ID: 1139592379

View in Genome Browser
Species Human (GRCh38)
Location 16:67940479-67940501
Sequence CTGTGGATATGGAGCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139592367_1139592379 25 Left 1139592367 16:67940431-67940453 CCTCTTTCAGCTTGATGCTGGAC 0: 1
1: 0
2: 2
3: 11
4: 117
Right 1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 219
1139592373_1139592379 -10 Left 1139592373 16:67940466-67940488 CCCTGGTTGTCACCTGTGGATAT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139592379 Original CRISPR CTGTGGATATGGAGCAAGGT GGG Intronic
900131048 1:1087400-1087422 CAGTGGCTCTGGGGCAAGGTGGG + Intronic
900988227 1:6085717-6085739 CTGTGGACAAGGTGCAGGGTGGG - Intronic
901654243 1:10760234-10760256 CTCTGGAGATGGAGAAAGGCTGG + Intronic
902275164 1:15334420-15334442 CTGTGGTTATGGCTCAGGGTAGG - Intronic
905082810 1:35339630-35339652 CTGTGGGTTTTGAGCATGGTTGG + Intronic
905281203 1:36850470-36850492 TTGTCGATATGGAGGAAGATGGG - Intronic
905329166 1:37180083-37180105 CTGGGGGTGTGCAGCAAGGTGGG - Intergenic
905444502 1:38017329-38017351 CTTAGGATATGGTGCAAGCTTGG - Intronic
905687879 1:39921880-39921902 CTGAGGATATGAACCGAGGTGGG - Intergenic
905922797 1:41730444-41730466 CTGGGCATCTGGAGCAGGGTGGG - Intronic
907865841 1:58398335-58398357 CTTTAGAAATGTAGCAAGGTAGG - Intronic
908597937 1:65708598-65708620 CTGGGGATAGATAGCAAGGTGGG - Intergenic
910003217 1:82361893-82361915 TTGTGGCTAGGGAGAAAGGTGGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912614297 1:111082130-111082152 TTTTGTATATGGAGAAAGGTAGG + Intergenic
915040588 1:152965278-152965300 CTGTGGATATTGAGCAAAGGAGG + Intergenic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
916348854 1:163826096-163826118 GTGTGGAGATAGAGCAAGGAAGG - Intergenic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
922116223 1:222617573-222617595 CTGTTGAGATGGCGCAGGGTTGG + Intergenic
922222080 1:223616318-223616340 GTGTGGATGTGTAGGAAGGTAGG - Intronic
923311667 1:232741456-232741478 ATATGGATTTGGAGAAAGGTTGG + Intergenic
923660535 1:235953197-235953219 CTGTGGTTTTGGGGTAAGGTGGG - Intergenic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
1064781638 10:18845800-18845822 CTGTGGCAATCGATCAAGGTTGG + Intergenic
1066281216 10:33919994-33920016 CCATGGATATGAAGCAATGTGGG + Intergenic
1067179362 10:43973226-43973248 CAGGGCATATGGAGAAAGGTAGG - Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1070272777 10:74973849-74973871 CTGAGGATATGGACCCATGTTGG - Intronic
1070445464 10:76496467-76496489 CATTGGATATAGAGCAACGTAGG - Intronic
1071847166 10:89532814-89532836 CTATGAATATGGAGGAAAGTGGG + Intronic
1072015196 10:91340018-91340040 CTGATGATTTGGAGCATGGTAGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074406406 10:113183668-113183690 CTGTGCACAAGGAGCAAGGCCGG - Intergenic
1074418862 10:113291655-113291677 CTGGGGATATGGATCATGTTGGG + Intergenic
1075300461 10:121318091-121318113 CTTTGTATATGGTGTAAGGTAGG + Intergenic
1076148846 10:128146902-128146924 TTGTGGCTGTGGAGAAAGGTGGG + Intergenic
1076308962 10:129488872-129488894 ATGTGGATATAGAGCAAGAGAGG + Intronic
1076679158 10:132162877-132162899 CTGTGGGGATACAGCAAGGTGGG - Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1078215856 11:9311441-9311463 CGGTGGGTATGGAGGAGGGTAGG + Intronic
1080993198 11:37566974-37566996 TTTTGGATATGGTGTAAGGTAGG - Intergenic
1085511718 11:77091594-77091616 CTGTGGGTATGGTGGAGGGTGGG - Intronic
1085871910 11:80360251-80360273 CTGTGGATATGGCAAAAAGTTGG - Intergenic
1086101616 11:83106242-83106264 CTTTTGAAAAGGAGCAAGGTAGG - Intergenic
1086496104 11:87405953-87405975 TTTTGGATATGGAGGAAGGTAGG + Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1090045723 11:123331204-123331226 CTGTGCATATTGAGCAAAGTGGG + Intergenic
1090630852 11:128645999-128646021 CTGGGGATATGGGGCAAGTGGGG + Intergenic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1096618020 12:52845362-52845384 CTGAGGAAATGCAGGAAGGTCGG - Intronic
1096709315 12:53443598-53443620 CGGTGGGTATGGAGGAGGGTAGG - Exonic
1098045650 12:66397769-66397791 GAGTGGAGATGAAGCAAGGTTGG + Intronic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1102560939 12:113761939-113761961 CTGTGGATGGGGACCAAAGTGGG + Intergenic
1104613362 12:130248421-130248443 CTGGGGATTTGGAGCAAGAAAGG - Intergenic
1105059190 12:133132650-133132672 TTCTGGCTATGAAGCAAGGTTGG + Intronic
1105623005 13:22087360-22087382 CTGTGAACTTGGAGCAGGGTGGG + Intergenic
1106663024 13:31822256-31822278 ATGTGTTTATGAAGCAAGGTTGG - Intergenic
1108693995 13:52886724-52886746 ATGTGGATATTGAGAAACGTGGG + Intergenic
1111073685 13:83204465-83204487 ATGTGAATATGTAGCAAGATTGG + Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112741219 13:102474763-102474785 CTGTGGATATTGAAAAAGGAAGG - Intergenic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1116574420 14:46554657-46554679 TTGTGTATATGGTGAAAGGTAGG + Intergenic
1116659992 14:47697873-47697895 TTTTGGATATGGTGAAAGGTAGG - Intergenic
1119594060 14:75917632-75917654 GGGAGGATAAGGAGCAAGGTGGG + Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1124159366 15:27254799-27254821 CTGTGGAAATAGAGCACAGTTGG + Intronic
1124551902 15:30688898-30688920 CTGTGCATATGGACAAAGGGAGG - Intronic
1124594469 15:31081647-31081669 CTGTGGCTTTGGTGCGAGGTTGG - Intronic
1124965357 15:34429269-34429291 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1124981975 15:34575471-34575493 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1127277639 15:57461275-57461297 CAGGGGATATGAAGCAAGGTAGG + Intronic
1130137906 15:81197124-81197146 CTGTGCATAGGGAGGTAGGTGGG + Intronic
1130795390 15:87203251-87203273 CTGTGGAAGTGGGGAAAGGTGGG + Intergenic
1132242106 15:100265939-100265961 CGGTGGGTGTGGAGCAGGGTGGG - Intronic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1134425569 16:14140656-14140678 CTGAGGACTTGGAGCAAGATGGG - Exonic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1142163112 16:88569712-88569734 TTGGGGATATGGAGGAAGATGGG + Intergenic
1151010132 17:70484234-70484256 CTCTGATCATGGAGCAAGGTTGG - Intergenic
1151605992 17:75136386-75136408 CTGTGGAGTGGGAGCATGGTGGG - Intronic
1153506871 18:5809776-5809798 TTGTGAATATGGTGCAAGATAGG + Intergenic
1155207189 18:23570297-23570319 CTGATAATATGGAGAAAGGTTGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156307986 18:35896977-35896999 CTGTGGTGTTGGAGTAAGGTTGG - Intergenic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1162910051 19:13843461-13843483 CTGTGGAACTGGAGCAAGTGGGG - Intergenic
1166011095 19:39943433-39943455 CGGTGGGTATGGAGGAGGGTAGG + Intergenic
1166182225 19:41117004-41117026 TTGTGGATAGGGATGAAGGTGGG - Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
925534585 2:4902610-4902632 ATGTGGATTGGGAACAAGGTTGG - Intergenic
928442256 2:31302307-31302329 CTGTGTAGCTGGAGCATGGTGGG + Intergenic
931877375 2:66528626-66528648 CAGTGGCAATGGAGCTAGGTGGG - Intronic
932771332 2:74502393-74502415 CTGTGAATGTGTAGCAGGGTTGG + Intronic
934055519 2:88248270-88248292 ATGTGGATATGGTGCAGGGCAGG + Intergenic
934713396 2:96529725-96529747 CTCTGGACATGGAGGTAGGTTGG - Intergenic
937020926 2:118654317-118654339 TTTTGTATATGGAGCAAGGTAGG - Intergenic
941416930 2:165232605-165232627 ATGTGGCTATGGAGCAAGAAGGG - Intergenic
944517385 2:200526113-200526135 CTGCGAAGATGGAGCAAGGGAGG - Intronic
946016118 2:216605516-216605538 CTGTGGCTATTGAGCCAGGCAGG + Intergenic
946389771 2:219408492-219408514 CCTTGGAGAAGGAGCAAGGTCGG + Intergenic
947634730 2:231674222-231674244 ACGTGGATGTGGAGCCAGGTAGG - Intergenic
947762455 2:232612633-232612655 GTGAGGATATGGAGCAAGGCAGG + Intronic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
948671940 2:239574474-239574496 CTGTGGTTATGAAGCATGGTAGG + Intergenic
949081570 2:242104763-242104785 CTGTGGTTCTGGATCAGGGTTGG + Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1172846426 20:37932121-37932143 TTCAGGTTATGGAGCAAGGTGGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1177294341 21:19155430-19155452 TTTTGGATATGGTGAAAGGTAGG + Intergenic
1179031361 21:37722756-37722778 CTTTGTATATGGTGAAAGGTAGG - Intronic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1179243157 21:39609520-39609542 CTGGGGAAATGGAGCAAGCGAGG - Intronic
1179925485 21:44531840-44531862 CTCCGGAGATGGAGCAAGGTGGG + Intronic
1181130163 22:20726542-20726564 CTGTGGAGGTGGAGCAGAGTTGG + Intronic
1182143137 22:27979984-27980006 CTGTGGTTATTGAGCCAGCTAGG - Exonic
1184536111 22:45088111-45088133 AGGTGGCCATGGAGCAAGGTGGG - Intergenic
1184541536 22:45128834-45128856 CTGTGGATTTTGAGTAAAGTGGG - Intergenic
951093990 3:18607300-18607322 TTGGGGATCTGGAGAAAGGTAGG + Intergenic
951190990 3:19771410-19771432 CTGTGGATCTGGGGGAAGATTGG - Intergenic
952236514 3:31486108-31486130 CTGGGGAAATGGAGCATGTTTGG - Intergenic
952785150 3:37146462-37146484 CTGTGGAGAGGGAGCACAGTGGG - Intronic
955945750 3:64191933-64191955 CTCTGGGTCTGGAGCAGGGTGGG - Intronic
956634738 3:71352534-71352556 CTGCTTATATGGAGCAAAGTAGG - Intronic
958094672 3:88928675-88928697 TTGTGGAAGAGGAGCAAGGTAGG - Intergenic
958195240 3:90235401-90235423 CTCTGGTCATGGAGCAAGGTTGG + Intergenic
958418654 3:93906806-93906828 CTCTGGTCATGGAACAAGGTTGG + Intronic
959902371 3:111674969-111674991 CTCTGGAGATGGGGGAAGGTAGG - Exonic
961107629 3:124255723-124255745 CAGTGCAGATGGAGCAGGGTGGG + Intronic
961280940 3:125765693-125765715 CTGTGGGGCTGGAGCATGGTGGG - Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962234091 3:133693150-133693172 CTAGGGATAAGGAGGAAGGTGGG - Intergenic
963078017 3:141366301-141366323 CTGTGTATATGAAGCAAGCAAGG + Intronic
963189699 3:142455707-142455729 TTGTAGATATGGTGTAAGGTAGG - Intronic
964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG + Exonic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966145265 3:176804592-176804614 CTTTGTATATGGTGCAAGGAAGG - Intergenic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968979079 4:3837045-3837067 CTGGGGAGATGGAGCTTGGTAGG - Intergenic
969052554 4:4383679-4383701 CTGAGGAGAGGGAGCAGGGTAGG + Intronic
969948413 4:10808111-10808133 CTCTGGAGACTGAGCAAGGTAGG - Intergenic
971858265 4:32071617-32071639 CTGTGGCCATGGAGCAAGAGAGG - Intergenic
972026580 4:34386253-34386275 CTGTGGATTTAGAGCATGGATGG + Intergenic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
974433170 4:61824668-61824690 CTGTGGATATGCAGCAGGTGGGG - Intronic
976612876 4:87047657-87047679 CGGAGGATGTGGGGCAAGGTGGG + Intronic
977837965 4:101667441-101667463 CTGTTGTTATGGAGAATGGTAGG - Intronic
979688297 4:123535536-123535558 GTGGGGATGTGGAGCAGGGTGGG + Intergenic
981806621 4:148723434-148723456 CTGCTGATATGGAGAAAGTTTGG - Intergenic
981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG + Intronic
984499045 4:180535295-180535317 CAGTGGATATGGAGCATGAAAGG - Intergenic
989747445 5:44847014-44847036 CAGTGTATCTGGAGCATGGTGGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991202612 5:64011706-64011728 CTTTGGTTATGCAACAAGGTTGG + Intergenic
991384861 5:66075163-66075185 CTGTGTATATGGAGGCTGGTGGG - Exonic
997055553 5:130438993-130439015 CTGGGGATCTGGAGCAACCTAGG - Intergenic
997359638 5:133286643-133286665 CTATGCATCTGAAGCAAGGTAGG + Intronic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1004142218 6:13028793-13028815 CACTGAATAAGGAGCAAGGTGGG + Intronic
1004260630 6:14104520-14104542 CTGGGGCTCAGGAGCAAGGTGGG - Intergenic
1006147148 6:31966500-31966522 ATGTGAATATGGAGCTAGATGGG + Intronic
1006450725 6:34104274-34104296 CTGGGGACATGGAGCAGGCTGGG + Intronic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1010068635 6:71716018-71716040 CTGTGGCGATGGAGCAGGTTTGG + Intergenic
1011643699 6:89437674-89437696 CACTGGATATGAAACAAGGTAGG - Intronic
1012914172 6:105150774-105150796 GTGAGGATGTGGAGAAAGGTTGG - Intergenic
1013086807 6:106864134-106864156 CTCTGATTGTGGAGCAAGGTTGG - Intergenic
1014561563 6:122897460-122897482 CTGTGGACATGGATCAGGTTTGG - Intergenic
1016664252 6:146616599-146616621 CTTTGCATATGGTGAAAGGTGGG + Intronic
1017032021 6:150232593-150232615 CTTTGTATATGGTGTAAGGTAGG + Intronic
1020843707 7:13255845-13255867 CTGGGGTTAAGGAGTAAGGTGGG + Intergenic
1021404475 7:20248817-20248839 CTGTGGATTTGGGGTAAGGGAGG - Intergenic
1023535785 7:41207745-41207767 GTGGGGAGATGGGGCAAGGTGGG + Intergenic
1024167621 7:46750365-46750387 CTGTGGATCTGGAGCTAGCCTGG + Intronic
1029381824 7:100220091-100220113 CTGTGGAACAGCAGCAAGGTCGG - Intronic
1029401991 7:100352541-100352563 CTGTGGAACAGCAGCAAGGTGGG - Intronic
1032447613 7:131998181-131998203 CAGAGAATATTGAGCAAGGTAGG - Intergenic
1035539481 8:421553-421575 CTGTGGTTCTGGATCAGGGTTGG + Intronic
1035911177 8:3567727-3567749 CAGAGGATGTGGAGGAAGGTTGG - Intronic
1036258483 8:7222815-7222837 CTGTGGGGCTGGAGCATGGTGGG + Intergenic
1036286818 8:7450008-7450030 CTGTGCAATTGGAGCAAGGCAGG - Intronic
1036308137 8:7616693-7616715 CTGTGGGGCTGGAGCATGGTGGG - Intergenic
1036310538 8:7681411-7681433 CTGTGGGGCTGGAGCATGGTGGG + Intergenic
1036334660 8:7861515-7861537 CTGTGCAATTGGAGCAAGGCAGG + Intronic
1036358993 8:8064694-8064716 CTGTGGGGTTGGAGCATGGTGGG - Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1038098574 8:24344450-24344472 CTGTGTATATAGAACAAGATTGG - Intronic
1038473424 8:27844351-27844373 CTGCAGCTGTGGAGCAAGGTGGG + Intergenic
1038968230 8:32600832-32600854 CTAGGGATCTGGAGGAAGGTTGG - Intronic
1039532359 8:38274817-38274839 CTGTGGATATGAAGCATAGTTGG - Exonic
1041505676 8:58594923-58594945 CTGTCGTCATGGAGCTAGGTGGG + Intronic
1043799739 8:84593119-84593141 CTTTGTATATGGTGTAAGGTAGG + Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1045282129 8:100758362-100758384 GTCTGGTGATGGAGCAAGGTAGG - Intergenic
1045722763 8:105133244-105133266 CTGGGGCTTTGGAGCAAGATGGG - Intronic
1046821640 8:118639992-118640014 CTGTGCCTAAGGAGCAGGGTAGG - Intergenic
1047005683 8:120617690-120617712 TTCTGAGTATGGAGCAAGGTTGG - Intronic
1047227681 8:122970538-122970560 CTGTGGAGTTGGAGAAAGCTGGG - Intronic
1048871497 8:138803011-138803033 CTAGGGAATTGGAGCAAGGTTGG - Intronic
1049452074 8:142667371-142667393 CCGTGGTTGTGGAGCCAGGTGGG - Intronic
1050980528 9:12007082-12007104 CTATGAATATAAAGCAAGGTGGG + Intergenic
1051561523 9:18446815-18446837 CTTTGGATATGGTCCAAGGTAGG - Intergenic
1052692522 9:31833537-31833559 CTGTGGATATGGATAAATGGAGG - Intergenic
1052707883 9:32015372-32015394 CTTTGTATATGGTGAAAGGTAGG + Intergenic
1053322221 9:37109255-37109277 CTTTGTATATGGAGTGAGGTAGG - Intergenic
1055404379 9:75959334-75959356 GTGTGAATATGGAGCAAGTGGGG + Intronic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1057171689 9:92966669-92966691 CTGTGCATGTGGACCAAGGAAGG + Intronic
1057903409 9:98966436-98966458 CTGGGGCCATGGGGCAAGGTAGG - Intronic
1057914224 9:99043307-99043329 CTGTGGAGATGGACCAGGGCTGG + Intronic
1059948982 9:119442426-119442448 CTGTGGATGGGGAGCAGTGTGGG - Intergenic
1185592208 X:1284999-1285021 ATGTGGAGAAGGAGCAAGCTGGG + Intronic
1185742836 X:2547587-2547609 TTGTGGGTAAGGAGCAGGGTAGG - Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1186458658 X:9730870-9730892 GTGGGCATATGGAGGAAGGTAGG - Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186947060 X:14580212-14580234 ATGTGGAGATGGAGCAAGTAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187576820 X:20565524-20565546 CTCTAGATTTGGAGGAAGGTAGG + Intergenic
1189861560 X:45277175-45277197 TTGTGTATATGGTGAAAGGTAGG + Intergenic
1189928875 X:45986652-45986674 CTGTACATATGGATCAAGGTGGG - Intergenic
1190620764 X:52284874-52284896 CTCTGATTGTGGAGCAAGGTTGG - Intergenic
1190715666 X:53101098-53101120 TTGTGGATATGGAGAAAGTTTGG - Intergenic
1191891010 X:65940877-65940899 CTGTGCATGTGGAGAAAGGGAGG + Intergenic
1193292083 X:79786815-79786837 CTTTGGAAATAGAGCAATGTAGG - Intergenic
1194012477 X:88579812-88579834 TTTTGTATATGGAGAAAGGTAGG - Intergenic
1194294011 X:92106454-92106476 ATGTGAATATGGAGCAAAATTGG + Intronic
1196862291 X:120039716-120039738 CTGAGGAGGAGGAGCAAGGTGGG - Intergenic
1196880811 X:120196628-120196650 CTGAGGAGGAGGAGCAAGGTGGG + Intergenic