ID: 1139596395

View in Genome Browser
Species Human (GRCh38)
Location 16:67960782-67960804
Sequence CAGTCACCCCAAAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139596391_1139596395 12 Left 1139596391 16:67960747-67960769 CCGCAATGACACAGAGGAGCTAG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 215
1139596388_1139596395 29 Left 1139596388 16:67960730-67960752 CCCTCAGCTACACTGAGCCGCAA 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 215
1139596389_1139596395 28 Left 1139596389 16:67960731-67960753 CCTCAGCTACACTGAGCCGCAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139596395 Original CRISPR CAGTCACCCCAAAGAGAAGA GGG Intronic
900826014 1:4927685-4927707 CAGTCCCCCAAAAGAGCAGAGGG + Intergenic
902539317 1:17141628-17141650 AAGACATCCCAATGAGAAGAGGG - Intergenic
903551101 1:24157739-24157761 CAGCCACCCAACAGACAAGATGG - Exonic
906971244 1:50516569-50516591 GAGTCCCTCCAAAGTGAAGAGGG + Intronic
907266425 1:53264356-53264378 CAGTGACCCGAAAGAGCAGGAGG - Exonic
908458725 1:64329000-64329022 CAGTCACTCAAAAGAGTAGATGG - Intergenic
910791431 1:91055125-91055147 CAGTCAGCCCAAGGAAAGGAAGG - Intergenic
911315834 1:96355696-96355718 CAGTGATCCCAAATAGAACAGGG + Intergenic
912530105 1:110314456-110314478 CAGTCACCTCAAACAGCCGAGGG - Intergenic
913533220 1:119747792-119747814 CAGTCACCCCCATGAGGAAAGGG - Intergenic
917173245 1:172201459-172201481 CCTTCACCCCAAAGAGATGCAGG + Intronic
917477421 1:175380671-175380693 CAGTTGCCACAAAGAGACGACGG + Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
919565242 1:199176957-199176979 CACGCACCACAAAGAGAAAAGGG + Intergenic
920455868 1:206100649-206100671 TCGTCACCCCCAAGACAAGAGGG - Intronic
920830015 1:209456013-209456035 CAGGGACCCCAAGGAGAATAAGG - Intergenic
922310781 1:224388200-224388222 CAGAATCCACAAAGAGAAGAGGG - Exonic
1063035035 10:2278403-2278425 CAATCACGCCAAAGAGGACAGGG + Intergenic
1065115946 10:22482440-22482462 CTGTCACCCAAAAGGGAAAAAGG - Intergenic
1065482822 10:26212319-26212341 CAGTCACCCCAAATGAGAGAGGG - Exonic
1065875948 10:29997094-29997116 CAGTTACCCCACTGAGAAAAGGG + Intergenic
1066230149 10:33424259-33424281 CAGTCAGACCATAGAGAGGATGG - Intergenic
1069515492 10:69073750-69073772 CAGTTCCCACAAAGTGAAGATGG - Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1073248408 10:102107371-102107393 CAGTCACCCCAGAGGAAAGGGGG + Intergenic
1076047609 10:127307376-127307398 AAAACACCCCAGAGAGAAGAGGG - Intronic
1077214185 11:1388523-1388545 CAGACAGCCCAAAGAGCAGGAGG + Intergenic
1078454307 11:11463117-11463139 CAGTCTCCCACAAGAGAACAGGG + Intronic
1079364987 11:19801307-19801329 CAGTCAGTGCAAAGAGGAGAGGG - Intronic
1079413239 11:20209098-20209120 CATTCAGCCTAAAGAGAAAAGGG - Intergenic
1081477721 11:43451268-43451290 AAGTCACCCCACAGAAAAGCTGG + Intronic
1081730072 11:45365440-45365462 CATTCACTCCCAAGGGAAGAAGG - Intergenic
1083259848 11:61517019-61517041 GTGACACCCCAAAGAGAAGAAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084632128 11:70359950-70359972 CAGTCCCCCCAGAGAAAACAGGG + Intronic
1086354006 11:85973634-85973656 CATATCCCCCAAAGAGAAGAGGG + Intronic
1091283172 11:134393866-134393888 CAGTGCCCCCAAAGAGAGGGAGG + Intronic
1095092969 12:38124090-38124112 CAGTCAGCCCAAACAGAAATAGG - Intergenic
1096475163 12:51905218-51905240 GAGTCATCCCAATGAGAAAAGGG - Intergenic
1097198230 12:57256354-57256376 CAGGCACCCAAATAAGAAGAGGG + Intronic
1101138427 12:101770020-101770042 CAGTCACTCCAAAGGCCAGAAGG - Exonic
1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG + Intronic
1101538825 12:105645757-105645779 CAATAATCCTAAAGAGAAGAGGG - Intergenic
1101569925 12:105944353-105944375 CAATCTCCCCACAGAGAAAATGG + Intergenic
1104176128 12:126334491-126334513 CAGTTACACCAGAGAGAAAATGG - Intergenic
1113351775 13:109536342-109536364 CAGTGATCCAGAAGAGAAGAGGG + Intergenic
1115830737 14:37337910-37337932 CAGTCACTCAAAAGATAAGAAGG + Intronic
1116216779 14:42026550-42026572 CAGTCACATCACAGAGCAGAAGG + Intergenic
1116593238 14:46807266-46807288 CCATCAGCCAAAAGAGAAGAGGG - Intergenic
1116867098 14:50039997-50040019 CAGCCACCTCTAAGAGAAGCAGG + Intergenic
1118729484 14:68656415-68656437 CAGTTACCCCATTGAGAAAAGGG - Intronic
1118742840 14:68753055-68753077 CAGTCTCTTCAAAGAGAAAATGG + Intergenic
1126639849 15:50813103-50813125 CAGCCAACCCCAAGGGAAGAAGG - Intergenic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1131977034 15:97957354-97957376 CACTCACCACAAAAAGCAGAAGG + Intergenic
1132279728 15:100602588-100602610 CAGTGACCCCAAAGTGCTGAAGG + Exonic
1133483081 16:6190883-6190905 CAGTCACACCACACACAAGATGG - Intronic
1135114503 16:19713489-19713511 CAGCCACCCCCAAAGGAAGAAGG - Intronic
1135271050 16:21070187-21070209 CTGTCTGCCAAAAGAGAAGATGG - Intronic
1135831900 16:25781813-25781835 CAACCACCCGAAAGAGAAGAAGG - Intronic
1136174866 16:28509629-28509651 CAGGGAGCCCTAAGAGAAGATGG - Intronic
1136945443 16:34645182-34645204 CACACACCTCAAAGAGGAGAAGG + Intergenic
1138103965 16:54277128-54277150 CATTCACCCTAAAGACAGGAAGG + Intergenic
1139384744 16:66559114-66559136 CAGTCCAGCCAAAGAGGAGAAGG - Intronic
1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG + Intronic
1140022754 16:71254240-71254262 CCCTCACCCCAGTGAGAAGATGG - Intergenic
1141124557 16:81391883-81391905 CCCTCACCCCAAAGATAAAAGGG - Intergenic
1141243812 16:82288039-82288061 CAGTAACCCAAAAGTGAAAACGG - Intergenic
1145257327 17:21333538-21333560 GAGACACGCCAAAGAGAACATGG + Intergenic
1145304730 17:21667271-21667293 CAGTCACACCAAAGTGATAAAGG - Intergenic
1145319313 17:21754497-21754519 GAGACACGCCAAAGAGAACATGG - Intergenic
1145551445 17:24708485-24708507 CATTCAACTCAAAGAGATGAAGG + Intergenic
1145593271 17:25316111-25316133 CATTCAACTCAAAGAGATGAAGG + Intergenic
1146164375 17:30576463-30576485 CAGCCTCCACAAAGAGAAAATGG - Intergenic
1146666207 17:34705704-34705726 CACTCATCCCATAAAGAAGAAGG + Intergenic
1146884216 17:36460076-36460098 CAGCCAGCCCAAACAGAAGCGGG - Intergenic
1147643732 17:42021058-42021080 CAGTCCCCCCAGGGAGCAGATGG + Intronic
1151585948 17:75008565-75008587 CAGTCACACCTGAGAGACGAAGG + Intergenic
1152416984 17:80169105-80169127 CAGTATTCCCACAGAGAAGATGG + Intergenic
1153265993 18:3269987-3270009 CTGTCTCTCCAAAGAAAAGAGGG + Intronic
1154197702 18:12278645-12278667 GAGCCACCCCAAAGAGAAATAGG + Intergenic
1155949970 18:31901188-31901210 CAGTCACTCTTCAGAGAAGATGG + Intronic
1160058286 18:75507018-75507040 CAGTCATCCCTGAGAGAGGAAGG + Intergenic
1160370176 18:78365562-78365584 CAGTGGCTCCAAGGAGAAGAGGG + Intergenic
1160871940 19:1281674-1281696 CAGGCCCCCCACAGAGGAGATGG - Intergenic
1163811640 19:19436315-19436337 CAGCCACCTCCTAGAGAAGATGG + Intronic
1164293649 19:23889717-23889739 CATTCTTCCCATAGAGAAGATGG + Intergenic
1164708677 19:30339257-30339279 CAGTCACCCCAAAGAGCACCTGG - Intronic
1165644089 19:37418733-37418755 CTATCACTCCCAAGAGAAGATGG + Intronic
1167066661 19:47191439-47191461 CAGTCACTCCTGAGAGAACAGGG + Intronic
1167534326 19:50039979-50040001 CAGTCACCCCATGAAGAAGCTGG + Intronic
925009540 2:471671-471693 CGCTGACACCAAAGAGAAGAGGG - Intergenic
926851544 2:17203566-17203588 GATTTACCCCCAAGAGAAGAGGG + Intergenic
929179518 2:39020549-39020571 CAGCCTCCCCAAAGAGAAAAGGG - Intronic
931165832 2:59746783-59746805 AAATCCCCACAAAGAGAAGAGGG + Intergenic
931853988 2:66282340-66282362 CAGTTACCTCTAAGAAAAGAAGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932382364 2:71296837-71296859 AATTGACCCTAAAGAGAAGAAGG + Intronic
937116379 2:119407720-119407742 CAGTCTCCCCCCAGAGAACAGGG + Intergenic
937539764 2:122934979-122935001 CAATCACCCCTCAGAAAAGATGG + Intergenic
939902890 2:147871771-147871793 AGGTGACCCCAAAGAGTAGAAGG - Intronic
941898520 2:170655260-170655282 CAGTCACAGTATAGAGAAGACGG + Intergenic
945549034 2:211196494-211196516 CCACCACCCCAAAAAGAAGAAGG + Intergenic
946881605 2:224182375-224182397 CAGTCATCCTACAGAGGAGAAGG + Intergenic
946958681 2:224959835-224959857 AAGTCAACCCAAAGAGCAGAGGG - Intronic
948051887 2:234984842-234984864 CAGTCCATCCAAATAGAAGAGGG + Intronic
1169292920 20:4368107-4368129 AATTCACCCCAAAGAGAAACAGG + Intergenic
1170521643 20:17192076-17192098 CAGTGACCCCTGAGAGATGAGGG + Intergenic
1170605127 20:17869990-17870012 CAGCCCCAGCAAAGAGAAGACGG + Intergenic
1171522239 20:25784711-25784733 CAGTCACACCAAAGTGATAAAGG - Intronic
1171529988 20:25846656-25846678 CAGTCACACCAAAGTGATAAAGG - Intronic
1171554588 20:26071172-26071194 CAGTCACACCAAAGTGATAAAGG + Intergenic
1172602409 20:36193026-36193048 CTGTCTACCCAAGGAGAAGAAGG - Intronic
1175167582 20:57055819-57055841 AAGTTAACCCAAACAGAAGAGGG - Intergenic
1177083512 21:16672913-16672935 GAGTCACAGCAAAGAGTAGAAGG - Intergenic
1178641338 21:34346656-34346678 CAGTAGCCCCAAGGAAAAGAGGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1182041719 22:27243312-27243334 AAGCCACCCCAAAGGAAAGAGGG + Intergenic
1183009878 22:34936151-34936173 CAGACACCCCACAGAGAGCAAGG - Intergenic
1183047679 22:35233323-35233345 AAGTTCCTCCAAAGAGAAGAGGG + Intergenic
1184312374 22:43655306-43655328 CTATCACACAAAAGAGAAGAGGG + Intronic
1185145864 22:49136354-49136376 CAGTCACCGGCAAGAGAAGACGG - Intergenic
949153028 3:793421-793443 TAGCCGACCCAAAGAGAAGATGG - Intergenic
949271424 3:2222405-2222427 CAGTGACTCCAAAGAAAACATGG + Intronic
949821062 3:8115839-8115861 CAGAAGCCCCAAAGAGAATAAGG + Intergenic
950509268 3:13415982-13416004 CAGTCACCCCTCAGCAAAGAGGG + Intronic
950915070 3:16636482-16636504 CAGTCAACCCTCAGAGAAGCTGG + Intronic
951863117 3:27276221-27276243 CTCTCACCTCAAGGAGAAGATGG + Intronic
953231897 3:41072743-41072765 CCATCATCCCAAAGAGAAGATGG + Intergenic
954874145 3:53790124-53790146 GAGTCAACCCAAAGTGAACATGG - Intronic
954999651 3:54915782-54915804 CAGTCACCACAAACAGCAGTTGG - Intronic
955284639 3:57627504-57627526 CAGTTTCTCCAAAGACAAGAAGG - Exonic
956410368 3:68972699-68972721 CAGTAAGCCGAAAGAGAACAAGG + Intergenic
958562177 3:95760197-95760219 CAGCCACCACAAAGAAAAGCAGG - Intergenic
958942486 3:100331529-100331551 CAGTCTCCCCAAGGTGAGGAAGG + Intergenic
959832491 3:110881051-110881073 CAGTCATCCCATAGAGATAAAGG + Intergenic
959965323 3:112347479-112347501 CAGTCTCCTCAGAGAGATGAAGG - Intronic
961390011 3:126546820-126546842 CAGTTAGCCCATAGAGAAGTAGG - Intronic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
966271212 3:178108238-178108260 GAGTCACTGCAAATAGAAGAAGG + Intergenic
970136685 4:12932870-12932892 CATTTAGCCCAGAGAGAAGAGGG - Intergenic
970321710 4:14881351-14881373 CAGTCAGCCAGAAGAAAAGATGG + Intergenic
972353024 4:38254837-38254859 CAGAAACCCCAAAGAGGAGTTGG + Intergenic
973700696 4:53534139-53534161 CAGTTACCCCATGGAGAAGGGGG + Intronic
974345657 4:60677850-60677872 TTGTATCCCCAAAGAGAAGATGG + Intergenic
974933709 4:68388987-68389009 TAGTCACCCCAAAAATAAGCTGG - Intergenic
975389829 4:73802998-73803020 CAGCCACCCTACAGAGAAAAGGG + Intergenic
976164508 4:82240021-82240043 CAGTCACCCCAAGGGCCAGAGGG + Intergenic
976372924 4:84310956-84310978 TATTCACCACAAAGTGAAGAGGG + Intergenic
978652988 4:111030456-111030478 CTCTCATCCCAAAGAGAAAAAGG + Intergenic
979266913 4:118714432-118714454 TTGTCACCACAGAGAGAAGAGGG + Exonic
980817950 4:137973019-137973041 AGCTCACCCCAAAGAAAAGATGG - Intergenic
981292150 4:143088729-143088751 TAGTCACCCCAAGGAGAAAAGGG - Intergenic
986758951 5:10862588-10862610 CAGCCACCTAAAAGAGAAAATGG - Intergenic
986852055 5:11824868-11824890 CTGTCACCCCAAACAGAGTAGGG + Intronic
987112654 5:14701729-14701751 CACTCACACCAAAGAGAAGGCGG - Intergenic
988799980 5:34687539-34687561 AAGTCTCCCCCAGGAGAAGAGGG + Intronic
988885063 5:35547735-35547757 CAGTGCCCACACAGAGAAGAGGG - Intergenic
989401134 5:41008843-41008865 AAATCAGCCCAGAGAGAAGATGG - Intronic
990494872 5:56337372-56337394 CAGTCACCCCAAGTAGGAGCTGG + Intergenic
991530962 5:67613663-67613685 CTGCCACCCCCAAGAGAACAAGG + Intergenic
993977099 5:94496100-94496122 CAGTCCCCTCAAAGAGAGGTTGG + Intronic
994752787 5:103759435-103759457 AAATCACACCAAAGAGAAGCAGG - Intergenic
1000664248 5:163974911-163974933 CAGTCATACCATAGAAAAGAAGG - Intergenic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001893470 5:175359121-175359143 CAGTGAGCCCAAAGAGGACAGGG + Intergenic
1001904602 5:175461325-175461347 CACTCACCCCCAAGTTAAGAAGG - Intergenic
1002412190 5:179089809-179089831 CAGACACTGCAATGAGAAGATGG - Intergenic
1004292673 6:14382729-14382751 CAGGCAACCCAGTGAGAAGAGGG - Intergenic
1004595923 6:17099685-17099707 AAATCACCCCAAAGTGAACATGG - Intergenic
1004881659 6:20014258-20014280 GAGTCACGCTAGAGAGAAGAGGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005919713 6:30389954-30389976 CAGTCACCCAAGAGGGAAGGTGG - Intergenic
1008794721 6:55289030-55289052 CAGTCACATCAAAGAGACCAAGG - Intergenic
1009348662 6:62647674-62647696 CAGCCACCCCATGCAGAAGAAGG - Intergenic
1010318743 6:74482216-74482238 CAGTCACCTCAAATTGAATAGGG - Intergenic
1010492859 6:76495215-76495237 CAGTCACCCCAAACAGTGGCAGG + Intergenic
1014209908 6:118697490-118697512 CAGTCCCACCAAAGTGAAGGTGG - Intronic
1014934766 6:127374488-127374510 CAGCCACACCACACAGAAGATGG - Intergenic
1015241740 6:131031926-131031948 CACTTACTCCAAAGTGAAGAGGG + Intronic
1016281071 6:142419494-142419516 CAGGCACCCAAAAGAAAAGGAGG + Intronic
1016722426 6:147317298-147317320 CACTCACACCAAAGATAAAACGG + Intronic
1017841983 6:158229875-158229897 CTGTCAGACTAAAGAGAAGAAGG - Intergenic
1018141771 6:160844909-160844931 CAGTTAGCCCAGAGAAAAGATGG - Intergenic
1018142457 6:160852797-160852819 CAGTCAACCCAGAGAAACGACGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1019608238 7:1920993-1921015 CAGGCAACCCAAAGAGAGGGTGG + Intronic
1020141147 7:5612642-5612664 CAGTCCCTCCAATGAGAAAAAGG + Intergenic
1021768142 7:23969835-23969857 CCCTCAACCCAAAGAGAGGAAGG - Intergenic
1023486821 7:40696403-40696425 TACTCACCCCAAACATAAGATGG - Intronic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1023530824 7:41151869-41151891 CAGTCATGCTGAAGAGAAGAAGG - Intergenic
1024128484 7:46325582-46325604 GAGAGACCCAAAAGAGAAGAAGG + Intergenic
1024394457 7:48849624-48849646 CGGGGACCCCAAAGAGAATAAGG - Intergenic
1024440448 7:49410077-49410099 AGGTAAGCCCAAAGAGAAGAGGG + Intergenic
1025282733 7:57639886-57639908 CAGTCACACCAAAGTGATAAAGG - Intergenic
1025301984 7:57825531-57825553 CAGTCACACCAAAGTGATAAAGG + Intergenic
1027435513 7:78160082-78160104 CATTCACCGCAAAGAGAATGAGG - Exonic
1028708842 7:93883721-93883743 TAGTAACCCCAAAGGGAAGCTGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1033272304 7:139943598-139943620 AAGTCACCCCAATGAGGAGGTGG - Intronic
1033490650 7:141840407-141840429 TAGAAACCCCAAAGAGAAAAGGG + Intronic
1034079097 7:148260234-148260256 CAGTCACCTCAATTAGGAGAGGG - Intronic
1035362712 7:158324158-158324180 CAGTCTCCGCATAGACAAGACGG + Intronic
1036395490 8:8367072-8367094 CAGACACCACAAATAGATGATGG + Intronic
1036793995 8:11742537-11742559 CAGTCACCCCACAGAGTCCAAGG - Intronic
1038521178 8:28233445-28233467 CAAACTCCCCAGAGAGAAGATGG - Intergenic
1041760612 8:61362256-61362278 GAGTCAGCCCAAAGTGGAGAAGG + Intronic
1042059454 8:64800838-64800860 TAGCCACCCCAAAGTGAACATGG - Intergenic
1042205783 8:66328435-66328457 CACTTACCCTAAAGAGAAGTTGG - Intergenic
1044343099 8:91070435-91070457 AAGGCATCGCAAAGAGAAGAAGG + Exonic
1044962876 8:97548179-97548201 GAGTGACCCAAAAGAGAATATGG + Intergenic
1045300031 8:100903085-100903107 AAGTCACCACCAGGAGAAGAGGG - Intergenic
1046711064 8:117512196-117512218 AAGTGAACCCAAAGAGAAGCAGG - Intergenic
1046751101 8:117927554-117927576 CAGACTCTCAAAAGAGAAGATGG + Intronic
1046814071 8:118564906-118564928 CATACTCCCCAAAGAGAAAAAGG + Intronic
1047429875 8:124781883-124781905 CAGTGAAGCCAAAGAGGAGAAGG + Intergenic
1051740897 9:20251062-20251084 GACTCAGCCCATAGAGAAGAAGG + Intergenic
1055527730 9:77152329-77152351 CAGTCACTAAAAAGAAAAGAGGG - Intergenic
1056657586 9:88522076-88522098 AAGTCACCCCCAAAGGAAGAAGG + Intergenic
1057399420 9:94709967-94709989 CAGCCACACCAAAAACAAGATGG - Intergenic
1059217966 9:112584182-112584204 CAGTCACCCAGAAAAGAAGGGGG - Intronic
1060586642 9:124790707-124790729 CAGGGACCCCCAAGAGGAGAAGG + Intronic
1060967995 9:127722277-127722299 CAGTCACCCCGCAGGGAACAGGG + Intronic
1062018563 9:134304768-134304790 AAATCACCCCAAAGAGACGTGGG - Intergenic
1186462532 X:9759777-9759799 CAGTCCTTCCAAAGAGAAGATGG + Intronic
1189626573 X:42903457-42903479 CAGTTTCCCCAAAGAGACCACGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1196374552 X:115018800-115018822 AAGTCACTCAAAAGAAAAGAAGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1202093217 Y:21215814-21215836 CAGGCACTCAAAAGAGGAGAGGG - Intergenic