ID: 1139597952

View in Genome Browser
Species Human (GRCh38)
Location 16:67968884-67968906
Sequence GGGGAAACACACTTCCACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139597941_1139597952 30 Left 1139597941 16:67968831-67968853 CCTCGGGTGAGAGGCCGCCCTCT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135
1139597946_1139597952 1 Left 1139597946 16:67968860-67968882 CCCAGATGCAACATTTGTAAAAT 0: 1
1: 0
2: 2
3: 42
4: 512
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135
1139597947_1139597952 0 Left 1139597947 16:67968861-67968883 CCAGATGCAACATTTGTAAAATG 0: 1
1: 0
2: 1
3: 27
4: 330
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135
1139597944_1139597952 12 Left 1139597944 16:67968849-67968871 CCTCTCTGAGCCCCAGATGCAAC 0: 1
1: 0
2: 3
3: 48
4: 445
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135
1139597942_1139597952 16 Left 1139597942 16:67968845-67968867 CCGCCCTCTCTGAGCCCCAGATG 0: 1
1: 0
2: 3
3: 55
4: 484
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135
1139597943_1139597952 13 Left 1139597943 16:67968848-67968870 CCCTCTCTGAGCCCCAGATGCAA 0: 1
1: 0
2: 3
3: 51
4: 409
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135
1139597945_1139597952 2 Left 1139597945 16:67968859-67968881 CCCCAGATGCAACATTTGTAAAA 0: 1
1: 0
2: 8
3: 91
4: 1205
Right 1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139597952 Original CRISPR GGGGAAACACACTTCCACCT CGG Intronic
903535660 1:24064569-24064591 GAGAAAACACGCTTCCTCCTGGG - Intronic
904333534 1:29782978-29783000 GAGGAAACAGACATCCACATAGG + Intergenic
905915229 1:41679757-41679779 TGGGAAACCCAGTTCCATCTAGG + Intronic
906478466 1:46185384-46185406 GAGGAAACAGACTTCTAACTGGG + Intronic
907063082 1:51450678-51450700 GGGGAAACACATTTGCAATTTGG - Intronic
907937906 1:59058859-59058881 GGAGACACACACTTACTCCTTGG - Intergenic
911766441 1:101681235-101681257 TGGGAGACACACTTTCTCCTTGG - Intergenic
915423237 1:155802166-155802188 GGGGAACCAAACTTGAACCTTGG + Intronic
924718557 1:246601699-246601721 CGGGAGAAACACTTCAACCTGGG + Intronic
1063122584 10:3115211-3115233 TGGGACACACACTTTCACCCTGG - Intronic
1068096026 10:52492759-52492781 GGGGAGAAACACTTGAACCTGGG - Intergenic
1071384870 10:85109418-85109440 AGGCAAAGACACTTCCTCCTTGG + Intergenic
1073169431 10:101490964-101490986 GGGGAGACTCACTTGAACCTGGG + Intronic
1073970138 10:109038468-109038490 GGGGAAACATCATTCCACATAGG - Intergenic
1074782128 10:116809640-116809662 GGGGAAACCCACTCACTCCTGGG + Intergenic
1079437145 11:20468052-20468074 GGGGAAACAAAGTTCCAATTAGG - Intronic
1080364919 11:31562604-31562626 GGTGAAAAACACTTTCACATTGG - Intronic
1084665885 11:70576030-70576052 GGGGGAACACATTTCCACTCTGG - Intronic
1084931285 11:72558233-72558255 GGAGAAAGAGACTTCCACCAGGG + Intergenic
1095637235 12:44448893-44448915 TGGGAAACACACATGGACCTGGG - Intergenic
1096476117 12:51910259-51910281 GGGGACACTCACTCCCACCCAGG - Intronic
1101552014 12:105772067-105772089 GGGGAAATACACTGCAAACTTGG + Intergenic
1102901852 12:116644992-116645014 GGGGAACCACACTTCCTGGTAGG + Intergenic
1103073150 12:117961435-117961457 GGGGAAATAGACTCCCATCTTGG - Intronic
1104180637 12:126376939-126376961 AGAGAACAACACTTCCACCTTGG - Intergenic
1104287650 12:127439707-127439729 GGGGCATCACAGTCCCACCTAGG + Intergenic
1104997473 12:132667590-132667612 GGTGAGACGCTCTTCCACCTTGG + Exonic
1110241772 13:73275650-73275672 GGGAAAACACACTTCATCCATGG - Intergenic
1113667537 13:112151214-112151236 CGGCAAGCACACTGCCACCTGGG + Intergenic
1113846502 13:113394515-113394537 GGGAAAACACACCTACACATCGG + Intergenic
1114055977 14:18967301-18967323 GGGAAAACCCACACCCACCTGGG - Intergenic
1114106572 14:19434452-19434474 GGGAAAACCCACACCCACCTGGG + Intergenic
1114555520 14:23559986-23560008 GTGGGAACACAGTTCCAGCTCGG - Exonic
1117210177 14:53489424-53489446 GAGGAAAATCACTTCAACCTAGG - Intergenic
1118260066 14:64238242-64238264 GGGGCAGCACAGCTCCACCTGGG + Intronic
1122934353 14:104949121-104949143 GGGGACTCTCATTTCCACCTTGG + Exonic
1130849885 15:87782568-87782590 GGGGAAACCCACTCACACCCTGG - Intergenic
1131290815 15:91105371-91105393 GGGGAAAGACATTTCCAGGTAGG + Intronic
1131593775 15:93775859-93775881 GAAGACACACTCTTCCACCTCGG - Intergenic
1136114147 16:28084019-28084041 GGGAACACACTCTTCCACCTGGG - Intergenic
1136540889 16:30927240-30927262 GGGGAAAGACCCTTCCTTCTAGG - Intronic
1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG + Intronic
1144175693 17:12704760-12704782 GGGGAGACAGAGTCCCACCTAGG - Intronic
1149087746 17:52739462-52739484 TGGGAAAAACACTTCCCCTTTGG + Intergenic
1150522259 17:65881122-65881144 GGAGAATCACACTTGAACCTGGG + Intronic
1150598398 17:66627612-66627634 GGTAAAAGACACTTACACCTTGG - Intronic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1155318163 18:24592710-24592732 GGGGAAGTATAATTCCACCTTGG + Intergenic
1156957001 18:42979068-42979090 TGGGAAAAACATTTCCACATGGG - Intronic
1160472640 18:79151310-79151332 GCCCAAACACACTCCCACCTCGG - Intronic
1168218318 19:54942621-54942643 GGAGAATCACACTTGAACCTGGG + Intronic
924964086 2:59460-59482 TTGCAAACTCACTTCCACCTAGG + Intergenic
926624613 2:15080791-15080813 GGATAGTCACACTTCCACCTGGG + Intergenic
926886325 2:17602135-17602157 GGGGTAACTGACTCCCACCTAGG - Intronic
932653139 2:73581689-73581711 AGGGACACACAACTCCACCTGGG - Intronic
933208672 2:79539640-79539662 GGGCAAACACACTCCCAGCTGGG - Intronic
933330309 2:80884927-80884949 GGGGAATCACATTTCAACATGGG + Intergenic
936455965 2:112674557-112674579 GGGAAAAGACACTTCCACAATGG - Intergenic
936483333 2:112905861-112905883 AGGGAAACACCCTTCCACTCTGG + Intergenic
937858316 2:126688733-126688755 GGGAAAACAGACTCCCAGCTAGG - Intronic
937858821 2:126692343-126692365 GGGAAAACAGACTCCCAGCTAGG - Intronic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
941020655 2:160405500-160405522 GGGAAAGCACACTTCCAGCGCGG - Intronic
941158448 2:162007275-162007297 GGCGAAACACATTTTCCCCTAGG + Intronic
944876605 2:203968854-203968876 GGGGAGACACAGTGCCACCTGGG - Intergenic
1170513199 20:17100620-17100642 GGGGAATCACAATCCAACCTTGG - Intergenic
1171106297 20:22435915-22435937 GGGGAAAATCACTGCCACTTAGG - Intergenic
1176173019 20:63704685-63704707 GTGGACCCACACTTCCACGTTGG - Intronic
1179568126 21:42261703-42261725 GGTGAAACACGCTGCAACCTCGG + Intronic
1179972997 21:44846728-44846750 GGGGAGAGTCACTTCCAACTGGG + Intergenic
1180474456 22:15689893-15689915 GGGAAAACCCACACCCACCTGGG - Intergenic
1181115076 22:20627268-20627290 GGGAAATCTCACTTCCACCTCGG + Intergenic
1184512734 22:44942831-44942853 GGGGAAACTCAGGTCCAGCTGGG - Intronic
1185222285 22:49635121-49635143 GGGGACACAGAATCCCACCTGGG + Intronic
1185222311 22:49635245-49635267 GGGGACACAGAGTCCCACCTGGG + Intronic
951822344 3:26827025-26827047 GGAGCAACCCACTTCCACCAAGG + Intergenic
953081641 3:39625302-39625324 GGGAGAGCACCCTTCCACCTGGG + Intergenic
955059103 3:55481590-55481612 GGGGAAAGCCACTTCCAGATGGG + Intronic
956901070 3:73716650-73716672 GGGCAAACTCTCTTCCACCCAGG - Intergenic
958447646 3:94235016-94235038 AGGGAAACAGACTTCAACTTTGG + Intergenic
961012487 3:123445831-123445853 GAGGAAAAACACATACACCTTGG + Intronic
963225123 3:142854651-142854673 GTGGAAACTCCCATCCACCTTGG + Intronic
964520677 3:157563409-157563431 CCTGAAACAAACTTCCACCTGGG + Intronic
965125290 3:164619813-164619835 GGGGAAACTCACTTTCACCAAGG + Intergenic
969263499 4:6048868-6048890 GGGCAAGCACAGTTCCAGCTTGG + Exonic
972921620 4:43949426-43949448 GGGGAAAAAACCTTACACCTTGG - Intergenic
973064467 4:45771212-45771234 GTGGTAACACACTTCCCCATGGG - Intergenic
983529051 4:168791119-168791141 CTGCAAACACACTTCCTCCTGGG - Intronic
986208260 5:5646330-5646352 GTGGAAAAACACTTTCTCCTGGG - Intergenic
995574477 5:113514314-113514336 GGGGAAAAACACTTTCAGCTAGG - Intronic
997571549 5:134932004-134932026 GGGGAAAGTCACTTCCAGATAGG + Intronic
1002111050 5:176912991-176913013 AGGGAAATTCACTTCCCCCTAGG + Intronic
1003099300 6:3164916-3164938 GGGGAAACACCCCTACACGTTGG - Intergenic
1006914442 6:37585331-37585353 GGGGACACACACACACACCTGGG - Intergenic
1007527565 6:42509855-42509877 GGAAAAACACAATTCCCCCTAGG + Intergenic
1011584332 6:88908602-88908624 GGGGCACCACACTCCCACCATGG + Intronic
1016663204 6:146604907-146604929 GAGGAAGAACACTTCCAACTGGG + Intronic
1023154433 7:37233964-37233986 GGGCAAATGCAGTTCCACCTAGG + Intronic
1024808803 7:53182849-53182871 GATGAAACACACTTCCAAATAGG + Intergenic
1031877994 7:127163466-127163488 GGGGGAACCCCCTACCACCTAGG - Intronic
1032679471 7:134167341-134167363 GGGGAAAGTCACATTCACCTTGG - Intronic
1033136981 7:138793785-138793807 GCGAAAACAACCTTCCACCTAGG - Intronic
1034554950 7:151844452-151844474 GGGTAAAAACCCTCCCACCTGGG + Intronic
1034730896 7:153386700-153386722 GGAGCAACAAAATTCCACCTCGG + Intergenic
1039457542 8:37717495-37717517 GGGGAAACATACTTCTCTCTTGG - Intergenic
1039912701 8:41837404-41837426 GGGGAAACACACTGACACATGGG + Intronic
1041497802 8:58506379-58506401 GGGTAAACACACCACCAACTGGG + Intergenic
1043191298 8:77225831-77225853 GGGAAAACACACTTCTCCCCTGG - Intergenic
1043528098 8:81118492-81118514 GAGGAGACACTCTTCCAGCTAGG - Intergenic
1044616502 8:94148105-94148127 GGGGAAACCCACAACCACATTGG + Intronic
1045489951 8:102660567-102660589 AAGGACCCACACTTCCACCTAGG - Intergenic
1045899975 8:107266178-107266200 GGTGAAACCCACCTCCACGTGGG - Intronic
1046434617 8:114170976-114170998 GGTGAAAACCACTGCCACCTTGG + Intergenic
1046851157 8:118974433-118974455 GGGAAAACACACCTCTTCCTTGG - Intergenic
1048103055 8:131376293-131376315 TGGGTAACAGAATTCCACCTTGG - Intergenic
1051219412 9:14832485-14832507 GGGGAAACACAATTCCCAATAGG + Intronic
1051903135 9:22064278-22064300 GGACCACCACACTTCCACCTTGG - Intergenic
1053519224 9:38761381-38761403 GGGGAAATGCCCTTCCTCCTAGG + Intergenic
1055311742 9:74989710-74989732 GGGGAAAAACACTTCAACCCAGG + Intronic
1055367162 9:75556824-75556846 GGGGAAACAGAGTTCCATTTTGG + Intergenic
1055676494 9:78667921-78667943 GGAGAAACAAATTTCCATCTTGG + Intergenic
1056762981 9:89427947-89427969 GGGGAAACACACCTCCTTCCTGG - Intronic
1059106061 9:111512510-111512532 GGAGAATCACACTTGAACCTAGG + Intergenic
1060466942 9:123914883-123914905 TGGGAATCACATTTCCACATGGG + Intronic
1061219914 9:129244316-129244338 GGGGAAGCACATTTCCTACTGGG + Intergenic
1062711306 9:137976522-137976544 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711323 9:137976619-137976641 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711340 9:137976717-137976739 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711356 9:137976814-137976836 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711371 9:137976911-137976933 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711388 9:137977008-137977030 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711403 9:137977105-137977127 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711421 9:137977202-137977224 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711436 9:137977299-137977321 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711454 9:137977396-137977418 TGGGAAACACACTGCCTCCAAGG - Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1187782415 X:22842894-22842916 GAGGGAAGACAATTCCACCTAGG + Intergenic
1188094095 X:26001782-26001804 GGGGATACACACTCCCACCAGGG + Intergenic
1199738465 X:150708858-150708880 GGCGAACCACACACCCACCTTGG - Intronic
1200920603 Y:8609677-8609699 GTGAAAACACAGCTCCACCTTGG + Intergenic