 20:53593719-53593741 CCCCCCGCCCGCGCCAGCCGGGG - Intronic
1175997265 20:62817380-62817402 CCCGCCGCCGGAGGGAGGCGGGG + Intronic
1176733536 21:10522059-10522081 CCCCCCGCCCGCGCCAGCCGGGG + Intronic
1178544215 21:33479764-33479786 CCCGCCGCCCGCGCGTAAGGAGG - Intronic
1183201390 22:36387679-36387701 CCCGCCACCCGCGCGGGCGGGGG - Intronic
1183535466 22:38398402-38398424 CCCCCCGCCCGCGCCAGCCGGGG - Intronic
950829416 3:15859598-15859620 GCCGCCGCCGCCGAGAGGTGAGG + Exonic
953397062 3:42581840-42581862 GCCGCCGTCCGGGCGAGGTGAGG - Exonic
955083936 3:55683859-55683881 CCTGCGGCCGGCCCGAGGTGGGG + Exonic
955911601 3:63864020-63864042 GCCGCGGCCGGCGCGAGTTGGGG + Intergenic
961775096 3:129278889-129278911 CGCGCTGCCGGGGCGAGGTGAGG + Exonic
969638615 4:8383567-8383589 CCCGCCTCCCTCTCGTGGTGGGG - Intronic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
976600648 4:86935055-86935077 GCCGCCGCCTGCGCGCGTTGCGG + Exonic
980941650 4:139280283-139280305 TCCGCGGCCCCCGGGAGGTGGGG + Exonic
985084408 4:186298257-186298279 CCCGCGGGCCCCGCGAGGAGCGG - Intergenic
990910051 5:60843918-60843940 CCCGCTGCCTGCGCGTGGGGAGG - Intronic
992561618 5:77958096-77958118 CCTCCCGGCCGCCCGAGGTGGGG - Intergenic
994197564 5:96936396-96936418 GCCGCCGCTCGCCCGGGGTGCGG + Intronic
996815569 5:127569563-127569585 CCCGCCGGCCCCGGGCGGTGAGG + Intergenic
1001070268 5:168579462-168579484 CCCCCCACCCCCGCGAGGGGTGG + Exonic
1002352160 5:178590558-178590580 GCCGGCGCCCGGGCTAGGTGAGG - Intergenic
1004272882 6:14211075-14211097 CCCGCCGCGCGCGGGAGGTAAGG - Intergenic
1006313406 6:33277126-33277148 CCGGCCGCCGGGGCGAGGCGGGG + Exonic
1007479795 6:42142449-42142471 CCTGGCGCCCGCGCGGGCTGCGG - Intronic
1009808747 6:68635124-68635146 CCCGCCGCCCGCCAGAGGCTCGG - Intergenic
1013619372 6:111873134-111873156 GCCGCCGCCCGCGCCAGGGAGGG - Exonic
1014009762 6:116462176-116462198 TCCAGCGCCCGCGCGAGTTGCGG + Exonic
1019153310 6:170023305-170023327 CCCGGCGGCCGCCCTAGGTGGGG + Intergenic
1022400122 7:30028628-30028650 CCCGGCGCCCGGGCCCGGTGTGG - Exonic
1023984970 7:45088979-45089001 CCCACCGCCCGGCCGAGGGGCGG - Intergenic
1027138238 7:75639298-75639320 CCCGCCCCCGGCGCGCGCTGCGG - Intronic
1027232589 7:76281494-76281516 CACGCCGCCCGCGCGGGGGAAGG + Exonic
1029291488 7:99505144-99505166 TCCGCCCCCCGTGCGAGGTGAGG + Exonic
1032074518 7:128830221-128830243 CCCGCCGCCCGGGCGGCGCGGGG + Intergenic
1034911470 7:155002381-155002403 CCCGCCGGCCGAGCGAGGCTGGG + Intronic
1035021903 7:155805230-155805252 GCCGCCGAGCCCGCGAGGTGGGG + Intronic
1036785295 8:11681463-11681485 CCCGGTCCCCGCGCGGGGTGCGG + Intronic
1036801355 8:11794887-11794909 CCGGCCGCCCGCTCCAAGTGCGG - Intergenic
1037789001 8:21919999-21920021 GCAGCCCCGCGCGCGAGGTGTGG - Intronic
1038804333 8:30776609-30776631 CCCAGTGCCCCCGCGAGGTGCGG + Intronic
1039512955 8:38105918-38105940 CCCACCGCCCGTGAAAGGTGCGG - Intronic
1039948940 8:42153031-42153053 CCCGCCCGCCGCGCGCGCTGAGG - Exonic
1041689996 8:60679100-60679122 CCCGGCGCCCCCGGGAGGGGCGG + Intronic
1043929066 8:86069635-86069657 CCCGCCGCTCGCGGGACCTGGGG + Exonic
1045028966 8:98117197-98117219 CCCGCCCCCAGCGGGAGCTGTGG - Exonic
1053173018 9:35904529-35904551 CCCGCCGCCAGCGGCTGGTGTGG + Intergenic
1057259673 9:93576682-93576704 CCCGCCGCCCCCGCGCGGCCCGG + Exonic
1058412501 9:104748418-104748440 CCCGCCACCCGCGCTTCGTGTGG + Intronic
1060700728 9:125747312-125747334 CTCCCCGCCCGCGCGGGGAGGGG - Intergenic
1060952326 9:127612205-127612227 CCCGCCGCCGGCGCGCGCGGGGG - Intergenic
1062243423 9:135551619-135551641 CCCACCGCCCCCACGAGGTGAGG + Intergenic
1062389230 9:136327467-136327489 ACCGCCGCCCGCGCGGGGAGGGG - Exonic
1062587737 9:137257038-137257060 CCAGGCGCCAGGGCGAGGTGAGG + Exonic
1200249815 X:154546951-154546973 CGCCCCGCCCGCACGAGGGGTGG - Exonic