ID: 1139590365

View in Genome Browser
Species Human (GRCh38)
Location 16:67929732-67929754
Sequence GAGTAGCCATGCCGAGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139590365_1139590370 2 Left 1139590365 16:67929732-67929754 CCCCGGCCTCGGCATGGCTACTC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1139590370 16:67929757-67929779 GGAAGAGCCACTGCTACTCAAGG 0: 1
1: 0
2: 0
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139590365 Original CRISPR GAGTAGCCATGCCGAGGCCG GGG (reversed) Exonic
900955817 1:5885676-5885698 CAGAATCCAGGCCGAGGCCGAGG + Intronic
901220897 1:7583241-7583263 GAGGAGCCAAGCAGAGGCCCAGG + Intronic
915167866 1:153958550-153958572 GAGGAGCCGGGCCGAGGCCGCGG - Exonic
920113808 1:203605440-203605462 GAGAAGCAATGCCGAAGCTGTGG - Intergenic
1063667170 10:8069761-8069783 GCATAGCCGTGCTGAGGCCGAGG + Intronic
1067553545 10:47252426-47252448 GAACAGCCAAGCAGAGGCCGTGG + Intergenic
1069474613 10:68721524-68721546 GCGTCGCCATGCCGAGGCTGAGG - Intronic
1070302150 10:75211146-75211168 GGGTCGCCATGGCGAGGCCGCGG - Exonic
1075408238 10:122208979-122209001 GAGTAGCCAAGCCAAAGCTGGGG + Intronic
1075473274 10:122710190-122710212 GAATAGCCCTGCCAAGGCAGGGG + Intergenic
1076426598 10:130371469-130371491 GAGTAGCAAGGCCGAGGGCCTGG + Intergenic
1090788759 11:130070989-130071011 GAGGAGCCCTGCTGTGGCCGAGG + Intronic
1090958374 11:131534237-131534259 GAGTAGCCTGGTCGTGGCCGTGG - Intronic
1091068709 11:132542702-132542724 GAGTAGCAATGCTGGGGCCCAGG + Intronic
1096463833 12:51837395-51837417 GGGTATCCATGCCAAGGGCGTGG + Intergenic
1096578703 12:52570686-52570708 GAAGAGCAAGGCCGAGGCCGAGG - Exonic
1096584900 12:52613705-52613727 GAAGAGCAAGGCCGAGGCCGAGG - Exonic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1096614523 12:52824215-52824237 GAGGAGCCGGGCTGAGGCCGAGG - Exonic
1105326304 13:19373375-19373397 GAGTATCCAAGCAGAGGCTGGGG + Intergenic
1105867194 13:24471605-24471627 GAGTATCCAAGCAGAGGCTGGGG - Intronic
1105890776 13:24680901-24680923 GAGAAGCGGTGCCCAGGCCGGGG - Intronic
1113066608 13:106379138-106379160 GAGTAGGCAGGCAGATGCCGAGG - Intergenic
1113517677 13:110915448-110915470 GAGTAGCCAGGCAGAGGGCGGGG + Intergenic
1113888019 13:113671176-113671198 AAGGGGCCAGGCCGAGGCCGAGG - Intronic
1117214358 14:53535338-53535360 GAGTTGCAATGCTGTGGCCGGGG - Intergenic
1120012970 14:79437999-79438021 GAGAAGCCACGCTGAGGCCTGGG - Intronic
1123007762 14:105332640-105332662 GAGAAGCCATGCAGTGCCCGAGG - Intronic
1123033866 14:105463894-105463916 GAAGATCCCTGCCGAGGCCGAGG + Intronic
1124645701 15:31436405-31436427 GAGAATCCATGCCCAGCCCGTGG + Intergenic
1132547628 16:540536-540558 AACCAGCCAGGCCGAGGCCGGGG - Intronic
1133285987 16:4691081-4691103 GGGAAGCCAGGCAGAGGCCGTGG - Intergenic
1136929662 16:34407846-34407868 GAGAAGCCTTGCTGAGGCAGAGG + Intergenic
1136974912 16:35003959-35003981 GAGAAGCCTTGCTGAGGCAGAGG - Intergenic
1137487739 16:48905930-48905952 CAGGAGCCATGCAGAGGCCCCGG - Intergenic
1139590365 16:67929732-67929754 GAGTAGCCATGCCGAGGCCGGGG - Exonic
1142749723 17:1979945-1979967 GAGAAGCCATGCTGAGCCCCAGG + Intronic
1143218442 17:5241887-5241909 GAGAAGCCATGCAGAGCCCTGGG + Intergenic
1143638910 17:8184123-8184145 GAGTGGCCAGGCCCAGGCTGGGG - Intergenic
1151135602 17:71943420-71943442 GAGTGGCTATGCCAAGGCCATGG + Intergenic
1152513143 17:80803894-80803916 GAGCAGCCATGCCGGGACCAGGG + Intronic
1155238874 18:23847034-23847056 GAGTCCCCATGCAGAGGCCAAGG + Intronic
1157718811 18:49907798-49907820 GAGCAGCCTGGCCCAGGCCGGGG - Intronic
1161317466 19:3624396-3624418 GAGTAGCAATGCCGAGCACAGGG + Intronic
1161332438 19:3694709-3694731 GAATAGTCGCGCCGAGGCCGTGG - Intronic
1162817826 19:13207232-13207254 GAGGAGCCGCGCAGAGGCCGCGG - Exonic
925390892 2:3493149-3493171 GAGGAGCCCGGCCGAGGCAGGGG + Intergenic
927502224 2:23590546-23590568 CAGACGCCATGCCGAGGCCCTGG + Intronic
931737024 2:65205096-65205118 GGGTCGCCATGGCGAGGCCGCGG - Intergenic
944844519 2:203655520-203655542 GAGGAGTCAGGCCGAGGCAGTGG + Intergenic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172781715 20:37440336-37440358 AAGGAGCCCTGTCGAGGCCGTGG - Intergenic
1176286690 21:5022455-5022477 GAGGAGCCAGGCCGGGGGCGGGG + Intergenic
1179870491 21:44241020-44241042 GAGGAGCCAGGCCGGGGGCGGGG - Intergenic
1181807935 22:25386235-25386257 GAGTAGCCAGGCAGAGCCCTGGG - Intronic
950479921 3:13237876-13237898 GAGCAGCCAAGCCCAGGCAGGGG + Intergenic
954284006 3:49604935-49604957 GAGAGGCCATGCCAAGGCCCTGG - Intronic
955541422 3:59980618-59980640 GAGAAGCCATGGCCAGGCCAAGG + Intronic
967972501 3:195009794-195009816 TAGTAACCAGGCCGAGGGCGCGG + Intergenic
968472174 4:787179-787201 GAGTGGCCCTGCTGGGGCCGCGG - Intronic
968727276 4:2253626-2253648 GAGCAGACATGCCAAGGCTGGGG - Intronic
968811790 4:2803314-2803336 GAGTGGAGATGCCGAGGCCCTGG - Intronic
974581960 4:63814791-63814813 GAGTGGCCAGGCTGAGGCCCTGG + Intergenic
975169028 4:71212391-71212413 GAGTAGCCAGGAAGAGGCCCAGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979808265 4:125002338-125002360 GAGTAGCCATGCTCTGGCTGTGG - Intergenic
980397913 4:132239417-132239439 GAGTAGCCATGAGAAGGCCTTGG + Intergenic
985614479 5:911202-911224 GAGTGGCCATGCCCAGGTGGTGG + Intronic
990156174 5:52880053-52880075 GAGTAGCCATGAAGTGGCAGTGG + Intronic
993502071 5:88675852-88675874 CAGTAGCCGAGCCCAGGCCGGGG - Intergenic
997674209 5:135700759-135700781 GGGGAGCCATGCAGAGGCCCAGG - Intergenic
1007914911 6:45552445-45552467 GAGTAGCCAGGCAGAGGCTGAGG + Intronic
1007949457 6:45858530-45858552 GAATAGCCATGCCCAGCCCAGGG - Intergenic
1015502897 6:133952291-133952313 AAGTAGCCCTGCAGGGGCCGGGG - Intronic
1019125879 6:169839906-169839928 GAGTGGGCATGGCGAGGCCCTGG - Intergenic
1022113707 7:27245978-27246000 GATGAGCCATGCGGCGGCCGCGG + Exonic
1022758124 7:33316811-33316833 GAATAGCCATGCCAAGGACTGGG - Intronic
1035475391 7:159140456-159140478 GAGTGGCCAGGCTGAGGCCCCGG + Intronic
1038447278 8:27612791-27612813 GAAGAGCCATGCCAAGGCCAAGG + Intronic
1047081956 8:121472265-121472287 GCGCAGCCAGGCAGAGGCCGAGG + Intergenic
1047431680 8:124798624-124798646 GAGAAGACATGCCAAGGCCCAGG - Intergenic
1049221505 8:141430772-141430794 GAGCAGCCGTGCCAAGGCCCTGG + Intronic
1049374792 8:142284287-142284309 GAGGAGCCAGGCCCAGGCTGGGG - Intronic
1050838306 9:10112591-10112613 GATTAACCCTGCCCAGGCCGTGG + Intronic
1059109130 9:111538228-111538250 GAGCCGCCATGCCCAGCCCGTGG - Intronic
1192343435 X:70282091-70282113 GCGTGGCCATGCCCAGGCCTGGG + Intronic
1198534077 X:137569382-137569404 GAGTAGCCGCGCCGAACCCGAGG + Intronic