ID: 1139592240

View in Genome Browser
Species Human (GRCh38)
Location 16:67939776-67939798
Sequence CTGTGTGCAGTGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 705
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 651}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139592240_1139592243 -5 Left 1139592240 16:67939776-67939798 CCATCTTGCCTCACTGCACACAG 0: 1
1: 0
2: 2
3: 51
4: 651
Right 1139592243 16:67939794-67939816 CACAGCACTGAGCCTGTGGCTGG 0: 1
1: 0
2: 2
3: 43
4: 399
1139592240_1139592244 0 Left 1139592240 16:67939776-67939798 CCATCTTGCCTCACTGCACACAG 0: 1
1: 0
2: 2
3: 51
4: 651
Right 1139592244 16:67939799-67939821 CACTGAGCCTGTGGCTGGTGAGG 0: 1
1: 0
2: 3
3: 40
4: 382
1139592240_1139592247 18 Left 1139592240 16:67939776-67939798 CCATCTTGCCTCACTGCACACAG 0: 1
1: 0
2: 2
3: 51
4: 651
Right 1139592247 16:67939817-67939839 TGAGGAGTGAAACCTAGTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 141
1139592240_1139592246 17 Left 1139592240 16:67939776-67939798 CCATCTTGCCTCACTGCACACAG 0: 1
1: 0
2: 2
3: 51
4: 651
Right 1139592246 16:67939816-67939838 GTGAGGAGTGAAACCTAGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 113
1139592240_1139592242 -9 Left 1139592240 16:67939776-67939798 CCATCTTGCCTCACTGCACACAG 0: 1
1: 0
2: 2
3: 51
4: 651
Right 1139592242 16:67939790-67939812 TGCACACAGCACTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 51
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139592240 Original CRISPR CTGTGTGCAGTGAGGCAAGA TGG (reversed) Exonic
900214380 1:1473558-1473580 CGGTTTGCAGTGAGACAAGATGG - Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
901256595 1:7833985-7834007 GAGGGTGCAGTGAGCCAAGATGG - Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901482756 1:9537296-9537318 GAGTATGCAGTGAGCCAAGATGG + Intergenic
901638540 1:10681550-10681572 CAGGGTGCAGTGAGGACAGAGGG - Intronic
902313588 1:15600708-15600730 GGGTTTGCAGTGAGCCAAGATGG - Intergenic
902517551 1:16997452-16997474 ATGTGTGCAGTGGGGCAGGGTGG + Intronic
902604843 1:17563297-17563319 GAGGGTGCAGTGAGCCAAGATGG - Intronic
902786779 1:18738015-18738037 CTGTGTGCAGTGTGTAAATAGGG + Intronic
902913889 1:19624053-19624075 CCGGTTGCAGTGAGCCAAGATGG - Intronic
903066406 1:20702123-20702145 GTGTGTGCTGTGAGGCAACTGGG - Intronic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903311456 1:22460885-22460907 CTGTCTGCAGTGAGTAGAGAAGG - Intronic
903719507 1:25394051-25394073 AAGTTTGCAGTGAGCCAAGATGG - Intronic
903955712 1:27024030-27024052 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
904185211 1:28698608-28698630 GAGCTTGCAGTGAGGCAAGATGG + Intronic
904272288 1:29357969-29357991 GAGTTTGCAGTGAGGCGAGATGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905777894 1:40681896-40681918 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
906204127 1:43978311-43978333 CTGTGAACGGTGACGCAAGAGGG - Intergenic
907180073 1:52561733-52561755 CAGGCTGCAGTGAGCCAAGATGG + Intergenic
907858956 1:58332281-58332303 GTCTGTGCAGAGAAGCAAGATGG - Intronic
908491111 1:64645030-64645052 GAGTTTGCAGTGAGCCAAGATGG + Intronic
910196263 1:84642555-84642577 AAGGCTGCAGTGAGGCAAGATGG + Intergenic
910301944 1:85715790-85715812 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
910919703 1:92330510-92330532 GAGTTTGCAGTGAGCCAAGATGG - Intronic
911895511 1:103428688-103428710 GAGATTGCAGTGAGGCAAGATGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913007347 1:114647870-114647892 GAGTTTGCAGTGAGCCAAGATGG - Intronic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914522173 1:148427363-148427385 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
914771647 1:150691449-150691471 CAGGTTGCAGTGAGCCAAGATGG + Intronic
914998112 1:152562424-152562446 CTGTGGGCAGCCAGCCAAGATGG + Intronic
915493488 1:156265157-156265179 TTGGTTGCAGTGAGCCAAGATGG + Intronic
915604690 1:156943123-156943145 CAGGTTGCAGTGAGCCAAGATGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916033875 1:160903575-160903597 GAGGTTGCAGTGAGGCAAGATGG + Intergenic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
917169804 1:172158509-172158531 CAGTGTGCAGTGAGAAGAGAGGG + Intronic
917843558 1:179002213-179002235 GAGTTTGCAGTGAGCCAAGAAGG + Intergenic
918416596 1:184315386-184315408 GAGTGTCCAGTTAGGCAAGAGGG + Intergenic
920073751 1:203321913-203321935 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
920976885 1:210794677-210794699 CTGTGTGTGGTGAGTCATGAAGG + Intronic
922905115 1:229168433-229168455 CTGTGTGGGGGGAGGCAAGGGGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923594527 1:235350163-235350185 AAGCGTGCAGTGAGCCAAGATGG + Intergenic
924790708 1:247245172-247245194 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1062799079 10:366384-366406 ATGTGTTCAGTGAAGCCAGACGG - Exonic
1062823337 10:550940-550962 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823354 10:551022-551044 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1063215749 10:3923993-3924015 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1064000200 10:11657439-11657461 GAGTTTGCAGTGAGTCAAGATGG + Intergenic
1065474378 10:26118503-26118525 CTGAGTGGACTGGGGCAAGATGG - Intronic
1065566490 10:27016335-27016357 GAGGTTGCAGTGAGGCAAGATGG - Intronic
1065828348 10:29592185-29592207 GAGGTTGCAGTGAGGCAAGATGG + Intronic
1065884732 10:30066930-30066952 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1067317621 10:45182921-45182943 GAGTCTGCAGTGAGCCAAGATGG + Intergenic
1067337923 10:45379371-45379393 CTGTGTGCGGTGAGGACTGAGGG - Intronic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067785731 10:49244776-49244798 GTCTGTGCAGTGACACAAGAGGG + Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1069231381 10:66012963-66012985 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1069465809 10:68637802-68637824 ATGGTTGCAGTGAGCCAAGATGG + Intronic
1070419037 10:76218191-76218213 CTGTGTGCACTGAGGAAAAGAGG + Intronic
1070644257 10:78190532-78190554 AGGTGTGCAGAGAGGCAAGCAGG + Intergenic
1071204793 10:83261687-83261709 GAGTTTGCAGTGAGTCAAGATGG + Intergenic
1071583406 10:86794914-86794936 GAGTGTGCGGTGAGTCAAGATGG - Intronic
1071588467 10:86847994-86848016 AAGGGTGCAGTGAGCCAAGATGG - Intronic
1071675793 10:87654905-87654927 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1072504183 10:96047571-96047593 GAGGGTGCAGTGAGCCAAGATGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073158761 10:101371251-101371273 GAGTCTGCAGTGAGCCAAGATGG - Intronic
1073464209 10:103684421-103684443 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1073763824 10:106659935-106659957 GTGTGTGCAGTGAGGCTGTATGG + Intronic
1074307472 10:112292383-112292405 CTGAGTGCAGTGGGGCAGCAAGG - Intronic
1075062445 10:119266396-119266418 CAGTGAGCAGTGAGCCGAGATGG + Intronic
1075329533 10:121563307-121563329 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1075789339 10:125072213-125072235 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1076123989 10:127960478-127960500 CTGAGTGCTGAGGGGCAAGAAGG - Intronic
1076516216 10:131045856-131045878 CTGTTTGCATTTAGGCAACATGG - Intergenic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077131160 11:973409-973431 CTGTCAGCTGTGAGGCAAGGAGG + Intronic
1077586866 11:3460479-3460501 TTGTTTGCACTGGGGCAAGAAGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078217254 11:9321919-9321941 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1078519993 11:12055194-12055216 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1078529118 11:12122754-12122776 GTGTGTGCAGTGAAGAACGATGG + Intronic
1078764049 11:14276521-14276543 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1079424346 11:20326028-20326050 CTGTGGTCAGTGATTCAAGATGG + Intergenic
1079686782 11:23368728-23368750 CAGTTTGGAGTGAGCCAAGATGG + Intergenic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1080479561 11:32632288-32632310 GAGGTTGCAGTGAGGCAAGATGG - Intronic
1081372237 11:42317952-42317974 CTGTTTGCAATGTGTCAAGAGGG - Intergenic
1081699217 11:45142274-45142296 CAGGGTGCAGTGTGGCAAGAAGG - Intronic
1082105904 11:48221565-48221587 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1083034159 11:59621092-59621114 CTGGTTGCAGTGAGCCGAGATGG - Intergenic
1083212538 11:61197024-61197046 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1083373891 11:62204274-62204296 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
1083834373 11:65255726-65255748 GAGCTTGCAGTGAGGCAAGATGG - Intergenic
1083845523 11:65330348-65330370 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1083987379 11:66224464-66224486 CTGTGTGCAGTAAGTCAATCAGG - Intronic
1084033893 11:66496477-66496499 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1084242865 11:67834510-67834532 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1084299936 11:68242041-68242063 AAGTTTGCAGTGAGCCAAGATGG - Intergenic
1084759340 11:71259038-71259060 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1084800784 11:71542507-71542529 CTCTGTGCCGGGAGCCAAGAAGG + Intronic
1084830134 11:71762465-71762487 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085005174 11:73081367-73081389 GAGGGTGCAGTGAGCCAAGATGG + Intronic
1085885182 11:80513384-80513406 GTGGTTGCAGTGAGTCAAGATGG - Intergenic
1086258032 11:84903247-84903269 CTGTGTTCAGAGAGTAAAGAAGG - Intronic
1086504067 11:87484675-87484697 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1087601855 11:100327373-100327395 CTGTGTGCAGTCTGGAAAGAGGG - Intronic
1088225547 11:107616058-107616080 GAGGTTGCAGTGAGGCAAGATGG - Intronic
1088644126 11:111902875-111902897 GTGTGAGAAATGAGGCAAGAGGG - Intergenic
1089057339 11:115596667-115596689 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1089482253 11:118815591-118815613 GAGGCTGCAGTGAGGCAAGATGG - Intergenic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091462364 12:654128-654150 CAGGCTGCAGTGAGCCAAGATGG + Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092097914 12:5859598-5859620 GTGGTTGCAGTGAGCCAAGATGG - Intronic
1092413105 12:8269219-8269241 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1092799098 12:12145694-12145716 GTGGTTGCAGTGAGTCAAGACGG - Intronic
1093424083 12:19008727-19008749 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
1095271071 12:40220292-40220314 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1096862570 12:54540391-54540413 ATGTGTTTGGTGAGGCAAGAGGG + Intronic
1097209816 12:57358577-57358599 GAGAGTGCAGTGAGCCAAGATGG + Intronic
1097223663 12:57464456-57464478 GAGGTTGCAGTGAGGCAAGATGG + Intronic
1097289755 12:57904849-57904871 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1097684294 12:62677338-62677360 TTGCCTGCAGTGTGGCAAGAGGG - Intronic
1098035540 12:66298520-66298542 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1099417159 12:82404877-82404899 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1099793471 12:87364708-87364730 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
1099981417 12:89608231-89608253 CAGGCTGCAGTGAGCCAAGATGG - Intronic
1100162840 12:91880704-91880726 CTGTGTGCAGATAGACAATAGGG - Intergenic
1101750097 12:107576441-107576463 GTGTGCACAGTGGGGCAAGAGGG - Intronic
1102139809 12:110605351-110605373 CAGTGAGCAGTGAGCCGAGATGG + Intergenic
1102587500 12:113933409-113933431 CTGCGTGCAGTGAGGGCAGGAGG + Intronic
1102937325 12:116908710-116908732 ATGAGTGAAGTGATGCAAGATGG - Intergenic
1103461051 12:121105547-121105569 CAGATTGCAGTGAGCCAAGATGG + Intergenic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1104723349 12:131059238-131059260 CTGGCTGCAGTGAGCCAGGATGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105204946 13:18213738-18213760 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1105526266 13:21180609-21180631 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1106253398 13:28001212-28001234 CTGTGTGCAGCCAGGCACGCTGG + Intergenic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1106811220 13:33360267-33360289 GGGTTTGCAGTGAGCCAAGATGG - Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1107752411 13:43582636-43582658 GAGTGTGCAGTGAGCCATGATGG - Intronic
1108349048 13:49573846-49573868 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1108777222 13:53781436-53781458 CGGTGAGCAGGGAGGCACGAAGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110533801 13:76627925-76627947 GTATGTGTAGTGAGGCAAGAAGG - Intergenic
1111457137 13:88499655-88499677 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1112539675 13:100296303-100296325 GAGGCTGCAGTGAGGCAAGATGG - Intronic
1112645401 13:101325820-101325842 CTCTGTGAAATGAGGCCAGAAGG - Intronic
1112763433 13:102715895-102715917 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1113507351 13:110826373-110826395 CTGTGTCCAGTGATGCTGGATGG + Intergenic
1113705463 13:112429309-112429331 ATGACTGCAGTGAGCCAAGATGG + Intronic
1113850813 13:113416929-113416951 GTGTGTGCAGTGAGAGATGAGGG + Intergenic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114280675 14:21190281-21190303 CAATGTGCAATGAGGCAATAAGG + Intergenic
1114552339 14:23540050-23540072 GAGTCTGCAGTGAGACAAGATGG - Intronic
1114913628 14:27232994-27233016 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1117815366 14:59592546-59592568 CTGTGTGCAGAGAAGCACGTAGG - Intergenic
1118194005 14:63607814-63607836 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1118461322 14:65989680-65989702 CTGGTTGCAGTGAGCCGAGATGG + Exonic
1118542466 14:66843146-66843168 ATGAGTGAAGTGAGGCAAAAAGG - Intronic
1118762778 14:68890672-68890694 CAATGTGCAATGAGGCAAGCAGG + Intronic
1119034936 14:71221612-71221634 CAGGCAGCAGTGAGGCAAGATGG - Intergenic
1119296206 14:73535531-73535553 GTGCTTGCAGTGAGCCAAGATGG - Intronic
1119714090 14:76845951-76845973 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1119714785 14:76851420-76851442 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1121023765 14:90599337-90599359 CTATGTGCTGTGAGGGGAGAGGG - Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122485807 14:102078913-102078935 GTGACTGCAGAGAGGCAAGAAGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122588828 14:102830683-102830705 CTGTGTGCTGTGATGAGAGATGG + Intronic
1123202380 14:106678922-106678944 CCCTGTGCAGTGTGGCAAGTGGG + Intergenic
1125229682 15:37439020-37439042 AAGTGACCAGTGAGGCAAGAAGG + Intergenic
1125528773 15:40397145-40397167 CAGGCTGCAGTGAGCCAAGATGG - Intergenic
1126558534 15:50018050-50018072 AAGGGTGCAGTGAGCCAAGATGG - Intronic
1126611592 15:50535072-50535094 GAGTTTGCAGTGAGCCAAGACGG + Intronic
1126791657 15:52227083-52227105 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1127115986 15:55727729-55727751 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1127484969 15:59410499-59410521 CTGGGATGAGTGAGGCAAGAAGG + Intronic
1127873310 15:63091068-63091090 CTGGGAGCAGAGAGGCCAGACGG + Intergenic
1128259725 15:66224517-66224539 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1128667204 15:69547321-69547343 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1129692351 15:77721046-77721068 ATGTGAGCATTGAGGCAGGAGGG - Intronic
1130387068 15:83421369-83421391 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
1130389626 15:83444257-83444279 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1130557294 15:84931585-84931607 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1130789213 15:87134245-87134267 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1131504069 15:93000199-93000221 GAGGTTGCAGTGAGGCAAGATGG + Intronic
1131613461 15:93988905-93988927 GAGGTTGCAGTGAGGCAAGATGG + Intergenic
1131840850 15:96435725-96435747 CAGTTTGCAGTGAGCCGAGATGG + Intergenic
1131843054 15:96458535-96458557 CAGAGTGCCATGAGGCAAGAGGG - Intergenic
1132823134 16:1887351-1887373 TGGAGTGCAGTGAGCCAAGATGG + Intergenic
1133231532 16:4369312-4369334 CTGTGTGAAGAGAGCCAAGCTGG + Intronic
1134008799 16:10835892-10835914 GTGTGTGCAGTGAGGAAAGTGGG - Intergenic
1134230280 16:12423633-12423655 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1134252875 16:12587000-12587022 GAGATTGCAGTGAGGCAAGATGG + Intergenic
1134759821 16:16704363-16704385 GAGTTTGCAGTGAGTCAAGATGG - Intergenic
1134986251 16:18654842-18654864 GAGTTTGCAGTGAGTCAAGATGG + Intergenic
1135001929 16:18783978-18784000 CTATCTGCAGTGAGCCAAAAGGG + Intronic
1135579691 16:23615011-23615033 CAGATTGCAGTGAGCCAAGATGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135752687 16:25069488-25069510 AAGGGTGCAGTGAGCCAAGATGG + Intergenic
1136218505 16:28812064-28812086 CAGACTGCAGTGAGCCAAGATGG - Intergenic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1136774626 16:32865201-32865223 CTGTGTGCTGGGAGGCTACAAGG + Intergenic
1136895986 16:33996313-33996335 CTGTGTGCTGGGAGGCTACAAGG - Intergenic
1136927757 16:34389596-34389618 CTGTGTGCAGTGAGATCAGCAGG + Intergenic
1136976817 16:35022210-35022232 CTGTGTGCAGTGAGATCAGCAGG - Exonic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1137512862 16:49116525-49116547 GAGTTTGCAGTGAGTCAAGATGG + Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137630408 16:49939339-49939361 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
1137944205 16:52718050-52718072 CTGTGTGCGGTCAGGAAAGGAGG + Intergenic
1138395891 16:56704279-56704301 GAGGGTGCAGTGAGCCAAGATGG + Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138865219 16:60810041-60810063 ATGTGTGAACTGTGGCAAGAGGG + Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140395304 16:74621210-74621232 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1140802378 16:78500212-78500234 CTTTGTGCAGTGGGGAAAGGTGG + Intronic
1140932171 16:79637834-79637856 CTGTGTGCAGTTTGGGAAAAGGG + Intergenic
1140974846 16:80049901-80049923 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1141099374 16:81185898-81185920 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1141217153 16:82035322-82035344 CTGTGAACAGAGAGTCAAGAAGG - Exonic
1141237007 16:82228239-82228261 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1141932634 16:87216242-87216264 CTGTGAGCTGAGAGGCAAGTCGG - Intronic
1141962353 16:87417640-87417662 ATGGGAGCAGTGAGGCAAGGGGG + Exonic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142046517 16:87928831-87928853 CAGGGTGCAGTGAGCCGAGATGG - Intronic
1142062895 16:88042128-88042150 CTGGGTCCAGTGAGGTCAGACGG + Intronic
1203077053 16_KI270728v1_random:1127337-1127359 CTGTGTGCTGGGAGGCTACAAGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143118664 17:4594382-4594404 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1143454441 17:7057228-7057250 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1143464217 17:7124871-7124893 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1143661853 17:8329459-8329481 GAGTTTGCAGTGAGGCAACATGG + Intergenic
1143974547 17:10820379-10820401 GAGTCTGCAGTGAGCCAAGATGG - Intergenic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144694552 17:17293542-17293564 GTGTTTGCAGTGAGCCGAGATGG - Intergenic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1144933081 17:18875787-18875809 GAGGGTGCAGTGAGCCAAGATGG + Intronic
1145036432 17:19544018-19544040 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1145190162 17:20834034-20834056 GTGCTTGCAGTGAGCCAAGATGG - Intergenic
1145742404 17:27286505-27286527 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1146278212 17:31528795-31528817 CTGTGTCCAGTGGGGCAGGGTGG + Intronic
1146324241 17:31871826-31871848 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1146803394 17:35845064-35845086 CTAGGTGCAGTGAGGTAAAAAGG - Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147484115 17:40796102-40796124 GTGAGTGCAGTGAGCCAAAAAGG - Intronic
1147943725 17:44068279-44068301 CGGGTTGCAGTGAGCCAAGATGG - Intergenic
1148074816 17:44929148-44929170 CTGTCTGGGGTGAGGCAGGAGGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1148761401 17:50003587-50003609 CTGTGTCCGGTGAGGCAAGAGGG + Intergenic
1148940997 17:51211070-51211092 AAGTTTGCAGTGAGCCAAGATGG + Intronic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150260674 17:63787774-63787796 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1150287435 17:63962072-63962094 CTTTGTGGGGTGAGTCAAGAGGG - Intronic
1150798946 17:68263517-68263539 CTGTGTGCAGTGATGCCATCTGG + Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151782443 17:76256315-76256337 CAGGCTGCAGTGAGGTAAGAAGG + Intergenic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1151944425 17:77311719-77311741 CTCTGTGCATTGAGGCAACGTGG - Intronic
1151991617 17:77578800-77578822 CAGTTTGCAGTGAGCCGAGATGG - Intergenic
1152897267 17:82919810-82919832 CTGTGTGCAGGGACGCCAGGTGG + Intronic
1153469745 18:5430625-5430647 GAGGGTGCAGTGAGCCAAGATGG - Intronic
1155197500 18:23488673-23488695 GTGGTTGCAGTGAGTCAAGATGG + Intergenic
1155337828 18:24783461-24783483 CTGTGTGCTGTTAGGCAACTGGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1157885234 18:51360214-51360236 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1158454871 18:57597262-57597284 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1159521623 18:69532216-69532238 CTCTGTTCAGATAGGCAAGAGGG - Intronic
1159938349 18:74386452-74386474 ATGTGAGCAGAGAGGCCAGACGG + Intergenic
1159998775 18:74995308-74995330 CTGTGTGGAGAGTGGCCAGAGGG + Intronic
1160656281 19:272569-272591 GGGTGTGCAGTGAGCCGAGATGG + Intergenic
1160924915 19:1539440-1539462 CAGGGGGCAGTGAGTCAAGATGG - Intergenic
1161024011 19:2026763-2026785 GAGTTTGCAGTGAGCCAAGACGG + Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161244357 19:3241124-3241146 GTGGGTGCAGTGAGCCAAGATGG - Intronic
1161567149 19:5009794-5009816 GTGGCTGCAGTGAGCCAAGATGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161939210 19:7392174-7392196 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1162085417 19:8246018-8246040 AAGTGTGCAGTGAGGTATGATGG + Intronic
1162189103 19:8930779-8930801 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1162429061 19:10616073-10616095 GTGGCTGCAGTGAGCCAAGATGG + Intronic
1162603829 19:11691934-11691956 CAGCTTGCAGTGAGCCAAGATGG + Intergenic
1163059467 19:14748371-14748393 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163908826 19:20170507-20170529 CAGTGAGCAGTGAGTCAAGATGG + Intronic
1164658279 19:29940582-29940604 GAGGGTGCAGTGAGCCAAGATGG + Intronic
1165218134 19:34291922-34291944 AAGGGTGCAGTGAGCCAAGATGG - Intronic
1165471309 19:36006452-36006474 CTGTGAGCTGTGTGGCCAGAGGG - Exonic
1165767622 19:38361052-38361074 GTGTATGCACTGTGGCAAGAAGG + Intronic
1166283172 19:41808716-41808738 AGGTGTGCAGTCAGGGAAGAAGG - Intronic
1166495330 19:43298802-43298824 TTCTGTGCAGTTAGGCAAAAAGG + Intergenic
1166606520 19:44148213-44148235 TTGTGTGCACTGAGGCATGATGG + Intronic
1166877988 19:45909647-45909669 CAGGTTGCAGTGAGCCAAGAAGG - Intergenic
1166978546 19:46619428-46619450 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1167073910 19:47237316-47237338 CTGTGGGCTGTGAGTCCAGATGG + Intergenic
1168264222 19:55212993-55213015 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
1168527641 19:57101438-57101460 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
925196590 2:1930939-1930961 GTGTATGCAGTGCGGGAAGATGG - Intronic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926147244 2:10404303-10404325 CAGTGTGCTGGGAGGCAAAAGGG - Intronic
926253442 2:11169509-11169531 CGGTGGGCAGTGATTCAAGAAGG - Intronic
926728196 2:16014713-16014735 CTGGCTGCAGTGAGAGAAGATGG - Intergenic
926805706 2:16708914-16708936 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927776262 2:25906140-25906162 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
927801961 2:26108974-26108996 CAGGTTGCAGTGAGCCAAGATGG - Intronic
927847414 2:26478761-26478783 GAGTTTGCAGTGAGCCAAGATGG - Intronic
927961800 2:27245009-27245031 GAGGTTGCAGTGAGGCAAGATGG + Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928221633 2:29408145-29408167 GAGTTTGCAGTGAGCCAAGATGG - Intronic
928942603 2:36741911-36741933 TTGTGTGCTGTGATGCCAGAGGG - Intronic
929156754 2:38795380-38795402 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
929166591 2:38887859-38887881 GAGTCTGCAGTGAGCCAAGATGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929499091 2:42474461-42474483 CAGGTTGCAGTGAGCCAAGATGG + Intronic
929665271 2:43828898-43828920 AAGGTTGCAGTGAGGCAAGATGG + Intronic
929894986 2:45951895-45951917 GAGTTTGCAGTGAGCCAAGATGG - Intronic
929953543 2:46436450-46436472 CTGTAGACAGTGGGGCAAGAAGG - Intronic
930650640 2:53961040-53961062 GAGGTTGCAGTGAGGCAAGATGG + Intronic
930742776 2:54849551-54849573 GAGTTTGCAGTGAGTCAAGATGG - Intronic
931140958 2:59457058-59457080 CTTTGTGCAGTGAGGAAATTAGG - Intergenic
931771934 2:65504914-65504936 CTGGTTGCAGTGAGGGAAAATGG - Intergenic
932256156 2:70289013-70289035 GAGTTTGCAGTGAGCCAAGATGG - Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932457797 2:71860700-71860722 GTGTGTGCAGTGAGACAGGAGGG + Intergenic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934887288 2:98035967-98035989 CTGACTGCAGAGAGGCTAGAGGG + Intergenic
935050296 2:99519298-99519320 GAGTTTGCAGTGAGGCAAGATGG + Intergenic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
936383105 2:112005130-112005152 CAGGCTGCAGTGAGCCAAGATGG - Intronic
936559690 2:113526607-113526629 AAGTTTGCAGTGAGCCAAGATGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936777352 2:115989909-115989931 GAGTTTGCAGTGAGCCAAGACGG - Intergenic
936827434 2:116599513-116599535 CTTTCTGCAATGAGGCAAAAGGG + Intergenic
937365241 2:121256709-121256731 GAGGTTGCAGTGAGGCAAGATGG + Intronic
937409049 2:121656950-121656972 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
938248920 2:129798816-129798838 CTGTGTGCAGGGAGGACACAGGG - Intergenic
938376713 2:130812587-130812609 TTGTTTGCAGTGAGCCGAGATGG - Intergenic
938784141 2:134610001-134610023 CTGGGTGGGGTGAGGCAAAAGGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
938951529 2:136259112-136259134 ATGTGGGCAGTGAGGCAGTAAGG - Intergenic
939481052 2:142747484-142747506 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
939576116 2:143897169-143897191 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
939724715 2:145703077-145703099 ATGGATGCAGTGATGCAAGATGG - Intergenic
940107945 2:150118891-150118913 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
942122919 2:172796168-172796190 CTGGGTTCAGTTAGACAAGAGGG + Intronic
942144111 2:173008981-173009003 CTGTTTGCAGTGAGGCTTTAGGG - Intronic
942626821 2:177910114-177910136 CAGTGTGCAATGAGTCATGAAGG - Intronic
942750917 2:179286164-179286186 ATGGTTGCAGTGAGCCAAGATGG + Intergenic
942793777 2:179792437-179792459 GTGGTTGCAGTGAGCCAAGATGG - Intronic
943295581 2:186134000-186134022 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
944985356 2:205169993-205170015 GAGGTTGCAGTGAGGCAAGATGG - Intronic
944991027 2:205235657-205235679 TTGAGTGCAATGAAGCAAGATGG + Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945471220 2:210229689-210229711 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
945833626 2:214812885-214812907 AAGGTTGCAGTGAGGCAAGATGG + Intergenic
946494822 2:220185500-220185522 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
946628624 2:221642267-221642289 GTGGCTGCAGTGAGCCAAGACGG + Intergenic
946978070 2:225175315-225175337 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
947043866 2:225954692-225954714 AGGTTTGCAGTGAGCCAAGATGG + Intergenic
947617360 2:231566906-231566928 GAGTTTGCAGTGAGACAAGATGG + Intergenic
948011905 2:234655702-234655724 CTGCCTGAAGTGAAGCAAGATGG - Intergenic
948209612 2:236183189-236183211 GAGTTTGCAGTGAGTCAAGATGG - Intergenic
948717450 2:239874455-239874477 CTGAGTGCCGTGAAGCAGGAAGG - Intergenic
948909791 2:240997311-240997333 CTGTTTGCAGAGAGGCAAACTGG - Intergenic
1169135241 20:3193433-3193455 GAGGTTGCAGTGAGGCAAGATGG - Intronic
1169179827 20:3553971-3553993 CTGAGTGCAGTGAGTAAACAAGG - Intronic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1169219915 20:3816168-3816190 CTGAGAACAGTGAGGCAGGAAGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169363889 20:4975443-4975465 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1169478819 20:5958302-5958324 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1169493073 20:6087373-6087395 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1170775566 20:19371950-19371972 CAGGCAGCAGTGAGGCAAGATGG + Intronic
1171331492 20:24343051-24343073 AAGTTTGCAGTGAGACAAGATGG - Intergenic
1172202347 20:33135413-33135435 CTGACTGCAGTGGGGCAAAAAGG - Intergenic
1172283445 20:33724223-33724245 AAGGGTGCAGTGAGCCAAGATGG + Intergenic
1173020276 20:39261394-39261416 CAGTGTGCAGAGTGGAAAGAAGG - Intergenic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173481197 20:43400886-43400908 GAGTCTGCAGTGAGCCAAGATGG - Intergenic
1173797847 20:45875101-45875123 TTGCTTGCAGTGAGCCAAGATGG - Intronic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1176002503 20:62839165-62839187 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1176051823 20:63123943-63123965 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1176186216 20:63781074-63781096 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1177168493 21:17629313-17629335 GAGAGTGCAGTGAGCCAAGATGG + Intergenic
1177599957 21:23298246-23298268 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1178868408 21:36350241-36350263 GAGTGTGCAGTGAGCCAAGATGG + Intronic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180990405 22:19932366-19932388 CTATGTGCAGTGAGCCACCATGG - Intronic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181196562 22:21191266-21191288 CTGTTTGCAGTATGGCAAAATGG + Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1182176560 22:28295630-28295652 CTGTCTGCAGAGTGGAAAGAAGG - Intronic
1182305279 22:29363581-29363603 GAGGTTGCAGTGAGGCAAGATGG + Intronic
1182539767 22:31032494-31032516 CTGTAAGGAGTGAGCCAAGATGG - Intergenic
1183392755 22:37554931-37554953 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1183396822 22:37576385-37576407 GTGCTTGCAGTGAGCCAAGATGG + Intronic
1184500250 22:44867216-44867238 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1184705218 22:46207344-46207366 GAGCGTGCAGTGAGCCAAGATGG - Intronic
1185186340 22:49402836-49402858 GAGTTTGCGGTGAGGCAAGATGG + Intergenic
949241688 3:1880385-1880407 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
949404417 3:3699322-3699344 CTGGTTGCAGTGAGCCGAGATGG + Intergenic
949720027 3:6978211-6978233 ATGTGTAGAGGGAGGCAAGATGG + Intronic
949963227 3:9332183-9332205 GAGTTTGCAGTGAGCCAAGATGG - Intronic
950437652 3:12990272-12990294 GTGTGTGGAGTGAGGCCAGGTGG - Intronic
950545600 3:13636309-13636331 GTGTGTGCAGGGAGGCACGCGGG + Intronic
952267071 3:31797057-31797079 GAGTTTGCAGTGAGCCAAGATGG - Intronic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
953082037 3:39629708-39629730 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953407174 3:42665230-42665252 CTGTGTGGAGTGGGGCAGGCAGG + Exonic
953600987 3:44364675-44364697 GAGGTTGCAGTGAGGCAAGATGG + Intronic
953690559 3:45114479-45114501 CAGGTTGCAGTGAGCCAAGATGG - Intronic
953996980 3:47527355-47527377 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
954489045 3:50884153-50884175 GAGTTTGCAGTGAGGCGAGATGG - Intronic
954519855 3:51215170-51215192 GAGTTTGCAGTGAGCCAAGATGG - Intronic
954964783 3:54600645-54600667 CGGTGTGCTGTGAGGCAATGAGG + Intronic
955315166 3:57932606-57932628 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
955365322 3:58305632-58305654 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
955388771 3:58503036-58503058 CTGTGTGCCCTGGGGCAAGCAGG + Intergenic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956424036 3:69114570-69114592 GAGTTTGCAGTGAGCCAAGATGG - Intronic
957043356 3:75354271-75354293 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
957058207 3:75460406-75460428 ATGTTTGCACTGGGGCAAGAAGG - Intergenic
958795547 3:98703050-98703072 GTGGTTGTAGTGAGGCAAGATGG - Intergenic
959083940 3:101831703-101831725 GAGTTTGCAGTGAGCCAAGAAGG - Intronic
959208232 3:103341064-103341086 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959741715 3:109728318-109728340 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
960468648 3:118031983-118032005 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
960944764 3:122958401-122958423 CTGTCTGCAGTTTGGCAGGAAGG + Intronic
961295241 3:125879293-125879315 TTGTTTGCACTGGGGCAAGAAGG + Intergenic
961890663 3:130127868-130127890 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
962565780 3:136657755-136657777 CAGGTTGCAGTGAGCCAAGATGG + Intronic
962957619 3:140280663-140280685 CAGTGTGCCATGATGCAAGATGG + Intronic
963937931 3:151073648-151073670 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
964265182 3:154888000-154888022 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
964281147 3:155067373-155067395 GAGTTTGCAGTGAGCCAAGATGG - Intronic
964374502 3:156035854-156035876 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
965475227 3:169147833-169147855 GTGTGTGCACCGAGGCAGGAGGG + Intronic
965569441 3:170156660-170156682 GAGTTTGCAGTGAGCCAAGATGG - Intronic
965723370 3:171686057-171686079 GAGGGTGCAGTGAGCCAAGACGG + Intronic
966014339 3:175122700-175122722 GTGAGTGCAGTGAGGCCAGAGGG - Intronic
966215117 3:177493850-177493872 AAGTCTGCAGTGAGCCAAGATGG + Intergenic
966401246 3:179549620-179549642 TTCTGTGCAATGATGCAAGAGGG - Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
966746677 3:183283584-183283606 GAGGGTGCAGTGAGCCAAGATGG - Intronic
966857973 3:184208692-184208714 GAGTTTGCAGTGAGCCAAGATGG + Intronic
968037786 3:195562839-195562861 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
968399937 4:285314-285336 GTGTGTGCAGGGAGATAAGATGG + Intronic
969002046 4:3990285-3990307 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
969751957 4:9118224-9118246 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
969753663 4:9132758-9132780 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
969811869 4:9654524-9654546 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
970064360 4:12074946-12074968 CAGTTTGCAGTGAGCCAAGATGG - Intergenic
971018650 4:22513208-22513230 GAGTTTGCAGTGAGACAAGAAGG - Intronic
971101661 4:23473061-23473083 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973573189 4:52261139-52261161 CAGAGTGCAGGGAGGCCAGACGG - Intergenic
974107508 4:57486870-57486892 GAGGCTGCAGTGAGGCAAGATGG + Intergenic
976463319 4:85338382-85338404 CTGAGTGCAGTGAAGCTAGGTGG + Intergenic
976846673 4:89496516-89496538 CTGTGTGCAGTGGGCTAAGAAGG + Intergenic
979152217 4:117333961-117333983 GAGCTTGCAGTGAGGCAAGATGG - Intergenic
979910251 4:126356345-126356367 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
979957097 4:126967864-126967886 CTGTGTGGGATGATGCAAGAAGG + Intergenic
982131280 4:152230920-152230942 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
982158501 4:152543654-152543676 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
982876462 4:160657390-160657412 CAGTGTGCAATAAGGCAAAAAGG - Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
984118894 4:175717130-175717152 TGGTGTGCAGTGAGCCAAGTGGG - Intronic
985905574 5:2832834-2832856 CTTTGAGGAGTGAAGCAAGAGGG - Intergenic
987087392 5:14483510-14483532 CTGTGTGCTGTGAGGCCCGCAGG - Intronic
987276979 5:16373043-16373065 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
987568412 5:19624070-19624092 GAGTTTGCAGTGAGCCAAGATGG - Intronic
987667969 5:20969316-20969338 AGGTTTGCAGTGAGCCAAGATGG + Intergenic
988191474 5:27941585-27941607 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
990267731 5:54096476-54096498 TTGGTTGCAGTGAGCCAAGATGG - Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990800731 5:59599739-59599761 CTGTGTGCAGTGGAGTAAGTGGG + Intronic
991523319 5:67526232-67526254 GTGCTTGCAGTGAGCCAAGATGG + Intergenic
992165311 5:74044497-74044519 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
992338562 5:75798758-75798780 CACTGTGCAGGGAGCCAAGATGG - Intergenic
992506502 5:77392391-77392413 CTGGCAGCAGTGAGACAAGATGG + Intronic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
992707467 5:79411418-79411440 ATGGCTGCAGTGAGTCAAGATGG + Intronic
992888358 5:81181559-81181581 TTATCTGCAGTGAGGCAAAATGG - Intronic
993049674 5:82912176-82912198 CTGTGTGTGGTGAGGCAACTGGG - Intergenic
993234653 5:85289096-85289118 CAGTTTGCAGTGAGCCCAGATGG + Intergenic
993644904 5:90450706-90450728 AGGTTTGCAGTGAGCCAAGATGG - Intergenic
994101063 5:95893447-95893469 GAGTTTGCAGTGAGCCAAGATGG - Intronic
994592740 5:101792245-101792267 GTGTGTACAGTGAGACACGAGGG - Intergenic
994767289 5:103934954-103934976 GTATCTGCAGTGAGGCAGGAGGG - Intergenic
995347509 5:111137487-111137509 CTCTGTTCAGTGAGGCATCAGGG - Intergenic
995509882 5:112897992-112898014 GTGGTTGCAGTGAGCCAAGATGG + Intronic
997007302 5:129833238-129833260 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
998635929 5:143954575-143954597 CAGTTTGCAGTGAGTCGAGATGG + Intergenic
998832977 5:146179165-146179187 GTGGTTGCAGTGAGCCAAGATGG + Intronic
999369384 5:151044670-151044692 CTGTGTGGAGAGGGGCTAGACGG + Intronic
999673689 5:153978484-153978506 CAGGCTGCAGTGAGCCAAGATGG + Intergenic
999967837 5:156828860-156828882 AGGTTTGCAGTGAGCCAAGATGG + Intergenic
999973869 5:156891714-156891736 CTCTGTGCAGAGAGGAAATATGG + Intergenic
1000103777 5:158039505-158039527 GTGTGTGTAGTGAGACAAGGAGG + Intergenic
1001004055 5:168034274-168034296 GAGGGTGCAGTGAGCCAAGATGG + Intronic
1001455085 5:171854083-171854105 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002013264 5:176301712-176301734 GGGGTTGCAGTGAGGCAAGATGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002484930 5:179528618-179528640 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003821077 6:9897793-9897815 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1004930345 6:20457237-20457259 GAGGGTGCAGTGAGCCAAGATGG - Intronic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005453436 6:25996001-25996023 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1007383810 6:41507260-41507282 GAGGGTGCAGTGAGCCAAGATGG - Intergenic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1008016974 6:46531777-46531799 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1008330518 6:50239911-50239933 CTGTGTGCAATGAGCCCAGTGGG - Intergenic
1008741110 6:54609327-54609349 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1009480443 6:64151423-64151445 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1009488331 6:64254147-64254169 ATGGGTACAGTGAGGCAAGAGGG - Intronic
1010236236 6:73577017-73577039 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1011249794 6:85359094-85359116 GAGGTTGCAGTGAGGCAAGATGG + Intergenic
1011509675 6:88086812-88086834 CTGTGTGCAGTCAGTCTAGCTGG - Intergenic
1011764796 6:90608926-90608948 GTGTTTTCCGTGAGGCAAGAGGG - Intergenic
1012557558 6:100534176-100534198 AAGGGTGCAGTGAGCCAAGATGG + Intronic
1013229806 6:108152011-108152033 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1013268278 6:108521432-108521454 GAGGTTGCAGTGAGGCAAGATGG + Intronic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013786902 6:113791633-113791655 CAGGCTGCAGTGAGGCAAGATGG + Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1017360702 6:153566100-153566122 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1017435880 6:154415293-154415315 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1017577130 6:155817553-155817575 ATGCATGCAGTGAGGCAGGAGGG - Intergenic
1017796757 6:157851652-157851674 GAGGGTGCAGTGAGCCAAGATGG - Intronic
1017798640 6:157871314-157871336 CAGGCTGCAGTGAGCCAAGATGG + Intronic
1018151429 6:160943671-160943693 GAGGCTGCAGTGAGGCAAGATGG - Intergenic
1018589126 6:165397635-165397657 GTGATTGCAGTGAGCCAAGATGG + Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019127685 6:169851871-169851893 CTGTGACCTGTGAGGCAAAAGGG - Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1019808346 7:3145670-3145692 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1019862112 7:3668724-3668746 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1020196668 7:6045170-6045192 GTGATTGCAGTGAGCCAAGATGG - Intronic
1020287203 7:6693266-6693288 CTATGTGGAATGAGGAAAGAAGG - Intronic
1021021026 7:15599225-15599247 CTGGCTGCAGTGAGGCAGGCTGG + Intergenic
1021053007 7:16012701-16012723 AAGTTTGCAGTGAGCCAAGATGG - Intergenic
1021475286 7:21054178-21054200 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1021482758 7:21135996-21136018 CTGTGTGTAATGAGGCATAAAGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022673846 7:32480124-32480146 CTCAGTGCAGTGATGCAAGTGGG - Intergenic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1023178441 7:37456519-37456541 GAGGTTGCAGTGAGGCAAGATGG + Intergenic
1024328680 7:48134647-48134669 CAGTTTGCAGTGAGCCGAGATGG - Intergenic
1026038914 7:66849594-66849616 GAGGTTGCAGTGAGGCAAGATGG + Intergenic
1026433044 7:70367196-70367218 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1026864930 7:73817664-73817686 GAGGTTGCAGTGAGGCAAGATGG + Intronic
1027198904 7:76050094-76050116 TTGGTTGCAGTGAGCCAAGATGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1029192686 7:98782990-98783012 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1029210514 7:98904417-98904439 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1029453341 7:100655135-100655157 CAGCGTGCAGAGACGCAAGAAGG + Intronic
1031050660 7:116941709-116941731 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1032369517 7:131332986-131333008 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1032507151 7:132444317-132444339 GTGGTTGCAGTGAGCCAAGAGGG - Intronic
1032529334 7:132607329-132607351 TGGTGAGCAGTGAGGCAGGAGGG - Intronic
1032835166 7:135665964-135665986 GAGGGTGCAGTGAGCCAAGATGG - Intronic
1033354420 7:140587973-140587995 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1034204699 7:149305270-149305292 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1034453032 7:151148028-151148050 CTTTGTAAAGAGAGGCAAGATGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1036000387 8:4596025-4596047 CTGTGGGCAGTGTGGCAAACAGG - Intronic
1036375171 8:8193656-8193678 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
1036537693 8:9666654-9666676 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1036854368 8:12229492-12229514 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1036875728 8:12471992-12472014 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1038331724 8:26614312-26614334 CAGTGTGCAGTGGGCCAAGAGGG + Intronic
1038890547 8:31717340-31717362 GTGGCTGCAGTGAGCCAAGATGG + Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039322423 8:36446627-36446649 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1039339067 8:36626997-36627019 GAGGTTGCAGTGAGGCAAGATGG - Intergenic
1040901294 8:52419625-52419647 CTGGGTGCAGGGAGAAAAGAAGG - Intronic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1041383624 8:57277883-57277905 TTCTCTGCAGTGATGCAAGAAGG - Intergenic
1042089118 8:65139501-65139523 GAGTTTGCAGTGAGTCAAGATGG + Intergenic
1042316454 8:67431302-67431324 AGGTTTGCAGTGAGCCAAGATGG - Intronic
1042370909 8:67990048-67990070 GAGGGTGCAGTGAGCCAAGATGG - Intronic
1042828618 8:73003301-73003323 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1042893591 8:73641292-73641314 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1042936994 8:74069665-74069687 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1044562540 8:93627165-93627187 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1044626989 8:94243533-94243555 CAGCTTGCAGTGAGCCAAGATGG + Intergenic
1044982612 8:97731680-97731702 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
1045495749 8:102706995-102707017 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1045829958 8:106446859-106446881 GAGTCTGCAGTGAGCCAAGATGG + Intronic
1046037865 8:108865620-108865642 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1046367674 8:113257344-113257366 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1046747650 8:117893513-117893535 ATTTGGGCAGTGAGGCAAGAAGG + Intronic
1046819527 8:118620831-118620853 CTGAGTGCAGTCAGGTCAGAGGG - Intronic
1047334297 8:123921427-123921449 AAGGCTGCAGTGAGGCAAGATGG - Intronic
1047426518 8:124751519-124751541 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1047860641 8:128962702-128962724 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1048386407 8:133916623-133916645 AAGTTTGCAGTGAGCCAAGATGG + Intergenic
1048963599 8:139599441-139599463 CTGGGTGCAGTGTGTCAAGCAGG + Intergenic
1049117103 8:140698516-140698538 GTGGTTGCAGTGAGCCAAGATGG - Intronic
1049154915 8:141060496-141060518 CTGTGTGCAGAGACGACAGAGGG + Intergenic
1049227888 8:141466378-141466400 GAGTGGGCAGTGAGGCAAGAGGG + Intergenic
1049537187 8:143187899-143187921 CTGCCTGCAGTGAGGGAAGGTGG + Intergenic
1049703781 8:144027926-144027948 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1051243058 9:15080552-15080574 CTGTGGGCAGTGAGGCATAAAGG - Intergenic
1051259866 9:15252581-15252603 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1051625427 9:19094724-19094746 GAGTCTGCAGTGAGCCAAGATGG + Intronic
1052840384 9:33288181-33288203 CAGTTTGCAGTGAGCCGAGATGG + Intergenic
1053107718 9:35426478-35426500 CTTGGTGAAGTGAGGCAAGCTGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1054454695 9:65423843-65423865 CTGTGTCCAGCGAGGTCAGATGG + Intergenic
1054783720 9:69190043-69190065 GAGTTTGCAGTGAGCCAAGATGG + Intronic
1054882858 9:70163291-70163313 AAGGTTGCAGTGAGGCAAGATGG - Intronic
1055046816 9:71934803-71934825 GAGTATGCAGTGAGCCAAGATGG + Intronic
1056430551 9:86523995-86524017 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1057042755 9:91859264-91859286 GTGGTTGCAGTGAGCCAAGATGG - Intronic
1057983540 9:99686203-99686225 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
1058322045 9:103644624-103644646 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1058391473 9:104500362-104500384 CAGTTTGGAGTGAGCCAAGATGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060569686 9:124626867-124626889 GAGTTTGCAGTGAGCCAAGAGGG + Intronic
1060905281 9:127299462-127299484 GAGTTTGCAGTGAGCCAAGATGG - Intronic
1060982392 9:127801009-127801031 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1061152409 9:128836361-128836383 GAGGTTGCAGTGAGGCAAGATGG - Intronic
1061270703 9:129540077-129540099 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1061427337 9:130507558-130507580 GAGGCTGCAGTGAGGCAAGACGG - Intergenic
1061544833 9:131298621-131298643 CTATGTGCACTGCGGGAAGAGGG - Intronic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1061943346 9:133894566-133894588 CTCTGTCCAGGGAGGCATGAGGG + Intronic
1062420003 9:136476070-136476092 CTGTATGCAGTGTGGCATCAGGG + Exonic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1185510969 X:665026-665048 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1185859145 X:3561601-3561623 GTGGTTGCAGTGAGACAAGATGG - Intergenic
1188299414 X:28489181-28489203 CAGTTTGCAGTGAGCCGAGATGG + Intergenic
1188327526 X:28823789-28823811 ATGTGATCAGGGAGGCAAGAAGG - Intronic
1188770275 X:34145771-34145793 GAGGGTGCAGTGAGCCAAGATGG + Intergenic
1188793445 X:34434086-34434108 CTGTCTTCAGTGGGACAAGAAGG - Intergenic
1189228432 X:39433083-39433105 CTTTGTGCAGTGGGGCCAGGTGG - Intergenic
1189307884 X:40000825-40000847 CTGGCTGCAGTGGGGTAAGAAGG + Intergenic
1189428092 X:40920464-40920486 CTTAGTGCAGTGAGGAAAAATGG - Intergenic
1189787782 X:44574505-44574527 GAGTTTGCAGTGAGCCAAGATGG + Intergenic
1190356757 X:49613043-49613065 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1192785803 X:74334409-74334431 GAGCTTGCAGTGAGGCAAGATGG - Intergenic
1193487831 X:82108419-82108441 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1194124358 X:89995707-89995729 CAGCTTGCAGTGAGCCAAGATGG - Intergenic
1194427457 X:93757210-93757232 GAGTTTGCAGTGAGCCAAGATGG - Intergenic
1194709029 X:97211634-97211656 AAGTGTGCAGTGTGGCAACATGG - Intronic
1194713832 X:97267964-97267986 CTGAGAGCAGTGAGCCAACAGGG - Intronic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1196691625 X:118564998-118565020 AAGGGTGCAGTGAGCCAAGATGG - Intronic
1198074308 X:133180128-133180150 CTGTGTTAAGTGGGGAAAGAAGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198467324 X:136915343-136915365 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1200105317 X:153708854-153708876 CTGTGTGCTGGGAGGCTACAGGG - Intronic
1200841156 Y:7783006-7783028 CAGTCTGCAGTGAGGCCGGATGG + Intergenic
1201320835 Y:12696883-12696905 GAGTTTGCAGTGAGCCAAGACGG - Intergenic