ID: 1139597810

View in Genome Browser
Species Human (GRCh38)
Location 16:67968420-67968442
Sequence GACGGTGAGGGCGCGTTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139597810_1139597813 -6 Left 1139597810 16:67968420-67968442 CCTCAGAACGCGCCCTCACCGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1139597813 16:67968437-67968459 ACCGTCCGAGTCATCCAGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139597810 Original CRISPR GACGGTGAGGGCGCGTTCTG AGG (reversed) Exonic