ID: 1139599783

View in Genome Browser
Species Human (GRCh38)
Location 16:67979766-67979788
Sequence CTGGGGGTGTGAAGGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139599777_1139599783 -3 Left 1139599777 16:67979746-67979768 CCTGGGGCAGGTCATTGTGGCTG 0: 1
1: 1
2: 4
3: 29
4: 312
Right 1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG 0: 1
1: 1
2: 0
3: 27
4: 338
1139599770_1139599783 30 Left 1139599770 16:67979713-67979735 CCTGAAGCACATTCTTGTAACGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG 0: 1
1: 1
2: 0
3: 27
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139599783 Original CRISPR CTGGGGGTGTGAAGGTCAGA TGG Intronic
900252514 1:1678494-1678516 CTGGCGGTGTGATGGGCAGACGG - Intronic
900566582 1:3335164-3335186 CTGGGGCTGTGCAGGGCAGCTGG - Intronic
900654789 1:3751133-3751155 ATGGTGGGGAGAAGGTCAGAAGG - Intergenic
901167223 1:7229438-7229460 AGGGGGGTGTGAAGGGGAGAAGG + Intronic
901265310 1:7905776-7905798 CTGGTGGTTTCAAGGTCAGCAGG + Intergenic
901813783 1:11782399-11782421 CAGGGGGTGGGAAGCTCAGACGG + Intronic
902255285 1:15185042-15185064 TTTGGGGTGTGGGGGTCAGATGG - Intronic
902623782 1:17665126-17665148 CTGCAGGTGTGAAGGTGAGCGGG - Intronic
903267970 1:22169801-22169823 GTGGGGGTGTGATGAGCAGAGGG + Intergenic
903361006 1:22777138-22777160 GTAGAGGTGAGAAGGTCAGAAGG + Intronic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904619264 1:31765642-31765664 CTGGAGGTGGGAGGGACAGAAGG - Intergenic
905366536 1:37454708-37454730 CTGGGTGTGGGAAGATCAGAGGG - Intergenic
905966909 1:42105820-42105842 CTGGGCGTGTGAAGGACTGATGG + Intergenic
906666919 1:47628473-47628495 CTGGGAGTATCAAGGTGAGAGGG - Intergenic
906793158 1:48676278-48676300 TGGGGGGTCTGAAGGTCTGAAGG + Intronic
908681895 1:66671329-66671351 CTGGGGGTGGGAAGAACAGGCGG + Intronic
909775125 1:79474878-79474900 CTCAGGGTATGAAGGTCAAACGG + Intergenic
911232811 1:95378563-95378585 ATGGGGCTGTGAAGGTGACAGGG + Intergenic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
913212537 1:116593584-116593606 CAAGGGGTGTTAAGGACAGAGGG - Intronic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916235908 1:162587905-162587927 TTGGGGGTGGGAGGGTGAGAAGG - Intronic
916608011 1:166362170-166362192 CTGGGGATCTGAGGGTTAGATGG - Intergenic
919633504 1:199982043-199982065 CTGGTGGAGAGAAGGTTAGAGGG - Intergenic
920380970 1:205534364-205534386 CTGGGGGTGTGGAACTCAGCTGG + Intergenic
920727512 1:208450050-208450072 CGGGGGGTGTTAGGGGCAGAGGG + Intergenic
924309738 1:242727971-242727993 CTGGGGGTGTCAAGGAGAGTGGG - Intergenic
1063081982 10:2776016-2776038 TTGGAGGAGAGAAGGTCAGAAGG + Intergenic
1063114174 10:3062204-3062226 ATGGTGGAGAGAAGGTCAGAAGG - Intergenic
1063445303 10:6110231-6110253 CTTGGTGTGTGCAGGTCACACGG + Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1068443450 10:57089754-57089776 CTGAGGGAGTGAAGGGCTGATGG + Intergenic
1070391070 10:75970986-75971008 CTGGGGATGTGAAGGCCTGGAGG + Intronic
1070508023 10:77132985-77133007 ATGGAGGTGTGAAGGAGAGAGGG + Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1072726935 10:97820060-97820082 CTGGGGGTGGGAGGCTGAGATGG + Intergenic
1073553339 10:104424406-104424428 CTGGAGGTGTGCAGGACAAAAGG - Intronic
1075098905 10:119492056-119492078 ATGGGGGTGAGAGGGGCAGAAGG + Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1076206552 10:128609010-128609032 CAGGGGGTGTGAAGGTGAAGAGG - Intergenic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1076980571 11:202446-202468 ATGGTGGGGAGAAGGTCAGAAGG - Intronic
1077148404 11:1056251-1056273 GTGGGGGTGTGATGGACAGTGGG - Intergenic
1077300761 11:1846003-1846025 GTGAGGGGGTGAAGGTCAGGGGG - Intergenic
1077409308 11:2396031-2396053 CTAGGGGTGGGCAGGTCACACGG + Intronic
1077870862 11:6260225-6260247 CTGTGGGGGTGAAGGTGTGAGGG - Intronic
1078877365 11:15412032-15412054 CCGGGGGTGAGAACTTCAGAAGG - Intergenic
1078980965 11:16534711-16534733 TTTGGGGTGTGAGGGTCAGGAGG - Intronic
1081963889 11:47157804-47157826 CTGGGGGTGGGCAGCTAAGAAGG - Exonic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1082260399 11:50073230-50073252 CTGGGTCTGTGAAGGCCACAGGG + Intergenic
1083783835 11:64932652-64932674 TGGGGTGTGTGAAGGTCAGGGGG + Intronic
1083945654 11:65921225-65921247 GTGGTGGTGGGAGGGTCAGATGG + Intronic
1084316121 11:68346905-68346927 CTGGTGGGGTGATGGTCTGAAGG + Intronic
1084548759 11:69828232-69828254 CTTGGGGTCTGATGGGCAGACGG + Intergenic
1085446548 11:76604664-76604686 ATGGGGGTGGGAAGGAAAGAGGG - Intergenic
1086690131 11:89780401-89780423 CAAGGGGTGTGATGGGCAGAGGG + Intergenic
1086698531 11:89872571-89872593 CAAGGGGTGTGATGGGCAGAGGG - Intronic
1086707635 11:89971925-89971947 CAAGGGGTGTGATGGGCAGAGGG + Intronic
1086715723 11:90059556-90059578 CAAGGGGTGTGATGGGCAGAGGG - Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087899411 11:103623754-103623776 ATGGGGAGGTGATGGTCAGAAGG + Intergenic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089679197 11:120110029-120110051 CTGGGGTTGTGATGGTGATAAGG - Intergenic
1089772280 11:120812146-120812168 CAGAGAGTGAGAAGGTCAGATGG + Intronic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1092728132 12:11504440-11504462 CTGGGGCTGGGAAGGGCAGCAGG + Intergenic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1094502162 12:31031364-31031386 CTGGGAATGTGATGGTGAGAGGG + Intergenic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096718915 12:53506965-53506987 CTGGGGGTGGAAAGGGCAGGAGG - Intronic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1097059531 12:56272224-56272246 TGGGGGGTGGGGAGGTCAGAAGG + Exonic
1097175199 12:57138523-57138545 CTGGCGGTGCGACGGTGAGAGGG + Exonic
1097282298 12:57852587-57852609 GTGGGGGTGGGAAGGTCGGGGGG - Intergenic
1097706211 12:62870954-62870976 CTGGTGGTGGGAAGGTAAAATGG + Intronic
1098896733 12:76071274-76071296 CTGGGAGGGTGGAAGTCAGAGGG - Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100076578 12:90792194-90792216 GTGGGGGTGTGAAGGTTGCAGGG + Intergenic
1100329647 12:93571550-93571572 CTGGAGGTGGGAAGGAGAGAGGG - Intronic
1101837092 12:108303256-108303278 CTGGGGGTGGGATGGTCACCAGG + Intronic
1103963975 12:124626412-124626434 CCCGGGGTGGGAAGGTCAGCGGG - Intergenic
1103975909 12:124702411-124702433 CTGAGGGTGTGCAGGTCCCATGG - Intergenic
1104147821 12:126052927-126052949 CTGGGGGAGAGAAGGCCAGGTGG - Intergenic
1105215781 13:18284207-18284229 CAAGGGGTGTTAAGGACAGAGGG - Intergenic
1108585554 13:51867000-51867022 CTGGGGGTGGGGAGATTAGATGG + Intergenic
1113651415 13:112036513-112036535 CTGGGGATGTGACGGCCACACGG - Intergenic
1113871935 13:113564982-113565004 CTGAGGGTGTGAGGATCTGATGG - Intergenic
1113966846 13:114157477-114157499 CTGGGGGTGGAAAGGTGAGCTGG + Intergenic
1116165479 14:41329607-41329629 CTGGGGGTCTGACTGTTAGAAGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118778785 14:68992229-68992251 TTGAGGCTGTGAAGGTCAAATGG + Intergenic
1119365602 14:74089065-74089087 CCGGGGGTGTGAAGGGGAAAGGG + Intronic
1119829328 14:77686965-77686987 CTGGGAGTGTCAAGTTGAGAAGG - Intronic
1120510256 14:85404768-85404790 CTGGGGGTTTCAAGTACAGATGG - Intergenic
1120883384 14:89432624-89432646 GTGGGGCTGTGCAGGCCAGAGGG - Intronic
1120949497 14:90028025-90028047 CTGGGGGAATGCAGTTCAGAAGG - Intronic
1123778418 15:23602784-23602806 CATGGGGTGTGGAGGTCAGTGGG - Intronic
1123922141 15:25077690-25077712 CTGGTGGTGGGAAGGGGAGAGGG + Intergenic
1125340620 15:38671970-38671992 CTGGGGGTGTGGAGAACAGCAGG + Intergenic
1125998278 15:44185445-44185467 TTGGAGGTTTGTAGGTCAGAAGG - Intronic
1126723383 15:51606208-51606230 GTGGGGGTGTGGATGTGAGATGG + Intronic
1127964863 15:63915946-63915968 CTTGGGGTGTGAGGGGGAGATGG + Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128095412 15:64950195-64950217 CCGGGGCTGTGAAGGTCACAGGG - Intronic
1128497152 15:68205188-68205210 CTGGGGGCGTGAACCTCAGGTGG - Intronic
1129181183 15:73876903-73876925 CTGGGGGTGGGAGGGGCAGTGGG - Intronic
1129455907 15:75676124-75676146 CTGGAGGTGGGCAGGCCAGAGGG - Exonic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1129599258 15:76988760-76988782 GTGGGGGTGTGGCGCTCAGATGG - Intergenic
1130980356 15:88808075-88808097 CTGGAGGGGTGAGGGTAAGAAGG + Intronic
1131511499 15:93051722-93051744 CTTGGGGTGGGAAGGTCACTTGG + Intronic
1132674310 16:1115374-1115396 GTGGGGGTGTGACGGTCGGGTGG - Intergenic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133580287 16:7138172-7138194 CTTTGGGTGTGAGGATCAGATGG + Intronic
1134155043 16:11836123-11836145 GTGAGAATGTGAAGGTCAGAAGG - Exonic
1135063800 16:19292301-19292323 CTGGGAGTCTGAAGGTCCCAGGG + Intronic
1135258989 16:20964941-20964963 TTGGGGGAGAGAAGGACAGATGG - Exonic
1135422823 16:22316407-22316429 CTGGGGCTGGGCAGGTCATAAGG + Intronic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135850740 16:25960899-25960921 CTGGAGGTAGGAAGGTGAGAAGG + Intronic
1136284605 16:29233615-29233637 CTCGGAGTGGGAAGGGCAGACGG + Intergenic
1136298657 16:29318534-29318556 CCTGGAGTGTGAAGGTCGGAGGG + Intergenic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1137295291 16:47086682-47086704 CTGAGGGTGAGAATGTAAGATGG + Intronic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1138019108 16:53461117-53461139 CTGGGGATGTGTAGGACAGGTGG + Intronic
1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG + Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138456145 16:57121893-57121915 CTGGTGAGGTGAAGCTCAGAAGG - Intronic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1139475084 16:67199098-67199120 CTGGGGGTAGGAAGGTAGGACGG - Exonic
1139591466 16:67935582-67935604 CCAGGGCTGTGAAGGGCAGACGG + Exonic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139777148 16:69323640-69323662 TTGGGGGTGTGCAGCTAAGAAGG + Intronic
1141969898 16:87474137-87474159 CTGTAGGTGTGAAGTTCAGTTGG - Intronic
1142868754 17:2807403-2807425 CTGGGGTTGTCAAGGACAGGGGG + Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143894747 17:10127389-10127411 CTGGGGATGAGCAGGTCAGGAGG + Intronic
1143968355 17:10773728-10773750 CTGAAGGAGTGAAGGTAAGATGG - Intergenic
1144397916 17:14863169-14863191 CTGGGCAAGTGAAGGTAAGAAGG + Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1145980148 17:29006204-29006226 CTGGGGGTGGGCAGCGCAGAAGG - Exonic
1146641404 17:34544322-34544344 ATGGGAGGGTGGAGGTCAGAGGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149515930 17:57280916-57280938 GTGGGGGTGGCCAGGTCAGATGG + Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150993017 17:70282684-70282706 TTGGGGGTGAGAATGGCAGAGGG + Intergenic
1151164173 17:72189971-72189993 CTGTGGATGTGAGAGTCAGAGGG - Intergenic
1152531665 17:80922687-80922709 ATGGGGGTGTGAAGGTCAGACGG - Intronic
1153463020 18:5357872-5357894 CTGGTGGTGGGAAGGTAAAATGG + Intergenic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1155173613 18:23285046-23285068 CTGGATGTGTGCAGGTCACAGGG - Intronic
1155737505 18:29242273-29242295 CTGGGTGAGTAAAGGTCAGAGGG + Intergenic
1157453868 18:47809153-47809175 CTGGGGAGGTGGAGGTCAAAGGG + Exonic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159392834 18:67816353-67816375 ATGGGGATGTGATGGTCAAAGGG - Intergenic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1163545985 19:17941842-17941864 CTGAAGGTGTGAGAGTCAGATGG + Intronic
1163563143 19:18032869-18032891 TGGGGGGTGGGGAGGTCAGAAGG - Intergenic
1164648640 19:29876310-29876332 AAGGGGGTGTGCAGGGCAGAGGG + Intergenic
1164746475 19:30619622-30619644 CTGGGGGTGTGCATGTGAGTCGG - Intronic
1166196028 19:41206453-41206475 GTGGTGGAGTGAAGGTCAGTGGG - Exonic
925123447 2:1437419-1437441 CTGGGTGTGCTGAGGTCAGAAGG + Intronic
925376972 2:3393327-3393349 CTGGGGGTGTGAGGGGCATGGGG + Intronic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
934298550 2:91762518-91762540 CAAGGGGTGTTAAGGACAGAGGG + Intergenic
935755935 2:106276188-106276210 TTGGGGGTGTGATGGTGAGCTGG - Intergenic
936087689 2:109480485-109480507 CTGAGGGTGCCAAGGTCATAGGG + Intronic
937009605 2:118550807-118550829 CTGAGGGTGAGAGGGTGAGAGGG - Intergenic
937091468 2:119209252-119209274 CTGGGGGAGTGAAGTGGAGAAGG - Intergenic
937624304 2:124025747-124025769 CTGGGGGCGGGAAGGTGAGGTGG + Intronic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
938001198 2:127740185-127740207 CTTGTGGTGTGAATGTCTGATGG + Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
941347465 2:164388200-164388222 CTGGTGGAGAGAAGGTGAGAGGG - Intergenic
942189061 2:173453294-173453316 CTGGGGGTGTGATGGGGAAAGGG + Intergenic
946784217 2:223225437-223225459 CTGTGAGTGAGATGGTCAGATGG + Intergenic
947900843 2:233720190-233720212 GTGGGGCTGTGAAGGTGGGATGG + Intronic
948979683 2:241486825-241486847 CTGCAGGTGGGAAGGTCAGCTGG - Intronic
1169141808 20:3230848-3230870 GTGGGGGTGCGGAGGTCAGGTGG + Intronic
1169195954 20:3682104-3682126 GTGGGGGCGGGAAGGTCCGAAGG - Exonic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1170426986 20:16244965-16244987 ATGTTGGTGTGAAGGTCAGGAGG - Intergenic
1170975484 20:21160248-21160270 TGGGGGATGCGAAGGTCAGAAGG - Intronic
1171308435 20:24125944-24125966 CTGGGGGTGTGAGGAACAGCAGG - Intergenic
1171445489 20:25200072-25200094 CTGCTGGTGGGAAAGTCAGATGG - Intronic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1172594948 20:36144455-36144477 CTGGGAGTGGGAAGGTCTGGAGG - Intronic
1173048002 20:39531066-39531088 CTGAGCTTCTGAAGGTCAGAGGG - Intergenic
1173620568 20:44432696-44432718 CTGTGGGTGTGAATGTCATTAGG + Exonic
1173823399 20:46032315-46032337 GAGGGGGTGTGAAAGGCAGAGGG + Intronic
1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG + Intergenic
1174262234 20:49304948-49304970 CTTGTTGTGTGAAGGTCACAAGG + Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1175931767 20:62496931-62496953 TCGGGGGTGTGCGGGTCAGAGGG + Intergenic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1177724966 21:24955521-24955543 CTGAGCTTGTGAGGGTCAGAGGG - Intergenic
1178689483 21:34739349-34739371 CTGGCCCTGTGAAGGTCAGAGGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179577863 21:42318845-42318867 TGGGAGGGGTGAAGGTCAGAGGG + Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1181444985 22:22963436-22963458 ATGGGGGTGGGAAGGGGAGAGGG - Intergenic
1181572096 22:23773150-23773172 CTGGGGGTGTGAAGGGGAGCCGG + Intronic
1181846945 22:25718060-25718082 CTGGGGATCTAAAGATCAGAGGG - Intronic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1183087550 22:35495725-35495747 CTGGGAGTGTGACAGCCAGAGGG - Intergenic
1183225702 22:36548615-36548637 CTGGGGGTGAGGTGATCAGATGG + Intergenic
1183344345 22:37298880-37298902 CTGGGGCTGGGAAGGTCAAGTGG + Intronic
1184992232 22:48178628-48178650 CTGGGGGTGTGCAGGCCCCAGGG - Intergenic
1185290140 22:50020318-50020340 ATGGAGGTGTGCACGTCAGATGG - Intronic
1185290212 22:50021054-50021076 ATGGAGGAGTGCAGGTCAGATGG - Intronic
1185290218 22:50021114-50021136 ATGGAGGAGTGAATGTCAGATGG - Intronic
949170684 3:992717-992739 GTGGGAGTGTGAAGACCAGATGG + Intergenic
949482800 3:4510106-4510128 CTGGGGCTGTGAAGGTGAGTGGG + Intronic
950123314 3:10496085-10496107 CTGGGGGTGGGATGGGGAGAAGG + Intronic
950881913 3:16329057-16329079 GTGGGAGTGTTTAGGTCAGAAGG + Intronic
953259592 3:41324638-41324660 CATGGGCTGTGAAGGACAGAGGG + Intronic
953385598 3:42504160-42504182 CTGGGGTTGGGAGGGCCAGATGG - Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954451688 3:50575073-50575095 CTGGGGGTGTGAGACTCAGAGGG + Intronic
954661638 3:52229823-52229845 CTCTGGGTGCGAAGGTCAGCAGG - Intronic
957416362 3:79910278-79910300 CTGAGGATGTGAATGTCAGGGGG + Intergenic
960159813 3:114338404-114338426 GTGGGGGTGGGAAGGGCAGTGGG - Intronic
962413888 3:135165259-135165281 CAGGAAGTGTGAGGGTCAGAAGG + Intronic
963571912 3:147008573-147008595 CTGGGGTAGTGCAGGTCACAGGG - Intergenic
964139560 3:153381383-153381405 ATGAGGGTGGGATGGTCAGAAGG + Intergenic
964331063 3:155603557-155603579 CTGGCTGTGTGAACTTCAGAAGG + Intronic
966065582 3:175817466-175817488 TTGTTGGTGGGAAGGTCAGATGG + Intergenic
966824805 3:183954550-183954572 CTGGGGTTGTGATGGTGGGATGG + Intronic
967709923 3:192694885-192694907 ATGGGGAGGTGAAGGTCAAAGGG + Intronic
967889053 3:194351962-194351984 CTGGGGGTGTGCATGTAAGTGGG + Intergenic
972289529 4:37678528-37678550 CTGGTTGTGTAAAGGGCAGAGGG - Intronic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
972492220 4:39598830-39598852 ATGGGGGTGTGGGGGTCACATGG - Intronic
972640021 4:40916894-40916916 CTGTGGTGGGGAAGGTCAGAGGG + Intronic
973223488 4:47755361-47755383 CTGGGGGTGTGAAACTTTGAGGG - Intronic
973634789 4:52851987-52852009 CTGGTGGTGGGGAAGTCAGAGGG - Intergenic
977459802 4:97310784-97310806 CTGGAGGTGTGAGGGAGAGATGG - Intronic
978871926 4:113589119-113589141 CTGGGGCTGAGTGGGTCAGAAGG + Intronic
981450570 4:144892681-144892703 ATGGGGATATGTAGGTCAGAGGG - Intergenic
981744473 4:148039032-148039054 GTGGGGGTGGGTAGATCAGAGGG - Intronic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
987452564 5:18104619-18104641 ATGGAGGTCTGATGGTCAGATGG + Intergenic
990989761 5:61673503-61673525 CAGGGGCTGTGAAGGTCACTCGG + Intronic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991400252 5:66244344-66244366 CTGGAGGTGGGAAAGTCAGATGG - Intergenic
991930381 5:71748359-71748381 CAGGGGGTGTGAAGGTCGTTCGG - Intergenic
992365338 5:76084257-76084279 CCGAGGCTGTGAAGCTCAGAGGG + Intronic
995374099 5:111453921-111453943 CCTGGGGTGTGTAGGTCAGATGG + Intronic
997083590 5:130769958-130769980 CTGGGAATGTGAGGGTCAGGAGG + Intergenic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997953461 5:138260132-138260154 CAGGGGGTGTGAAAGTTACATGG - Intronic
999089261 5:148921052-148921074 CTGGGGATGTGAAGGTAAGGAGG + Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999672552 5:153970485-153970507 CTGGGAGTGGGAAGGTTAGCTGG + Intergenic
1001108686 5:168877295-168877317 CTGGCTGTGTGGAGGTCTGAGGG + Intronic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1002382321 5:178839640-178839662 CTGGGGGTGTGCAGGGCTAATGG + Intergenic
1002935043 6:1664338-1664360 CAGGGGGTGGGCAGGTGAGAGGG - Intronic
1003130136 6:3388447-3388469 CTGCTGGTGGGAATGTCAGATGG + Intronic
1003918057 6:10806149-10806171 ATGGCGGGGTGAAGGTCAAAGGG - Intronic
1003920883 6:10832056-10832078 CTGGGGGAGTGATGGTGACAGGG - Intronic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1005145313 6:22683187-22683209 ATGGGCTTGTGAAGGTCAGCAGG + Intergenic
1006052278 6:31354417-31354439 CTGGGGGTGGGTGGGGCAGAGGG - Intronic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006195741 6:32240942-32240964 CTGGAGGTGAGAAGGTCAAAAGG + Intergenic
1006431625 6:34000703-34000725 CTGAGGGTGTGACAGTCAGGAGG + Intergenic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1007902162 6:45422483-45422505 TTGGGGGGGTGAAGGCGAGACGG - Intronic
1008193088 6:48483868-48483890 CTGGTGGTGGGTAGGTGAGAGGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009295746 6:61944495-61944517 GGAAGGGTGTGAAGGTCAGAGGG + Intronic
1016392747 6:143591627-143591649 CTAGGGCTGTGAAGGCCAAATGG + Intronic
1019341650 7:511373-511395 CTGGGGGTGGCAGGGGCAGAGGG + Intronic
1019497339 7:1346653-1346675 CTGGGGGTGGGACGGTCAGGTGG - Intergenic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021207104 7:17795458-17795480 ATGGTGGTGTGAAGATCTGAAGG - Intronic
1022360084 7:29649361-29649383 CTGGGGCTGTGAACGTATGAGGG + Intergenic
1022564166 7:31380592-31380614 CTAGGGGTGCAAAGATCAGAAGG + Intergenic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1022636023 7:32136125-32136147 ATGGGGATGTGTTGGTCAGAGGG + Intronic
1022678957 7:32526374-32526396 CTTGGAGTGTGATGGTCTGAAGG + Intronic
1022993712 7:35732683-35732705 CTGGGGGAGTGAAGACCAAAAGG + Intergenic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1024257665 7:47550443-47550465 TTGGGAAGGTGAAGGTCAGAGGG - Intronic
1025188273 7:56877551-56877573 CTGGGAGTGAAAAGGACAGATGG + Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025683654 7:63699369-63699391 CTGGGAGTGCAAAGGACAGATGG - Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026443148 7:70460968-70460990 CTGGGTTTGGGAAGGGCAGAAGG + Intronic
1026527942 7:71172018-71172040 CTGGGGGTGGTAATGTGAGAGGG + Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028931179 7:96414791-96414813 GTGTGGGTGTCAAGGTGAGAGGG + Intergenic
1032545506 7:132738322-132738344 CTGGGGCTTTGAAAGTCATATGG + Intergenic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1035732453 8:1862511-1862533 CTGAGTCTGTCAAGGTCAGAAGG - Intronic
1038233543 8:25728985-25729007 CGGGGGATGTGAAGGTCCCATGG + Intergenic
1038522133 8:28242980-28243002 GTGGGGAGGTGATGGTCAGACGG - Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038878411 8:31578584-31578606 CAGGGGTTGTCAAGATCAGATGG + Intergenic
1039485187 8:37904430-37904452 CTGGGGGAGTGACTGTCAGGAGG - Intergenic
1039560794 8:38510878-38510900 CTGGGGGATTGAGAGTCAGAAGG - Exonic
1041786202 8:61637200-61637222 GTGGGGGTGTGAAGGTGTGAGGG - Intronic
1041997425 8:64080284-64080306 CTGGGGTTTTGTTGGTCAGAAGG - Intergenic
1042494114 8:69436671-69436693 CTGGGGAGGTGATGGTCAAAGGG + Intergenic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1045601411 8:103721963-103721985 TTGGGGTGGTGAGGGTCAGAGGG + Intronic
1048313708 8:133346574-133346596 CTGGGGGTGTGAAGGTAGCTGGG - Intergenic
1048337324 8:133512737-133512759 CTGAGTGTGAGAGGGTCAGATGG - Intronic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1049049489 8:140183301-140183323 CTGGGGTTGTAGAGCTCAGAAGG - Intronic
1049264964 8:141662843-141662865 CAGGGGGTGTGACGGGCGGAAGG + Intergenic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1051376824 9:16410419-16410441 CTGGGTACATGAAGGTCAGAGGG - Exonic
1053114691 9:35490407-35490429 CTGGGTGTTTGAAGGTCCGGTGG - Intronic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1058773145 9:108258460-108258482 CTGGTGGGGTGAGGGTGAGATGG - Intergenic
1059490972 9:114667094-114667116 GGGGGGGTGGGAAGGGCAGAAGG + Intergenic
1060038759 9:120281740-120281762 CTGGGGCTATGAAAGTCAGTGGG + Intergenic
1060046400 9:120344769-120344791 GTGGGGGCGGGGAGGTCAGATGG - Intergenic
1061230657 9:129313872-129313894 TTGGGGGTCTGATGGTCACATGG + Intergenic
1061396884 9:130348346-130348368 CTGGGGGTGTGTGGGTCCCAGGG + Intronic
1061397172 9:130349514-130349536 CTGGGGGTGAGAAGGCGTGAGGG - Intronic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1061733550 9:132636024-132636046 CTGGGGGAGTGATGGTGGGATGG - Intronic
1061842795 9:133369384-133369406 CTGGGCGTGTCCAGGTCACACGG - Intronic
1062086957 9:134653942-134653964 CTGGAGGTGTGTAGGGCTGAGGG + Intronic
1062087002 9:134654132-134654154 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087109 9:134654591-134654613 CTGGGAGTGTGTAGGGCTGAGGG + Intronic
1062087119 9:134654623-134654645 CTGGGGGTGTGTAGGGCTGGAGG + Intronic
1062087173 9:134654874-134654896 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087188 9:134654921-134654943 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1190265244 X:48824137-48824159 TTGGGGGTGTGAGTGTCAGGTGG - Intronic
1190567977 X:51750574-51750596 GTGAGGGTTTGAAGGTCAGGAGG + Intergenic
1196070949 X:111521191-111521213 TTTGGGTTGGGAAGGTCAGATGG - Intergenic
1196441198 X:115721541-115721563 CTGAGAGTGTGAACGTCAGTTGG + Intergenic
1196444726 X:115839529-115839551 CTGAGAGTGTGAACGTCAGTTGG + Intergenic
1196465814 X:115970442-115970464 CTGAGAGAGTGAAGGTCAGTTGG - Intergenic
1199700362 X:150371116-150371138 CTGGCTGTGTCCAGGTCAGAGGG - Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic