ID: 1139589992

View in Genome Browser
Species Human (GRCh38)
Location 16:67928229-67928251
Sequence GCTCCCTGGAGGCACCATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139589992_1139590007 18 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139590007 16:67928270-67928292 TCTGGTGGAGGGCCATGGCGTGG 0: 1
1: 0
2: 1
3: 15
4: 186
1139589992_1139590001 6 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139590001 16:67928258-67928280 GGTCCCAGGACCTCTGGTGGAGG 0: 1
1: 0
2: 1
3: 22
4: 246
1139589992_1139589998 0 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139589998 16:67928252-67928274 CTTCCTGGTCCCAGGACCTCTGG 0: 1
1: 0
2: 3
3: 46
4: 305
1139589992_1139589996 -8 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139589996 16:67928244-67928266 CAGGGAGCCTTCCTGGTCCCAGG 0: 1
1: 0
2: 6
3: 27
4: 377
1139589992_1139590002 7 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139590002 16:67928259-67928281 GTCCCAGGACCTCTGGTGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 209
1139589992_1139590000 3 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139590000 16:67928255-67928277 CCTGGTCCCAGGACCTCTGGTGG 0: 1
1: 0
2: 3
3: 46
4: 525
1139589992_1139590005 13 Left 1139589992 16:67928229-67928251 CCTTCATGGTGCCTCCAGGGAGC 0: 1
1: 1
2: 4
3: 16
4: 250
Right 1139590005 16:67928265-67928287 GGACCTCTGGTGGAGGGCCATGG 0: 1
1: 0
2: 8
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139589992 Original CRISPR GCTCCCTGGAGGCACCATGA AGG (reversed) Exonic
900584006 1:3423725-3423747 CCTCTGTGGAGGCACCAGGATGG - Intronic
900610290 1:3541814-3541836 GCTCCCTGGGGGCACCGTGGGGG + Intronic
900907503 1:5571198-5571220 GCTCCCTGGAGATTTCATGAAGG - Intergenic
901511001 1:9717980-9718002 GCTCCCTGGAGGCACCAGGGCGG + Intronic
901932337 1:12603524-12603546 GCACCCTAGAGGCCCCAAGAAGG - Intronic
902113530 1:14102643-14102665 GGGCCCTGAAGGCACCAGGATGG - Intergenic
902454525 1:16523034-16523056 CCTATCTGAAGGCACCATGAAGG - Intergenic
902698849 1:18158026-18158048 GGTCCCTGGGGACACTATGAAGG + Intronic
905005122 1:34703409-34703431 GCTCCCTAGGCCCACCATGATGG - Intergenic
906295060 1:44644621-44644643 CCTACCTGGAGGCAACAGGAGGG + Intronic
907282873 1:53362424-53362446 GCTCCCAGGAGGGCCCAGGAGGG - Intergenic
908931102 1:69316447-69316469 GCTCCCTGGAGTCCTCACGATGG - Intergenic
910934511 1:92476380-92476402 AGTCCCTGGAAGCACCATGGGGG + Intronic
911179290 1:94847033-94847055 GCTCCCTGGAAGCTCGCTGAAGG + Intronic
912466321 1:109877323-109877345 GCTCCCTGGGGGCACAAGGTGGG - Intergenic
912499370 1:110111916-110111938 GATCCCAGGAGGCACCAGGAGGG - Intergenic
913228927 1:116724927-116724949 GCCCCCTGCAGGCAGGATGAAGG - Intergenic
913490150 1:119371834-119371856 GAGCCCTGGAGGCAGCATGATGG - Intronic
917478987 1:175394286-175394308 ACTCCCGGGAGGTACTATGATGG + Intronic
921112799 1:212055346-212055368 GCTGCCTGGAGACTTCATGAAGG + Intronic
922466021 1:225845968-225845990 GCCCCCTGGAGGCAGCAGGGAGG + Exonic
923066019 1:230518053-230518075 GCTCCCTGGGGGCATCTGGAGGG + Intergenic
923504203 1:234591467-234591489 GCTCCCAGGTCCCACCATGAAGG - Intergenic
923832106 1:237569847-237569869 GCTCTGTGGAAGCACCATGCAGG + Intronic
1062896768 10:1109190-1109212 GCACCTTGAAGGCACCAGGAGGG - Intronic
1067794980 10:49314382-49314404 GTTCCCTTCAGGCAGCATGAAGG - Intronic
1069549520 10:69353193-69353215 CCTCCCTGGAGGCGGCATGGGGG - Intronic
1069728232 10:70594862-70594884 GATCCCAGGAGGCACCAGCAGGG - Intergenic
1069841800 10:71344456-71344478 GCTCCCTGGGGGCATCACCAGGG - Intronic
1070915927 10:80154718-80154740 TCAGCCTGGAGGCACCCTGAGGG + Exonic
1071163694 10:82780752-82780774 CCTCACTGGTGGCACCAAGAAGG - Intronic
1072294584 10:93996636-93996658 GCTCCCTGGATGCAGAATGCAGG + Intronic
1072434176 10:95400542-95400564 GATCCCTAGAGGAACTATGAAGG + Intronic
1072548219 10:96456886-96456908 GCTTGCTGGAGGCAGCATTAAGG + Intronic
1073645055 10:105293435-105293457 GCTACCTGGAGACCACATGATGG - Intergenic
1074434342 10:113421142-113421164 TCTCCCTGAAGGCACAAGGATGG - Intergenic
1075429338 10:122367217-122367239 TCTCCCTGGAGCCAGCCTGAGGG + Intergenic
1076246324 10:128950205-128950227 GTACCCTGGAGGCACCAGGAGGG + Intergenic
1076278375 10:129224818-129224840 TCTCCCTGGAGCCAGCATGGTGG - Intergenic
1076905438 10:133358529-133358551 GGTCCCTGGGGTCACCATGGTGG + Intergenic
1079031568 11:16990058-16990080 GGTCCCTGGTGACACCAAGAAGG + Intronic
1079078403 11:17397454-17397476 CCTCCCTGGAGGCACAGGGAGGG + Intronic
1081574948 11:44313269-44313291 GCTGCCTGTAGGCACCCAGAAGG + Intergenic
1083665570 11:64272357-64272379 GTTGCCAGGAGGCCCCATGAAGG - Intronic
1083692771 11:64420448-64420470 CCTCCCAGGAGTCAACATGATGG - Intergenic
1084497829 11:69515318-69515340 GCTGCCTGAAGTCACCATGTGGG - Intergenic
1084942638 11:72621202-72621224 GCTTCCTGGAGGCAGGATGTGGG - Intronic
1087101269 11:94367530-94367552 CCTCCTTGGAGGAACCACGAAGG + Intergenic
1087718101 11:101632359-101632381 GCTGCCTGGAGTCCACATGATGG + Intronic
1089703416 11:120259574-120259596 GGACCCAGGAGGCCCCATGAGGG - Intronic
1091341834 11:134821939-134821961 GCTCAGAGGAGGGACCATGAGGG - Intergenic
1097189509 12:57212763-57212785 TCTCCCTGAAGGCAGCATGGGGG - Exonic
1098504838 12:71237506-71237528 GCTCCCCTGAGGCACCAGGTAGG + Intronic
1099371014 12:81829804-81829826 GGTCCCTGGATGCACCAGGGAGG + Intergenic
1101269680 12:103130524-103130546 GCTCCCTGGAGGAACCAACCTGG - Intergenic
1101513288 12:105411737-105411759 GATCCCAGGATGCACCAGGAGGG + Intergenic
1101832580 12:108270901-108270923 ACTCCCTGGATGGACCATGTGGG + Intergenic
1102255310 12:111411597-111411619 GCACCCTGGAGCCACCAAGTCGG - Intronic
1102633486 12:114302269-114302291 CCACCCTGGAGGCACCAGGAGGG - Intergenic
1102749953 12:115284098-115284120 GCTCCCTGGAGGGAGTAGGAAGG - Intergenic
1103462936 12:121119478-121119500 GATCGCTGGAGGCCCCAGGAAGG - Intergenic
1104063261 12:125285714-125285736 GATCCCTGGTAGCAACATGAGGG + Intronic
1104422572 12:128649306-128649328 CCTCCCTGGTGGCACAATCAAGG - Intronic
1104477949 12:129085511-129085533 GATCTCTGGAGGCAGAATGAGGG - Intronic
1104648973 12:130517473-130517495 GCGCCCAGGAGGCCCCATCATGG + Intronic
1104929513 12:132330155-132330177 GGGCCCTGGAGCCACCAGGAGGG + Intergenic
1105062084 12:133162115-133162137 GCTGCCTGGAGACCACATGATGG + Intronic
1106298514 13:28440403-28440425 CTTCCCTGGCGGCACCCTGAAGG + Intronic
1106418927 13:29569438-29569460 GCTCCCTGCAGGGCCCCTGATGG + Intronic
1111468428 13:88646425-88646447 GCTCACTGGAGGCACCACTGGGG - Intergenic
1111843086 13:93473728-93473750 ATTCCATGGAGACACCATGATGG - Intronic
1113754017 13:112796543-112796565 TCTCCCTGGAGCCTCCAGGAAGG + Intronic
1115439275 14:33413336-33413358 GGTCCCTGGAAGCTGCATGAGGG + Intronic
1117776393 14:59188878-59188900 GCTCCGGGGAGGCAGCAGGAGGG - Intronic
1121668029 14:95687017-95687039 GCAGCCTGGAGGCACCAGGTGGG + Intronic
1121825731 14:97008218-97008240 GCACCCTGGAGGCTCCCTCATGG - Intergenic
1122764331 14:104055053-104055075 GGTTCTTGGAGGCACCATGGTGG + Intergenic
1123002948 14:105306050-105306072 GCTCTCTGGGGCCCCCATGAAGG - Exonic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1123448189 15:20344620-20344642 GCTCCCTGGAAGCACCAATCTGG - Intergenic
1125779686 15:42253530-42253552 CCTGCCTGGAGGCTCCCTGAAGG - Intronic
1127292997 15:57586769-57586791 GCTCCCAGGAGAAACCAGGAAGG - Intergenic
1130744334 15:86634966-86634988 GTTCCCTTTAGACACCATGAGGG - Intronic
1131021591 15:89103822-89103844 GCTCCCTGGAGGCCCAGTGTTGG + Intronic
1132038309 15:98504557-98504579 GCTTCTGGGAGGCACCTTGAAGG - Intronic
1132731391 16:1363913-1363935 GAGCCCTGGAGACACCCTGAGGG + Exonic
1133098982 16:3467602-3467624 GCACCCTGTGGGCATCATGAGGG + Intronic
1133448640 16:5884810-5884832 GCTCTCAAGAGGCTCCATGAGGG + Intergenic
1135026905 16:19005794-19005816 GCTCCCTAGAGCCAATATGAGGG - Intronic
1135120245 16:19760179-19760201 GCTTGCTGGAGGCATCATGAAGG + Intronic
1135177438 16:20243028-20243050 GCTCCCAGAATGCACCAGGATGG + Intergenic
1135940156 16:26815437-26815459 GCTACCTGAAGGCACTATCATGG - Intergenic
1139563663 16:67759394-67759416 GCTGCCTGGAGGCACCCTATAGG + Intronic
1139589992 16:67928229-67928251 GCTCCCTGGAGGCACCATGAAGG - Exonic
1139781029 16:69351598-69351620 GCCTCCTGGAGGTATCATGATGG + Exonic
1141622126 16:85241908-85241930 CCTCCCGGCAGCCACCATGAAGG - Intergenic
1141859038 16:86704143-86704165 TCTCCCTGGAAGCCCCAAGAGGG + Intergenic
1143030146 17:3963382-3963404 GCACCTTGGAGGTCCCATGAGGG - Intronic
1146466406 17:33090087-33090109 TCTGCCTCGAGGCACCATGCGGG + Intronic
1146636799 17:34512478-34512500 GCTCCCTGGGAGCACCCTAAAGG + Intergenic
1147011574 17:37453447-37453469 GTTCCATGGAGGCACCTTCAGGG + Intronic
1147140825 17:38459746-38459768 GCTGCCAGGTGGCAGCATGAAGG - Intronic
1147951724 17:44111327-44111349 GCTGCCAGGAGGCCCCATGGGGG + Intronic
1148787979 17:50155045-50155067 TCTCCCTGCAGGGACAATGAGGG - Intergenic
1149507936 17:57211397-57211419 GGTCCCAGGAGGCACCCTCAAGG + Intergenic
1151971124 17:77458002-77458024 GCTTCCTGGACTCACCCTGAAGG + Intronic
1152340606 17:79721962-79721984 GCTCCCTGGAAGCACCAGTCTGG + Intergenic
1152567603 17:81107148-81107170 GCTGGCTGAGGGCACCATGAGGG - Intronic
1152567869 17:81108156-81108178 GCTCCCTGGGGGCAGGAGGAGGG + Intronic
1152787950 17:82261373-82261395 GCTACCTTCGGGCACCATGAGGG - Intronic
1153666178 18:7369402-7369424 GCTCAGTGGAGTTACCATGATGG + Intergenic
1157554128 18:48601806-48601828 GTTTCCTGGAGGCAGCCTGAGGG + Intronic
1158076608 18:53537128-53537150 GCTCCCAGGAGAAACCATTAGGG - Intergenic
1158556253 18:58477171-58477193 CCACCCTGCAGGCACCAGGAAGG + Intergenic
1159305956 18:66642356-66642378 GCTCCCTGGAAGACCCATAAAGG + Intergenic
1159925474 18:74265289-74265311 GCTCTCTGGAGGCAAGATGATGG - Intronic
1160506301 18:79428439-79428461 GCTCCCTGGAGGCACCACAAAGG - Intronic
1160578438 18:79870077-79870099 ACTCACTGGAGGTCCCATGAGGG - Intronic
1160705169 19:526174-526196 TCTCCCTGGAGCCCCCAGGAGGG - Intergenic
1161454589 19:4363647-4363669 GCTCCCTTGAGGCACCACCCCGG + Intronic
1161681760 19:5683365-5683387 GCTCTCTGGAGACACCCAGAAGG - Intronic
1162043566 19:7984712-7984734 GGTGCCTGGAGGCAGCAGGAAGG + Intronic
1163688421 19:18725331-18725353 GCTCCCTGGAGGCCACAGGGAGG - Intronic
1164098444 19:22032732-22032754 GCTGCCTGTGGGCAGCATGAAGG + Intergenic
1164100287 19:22048721-22048743 GCCCCCTGTAGGCAGCATCAAGG + Intergenic
1164201392 19:23021810-23021832 GCCCCCTGTGGGCAGCATGAAGG + Intergenic
1165030450 19:32994531-32994553 GCTCACTGGAGGCACCCAAATGG - Intronic
1165759210 19:38310710-38310732 GCTCACTGAATGCACCAGGAAGG + Intronic
1166183173 19:41122884-41122906 GCTCTTTGGCGGCACCAAGACGG + Exonic
925300288 2:2806937-2806959 GCTCCCGAGAGGGACCATGCAGG + Intergenic
928660051 2:33492837-33492859 GATCCATGGAGGCATCAGGATGG + Intronic
929188585 2:39120416-39120438 GCGCCCCGGGGGCACCATGCAGG - Exonic
932011129 2:67978224-67978246 GCACCCAGGAGGCACTAAGAAGG - Intergenic
933258637 2:80107819-80107841 GCTCCATGCAGGCCCCATGGTGG - Intronic
935146484 2:100398972-100398994 GTTCTCTGGAGGCATCCTGAGGG + Intronic
935284439 2:101551455-101551477 GCTTCCTGGATGCAACATGAGGG + Intergenic
936051574 2:109227888-109227910 GTTCCCTGTAGGCTTCATGATGG + Intronic
936974382 2:118204656-118204678 GTTCCCAGGAGGCAGCAGGAAGG - Intergenic
937122701 2:119451899-119451921 GCTCCCTGCAGGTGCCAGGAGGG - Intronic
937896334 2:126979191-126979213 GCTCTCTGGAGGAACCAGCAGGG - Intergenic
938693599 2:133815283-133815305 GCTGCCTGGAGACCACATGATGG + Intergenic
938698246 2:133853991-133854013 TCTCCCTGGAGGCATGAAGAAGG + Intergenic
940987012 2:160061011-160061033 GCTCCCTGGAGGCTTAATCAGGG - Intronic
944586589 2:201178721-201178743 GCACCCTGGGGGCCCCAGGAAGG + Intergenic
945264956 2:207881844-207881866 GCTGCTTGGAGGCACCATCCTGG + Intronic
945431669 2:209772054-209772076 ACTCCCGGGAGCCACCATTATGG + Exonic
946010868 2:216562526-216562548 TCTCCCTGGGGGCAGCAAGATGG - Intronic
946334385 2:219027755-219027777 GCTCTCTGGAGTCACCCAGAAGG + Exonic
946811596 2:223531100-223531122 GCTCCATGCAGGCCCCATGGTGG - Intergenic
948280934 2:236747638-236747660 GCTCCCTGCAGGCCCTCTGAGGG - Intergenic
948437324 2:237962361-237962383 GCTCCCTGGAGGCACCTGGTAGG + Intergenic
948599310 2:239099447-239099469 GCTGCCTGTGGGCCCCATGAGGG - Intronic
1169048952 20:2560101-2560123 TCTCCATGGAGGAACCCTGATGG - Intronic
1170119447 20:12895652-12895674 GATCCCAGGAGGCACCTGGAGGG - Intergenic
1170244376 20:14204523-14204545 GCTTCCTGGAGTCCACATGATGG - Intronic
1171198672 20:23223866-23223888 GCTCCCAGGGGTCACCAAGAGGG + Intergenic
1173022080 20:39275057-39275079 TCTCCCTGGAGGAAGCCTGAAGG + Intergenic
1175870867 20:62208858-62208880 CCTCCCGGGAGGCACCACTAAGG - Intergenic
1177009619 21:15716212-15716234 GCTTGCTGGAGACACAATGATGG - Intergenic
1179250421 21:39667100-39667122 CCTCCCTGGAGGCTGCAGGAGGG + Exonic
1180636896 22:17268981-17269003 GCTCCCTGGAGCCACATGGAAGG - Intergenic
1181083230 22:20427492-20427514 GCTTCCTGGAGCCACCCTCAGGG - Exonic
1183317518 22:37145076-37145098 GCTCCCTCGAGGGACAGTGAGGG - Intronic
1183540090 22:38424816-38424838 GCTGCCCGGAGTCGCCATGAAGG + Intergenic
1183754919 22:39752800-39752822 CCTCCCTGGAGGGATGATGAAGG + Intronic
1184594596 22:45506156-45506178 GCTCCCTGGCGGCTCCTTGGAGG + Intronic
1184932861 22:47693932-47693954 TCCCCCTCAAGGCACCATGATGG + Intergenic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
950678949 3:14571676-14571698 GCTCACTGTAGGGAACATGAGGG + Intergenic
953082464 3:39633676-39633698 GCTGCATGGAGGCCCCATGCTGG - Intergenic
953443495 3:42941278-42941300 CCTCTCGGCAGGCACCATGATGG - Exonic
954365087 3:50141352-50141374 GCCTCCTGCAGGCCCCATGATGG - Intergenic
960297891 3:115966912-115966934 CCTCCCTGGTGGCATCCTGAAGG + Intronic
961734601 3:128993641-128993663 GCTCCCGGGAGCCACCAGGCGGG + Intronic
962258377 3:133887331-133887353 CCTCCCTGGGGGCACAATGTGGG - Intronic
964065244 3:152570213-152570235 GCTCCCTGGAGGCAATATGCAGG - Intergenic
968506874 4:974776-974798 GCTGCCTGGGGGCAGCAGGAAGG + Intronic
968509340 4:988478-988500 GCACCTTGGAGGCTGCATGATGG + Exonic
968824755 4:2886790-2886812 TTTCCCTGCAGGCACCAGGAAGG - Intronic
969046845 4:4342529-4342551 GCTTCCAGCAGGCACCATGAAGG + Intergenic
969195985 4:5564216-5564238 TCTGCCTAGAGGCACCATGGTGG - Intronic
969306174 4:6327453-6327475 GCCCCCTGGTGGCAGCTTGAAGG + Intronic
971024187 4:22571747-22571769 GCTGCCTGGAGACTACATGAAGG - Intergenic
985961431 5:3306075-3306097 CCTCCCTGGGAGCACCCTGATGG - Intergenic
986667241 5:10114365-10114387 GCTCCCAGGAGACACCAAGAGGG - Intergenic
986810956 5:11359559-11359581 GATCTCTGGAGCCACCATGCTGG + Intronic
987699664 5:21380683-21380705 GCTGCCTGGAGACAGCATGGAGG + Intergenic
988752746 5:34207375-34207397 GCTGCCTGGAGACAGCATGGAGG - Intergenic
989254970 5:39356624-39356646 GCTCACTGGAAGCACAGTGAAGG + Intronic
991740519 5:69668189-69668211 GCTGCCTGGAGACAGCATGGAGG - Intergenic
991756981 5:69884978-69885000 GCTGCCTGGAGACAGCATGGAGG + Intergenic
991792094 5:70247930-70247952 GCTGCCTGGAGACAGCATGGAGG - Intergenic
991819979 5:70544294-70544316 GCTGCCTGGAGACAGCATGGAGG - Intergenic
991836384 5:70760860-70760882 GCTGCCTGGAGACAGCATGGAGG + Intergenic
991884540 5:71248256-71248278 GCTGCCTGGAGACAGCATGGAGG - Intergenic
994541330 5:101101771-101101793 TCTCCCTGCTGGCAGCATGAAGG + Intergenic
997526949 5:134559760-134559782 GCTCCCTGGAGCCCCTATGGCGG + Intronic
997625562 5:135328489-135328511 GCTTCCTGGAGGAAGCATAAGGG + Intronic
999143035 5:149375261-149375283 GCTCCCTGAGAGCACCAGGAGGG - Intronic
999208874 5:149870460-149870482 GCTCCCTGGTGGCTTCAGGAGGG + Intronic
1001051217 5:168416014-168416036 GCTCTCTGGAAGCCCCATGATGG - Intronic
1001426978 5:171629232-171629254 ACCCCATGGGGGCACCATGATGG + Intergenic
1001602505 5:172938280-172938302 GTTCCCTGGTGCCTCCATGAAGG + Intronic
1001646025 5:173283115-173283137 GCTGCCTTGAGGAACCAGGATGG - Intergenic
1001859216 5:175038508-175038530 ACTCACTGGAGGCAGCATGAGGG - Intergenic
1002662838 5:180803032-180803054 GCTCCCTGGCGCAACCCTGAGGG + Intronic
1005550911 6:26914152-26914174 GCTGCCTGGAGACAGCATGGAGG - Intergenic
1006219172 6:32473485-32473507 GCTCCCTGGAGGCTCCCGCATGG - Intergenic
1006726788 6:36204898-36204920 GCTCCATGGAGGGATCAAGAAGG - Intronic
1006985745 6:38174581-38174603 GCTACCTGGAGGCACCCTTTAGG - Exonic
1009339889 6:62541374-62541396 GCTACCTGGAGTCCACATGAAGG + Intergenic
1012474010 6:99601988-99602010 GCTCACTGGAGCCTCCATCATGG - Intergenic
1015894088 6:137999528-137999550 GCTCCCTGGAGGCCTCCTGCAGG - Intergenic
1017775177 6:157675106-157675128 GCTCCCCAGAGGCCCCAGGAAGG + Exonic
1017889161 6:158624974-158624996 GCTTCCTGGAGGGACCTTCAGGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1019280136 7:195543-195565 GCTCCCTGCAGGCCGCATGCGGG + Exonic
1020070495 7:5223858-5223880 GCTCCCTGGAGGCACCATTCAGG - Intronic
1021609588 7:22444494-22444516 GGTCCCTGGAATCCCCATGATGG - Intronic
1028345846 7:89780641-89780663 ACTCGCTGGAGGTAACATGAGGG - Intergenic
1028402847 7:90443037-90443059 GCTTCATGGATGTACCATGAAGG + Intronic
1028446228 7:90927185-90927207 CCTCCCTGGAGGCACATTGGTGG + Intronic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1028921504 7:96315128-96315150 GCACCCTGGAGACACCAGGCAGG + Intronic
1031083176 7:117277996-117278018 CCTCCCTGGGGGCCCCAGGATGG - Exonic
1034111299 7:148540343-148540365 GCTCTCTGGAGACACAATCATGG + Intergenic
1034517809 7:151594229-151594251 ACTCCCAGGAGGAAGCATGAAGG - Intronic
1035655808 8:1303830-1303852 ACTCCCGGGAGGCACCCTGCAGG + Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG + Exonic
1038427653 8:27474593-27474615 TCCCCCTGGAGGCACCATTCTGG - Intronic
1039924448 8:41916255-41916277 GCACCGTGGATGCACCTTGAGGG - Intergenic
1040598061 8:48859387-48859409 GCTCCCGGAAGGGACCCTGATGG - Intergenic
1042649596 8:71024590-71024612 GCTCCCTGGAGTCTGCATAATGG - Intergenic
1044697382 8:94936789-94936811 GCTCCCTGGAGGTGCCATCCTGG + Intronic
1046285546 8:112088567-112088589 TCTTCCCAGAGGCACCATGAAGG - Intergenic
1046634825 8:116662746-116662768 GCTCCTGGCAGGCACCATCAAGG + Intronic
1048284939 8:133134281-133134303 CCTCCCTGGAGGCTCTAGGAAGG + Intronic
1048738306 8:137526348-137526370 GCTACCTGAAGCCACCATGCTGG - Intergenic
1048969121 8:139634547-139634569 GCTGCCTGGATTCTCCATGAGGG + Intronic
1049437817 8:142595769-142595791 GGTCCCTGGAGGGCCCATGCAGG - Intergenic
1049520805 8:143089223-143089245 GGTCCCTGCAGGCTCCATGGTGG - Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1049673733 8:143880631-143880653 GCTCCATGGAGTCACCGTGCTGG + Intergenic
1052871951 9:33515894-33515916 AATCCCTGGAGGCAACAGGAAGG + Intergenic
1057448560 9:95136871-95136893 CCTCCCTGGAGGGAGCATGAGGG + Intronic
1057685650 9:97232056-97232078 AATCCCTGGAGGCAACAGGAAGG - Intergenic
1057830237 9:98400663-98400685 GCTCCCTGCAGGAGCCATGGTGG - Intronic
1058680734 9:107438244-107438266 GCAGCCTGGAGGCAACATCAGGG - Intergenic
1060963103 9:127695022-127695044 GCTCCCAGGAAGCACAGTGAGGG + Intronic
1061167914 9:128934988-128935010 GCTCCCTAGAGCCACCCTAAGGG + Intronic
1061182432 9:129032690-129032712 GCTCCATGCAGGCCCCATGGCGG - Intergenic
1062197598 9:135282869-135282891 GCTCCCTGGAGGGTGCATGGCGG + Intergenic
1062562082 9:137146201-137146223 GCTCCCTGGAGGCCCCAGCCGGG + Intronic
1203423565 Un_GL000195v1:17098-17120 GCTCCCTGTGGGCAGCACGAAGG + Intergenic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1185705333 X:2262614-2262636 GCTTCCTCAGGGCACCATGAAGG + Intronic
1186141115 X:6574958-6574980 ACTCCCTGGAGGGACCAGCAGGG - Intergenic
1187039469 X:15578641-15578663 GTTCCCTAGAAGCACCAAGAAGG + Intronic
1189377994 X:40480731-40480753 GATCCCGGGAGGCATGATGAGGG + Intergenic
1190892842 X:54586309-54586331 GCTCCCTGGAAACTTCATGAAGG + Intergenic
1192659629 X:73029076-73029098 GCTGCCTGGAGACCACATGATGG + Intergenic
1194807315 X:98345138-98345160 GCTGCCTGGAGACTGCATGAAGG - Intergenic
1199284078 X:146036961-146036983 GCTCTCTGGAGGAACATTGAAGG - Intergenic
1199834495 X:151575124-151575146 GCCCCCTGCAATCACCATGATGG - Intronic
1201622195 Y:15972461-15972483 GCTCCCTGGAGGGACCAGCATGG + Intergenic
1202119245 Y:21507670-21507692 CCTCCCTGGACACACAATGAAGG + Intergenic
1202121697 Y:21531210-21531232 CCTCCCTGGACACACAATGAAGG + Intronic
1202157308 Y:21898172-21898194 CCTCCCTGGACACACAATGAAGG - Intronic
1202159755 Y:21921713-21921735 CCTCCCTGGACACACAATGAAGG - Intergenic
1202186198 Y:22186628-22186650 CCTCCCTGGACACACAATGAAGG - Intergenic
1202205161 Y:22399768-22399790 CCTCCCTGGACACACAATGAAGG + Intronic