ID: 1139603747

View in Genome Browser
Species Human (GRCh38)
Location 16:68003034-68003056
Sequence CACGGAAATCACGGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139603747_1139603752 -5 Left 1139603747 16:68003034-68003056 CCATCTTCCCCGTGATTTCCGTG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1139603752 16:68003052-68003074 CCGTGAGATTGTGATAGTCTAGG 0: 1
1: 0
2: 0
3: 6
4: 59
1139603747_1139603753 11 Left 1139603747 16:68003034-68003056 CCATCTTCCCCGTGATTTCCGTG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1139603753 16:68003068-68003090 GTCTAGGCCATGTAGAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 73
1139603747_1139603754 12 Left 1139603747 16:68003034-68003056 CCATCTTCCCCGTGATTTCCGTG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1139603754 16:68003069-68003091 TCTAGGCCATGTAGAACTCAGGG 0: 1
1: 0
2: 1
3: 4
4: 181
1139603747_1139603757 26 Left 1139603747 16:68003034-68003056 CCATCTTCCCCGTGATTTCCGTG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1139603757 16:68003083-68003105 AACTCAGGGGTGCTGAACTCAGG 0: 1
1: 0
2: 1
3: 18
4: 162
1139603747_1139603755 13 Left 1139603747 16:68003034-68003056 CCATCTTCCCCGTGATTTCCGTG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1139603755 16:68003070-68003092 CTAGGCCATGTAGAACTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139603747 Original CRISPR CACGGAAATCACGGGGAAGA TGG (reversed) Intronic
900859510 1:5218080-5218102 CACAGACAACAAGGGGAAGAGGG - Intergenic
903591051 1:24456219-24456241 CACGAACATCACGTAGAAGATGG - Exonic
907340471 1:53731767-53731789 CACAGAAAGAATGGGGAAGAGGG - Intronic
911380868 1:97112659-97112681 TATGGAAATCACGGGAAAGCAGG - Intronic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
915355650 1:155254168-155254190 CACCGAAAGCAAGGAGAAGAAGG + Exonic
916251511 1:162742920-162742942 CAAGGATAGCACGGGAAAGACGG + Intronic
917188794 1:172391314-172391336 GAGGGAAATCCCGGGGAAGGGGG + Intronic
917618922 1:176774971-176774993 CACGGAGAGCTCTGGGAAGAAGG - Intronic
924855712 1:247873267-247873289 CACGGAGGTCCCTGGGAAGATGG + Intronic
1062809555 10:452382-452404 CACGGCAAACACGTGGAAAAAGG + Intronic
1064593526 10:16919843-16919865 CAAGGAAATCTAGGGGAAAAGGG - Intronic
1068321176 10:55418610-55418632 CACAGAACTCACAGGCAAGATGG + Intronic
1069403785 10:68076688-68076710 CAGGGAAAACAAGGTGAAGAGGG - Intergenic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072631388 10:97149241-97149263 CACGGGAGTCTCCGGGAAGAGGG - Intronic
1074430397 10:113389446-113389468 CCCCGAAATCACGGTGAGGAAGG + Intergenic
1075785976 10:125050431-125050453 CACGGTTTTCACGTGGAAGACGG + Intronic
1077791448 11:5444754-5444776 CATGGAAATAACTGGGAAGGTGG + Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1079225637 11:18602387-18602409 CACAGAAATCCTGGGGCAGATGG - Intergenic
1079400384 11:20102196-20102218 CCCAGAGATCACGGTGAAGAGGG + Intronic
1080592719 11:33737273-33737295 CACGGAGATCAGGGAGAACAGGG + Intergenic
1083828657 11:65217400-65217422 CAAGGCAGTCCCGGGGAAGATGG - Intergenic
1084101400 11:66951970-66951992 CACGGTAACAACGGGGAAAAAGG - Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091389321 12:116422-116444 CACGGAAATGCCGGGGATGCTGG - Intronic
1093697428 12:22177771-22177793 AACGAAAATCCCTGGGAAGAAGG + Intronic
1096986387 12:55761364-55761386 CAAGGAAAGAAAGGGGAAGAGGG + Intronic
1103690943 12:122774205-122774227 CACGGTTATTAGGGGGAAGATGG + Intergenic
1104947470 12:132422570-132422592 CACAGAAAACAAGGGGATGAAGG + Intergenic
1106287890 13:28334110-28334132 CAGGCAAATCACTTGGAAGAGGG - Exonic
1107592862 13:41926629-41926651 CTTGGAAATCACAGAGAAGATGG + Intronic
1107773436 13:43812462-43812484 CACATAAAGCACAGGGAAGAAGG - Intergenic
1108185298 13:47882474-47882496 AACGAAAATCACAGAGAAGAAGG + Intergenic
1109572386 13:64210197-64210219 TACTGAAATCACGGGAGAGATGG - Intergenic
1113324898 13:109271623-109271645 CAGCAAAATCATGGGGAAGAAGG + Intergenic
1113588183 13:111480012-111480034 CATGAAAACCACTGGGAAGAAGG + Intergenic
1118887295 14:69878271-69878293 CCAGGAAATCACAGGGAAGGGGG - Intronic
1119197804 14:72730444-72730466 CACGGGAATGGCGGAGAAGAAGG + Intronic
1121583102 14:95045287-95045309 CACTGACCTGACGGGGAAGACGG - Intergenic
1132812942 16:1810434-1810456 CACAGCAAGCACGGGGAGGAGGG + Intronic
1135139883 16:19912235-19912257 CACTGGGATCACGGGGAAGCGGG - Intergenic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1138385295 16:56632339-56632361 CCCGGAAAGCGCGGGGAGGAGGG + Exonic
1138385868 16:56635430-56635452 CCCGGAAAGCGCGGGGAGGAGGG + Intergenic
1138971420 16:62148759-62148781 TAGAGGAATCACGGGGAAGAAGG + Intergenic
1139118565 16:63987128-63987150 GAAGGAAATCATGGGGAAAATGG - Intergenic
1139603747 16:68003034-68003056 CACGGAAATCACGGGGAAGATGG - Intronic
1140452525 16:75082240-75082262 GAAGGAAATGACGGGGAAGCAGG - Intronic
1140527047 16:75631699-75631721 CATGGAAATCACGGAGAAGATGG - Exonic
1145256214 17:21323869-21323891 AACGGTAACCACGGGGCAGAAGG - Intergenic
1145320401 17:21764081-21764103 AACGGTAACCACGGGGCAGAAGG + Intergenic
1147036315 17:37684097-37684119 CACAGAGAGCACTGGGAAGATGG - Intergenic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1150281892 17:63933652-63933674 CACGGAAGTCAGGGGCAGGAGGG + Intergenic
1151553722 17:74836296-74836318 CACGGCAATGATGGGGAAGTTGG - Exonic
1152315219 17:79576398-79576420 CATGAAAATCATGGAGAAGATGG + Intergenic
1153321243 18:3776104-3776126 GAGGGAAAAGACGGGGAAGATGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155572737 18:27213180-27213202 TACAGAAACCAGGGGGAAGATGG + Intergenic
1158498838 18:57982219-57982241 AAGGGAAAGCTCGGGGAAGAGGG + Intergenic
1159192195 18:65061116-65061138 GACGGAAATCTCGGGCATGATGG - Intergenic
1160160831 18:76468841-76468863 CAAGGAACTGATGGGGAAGATGG - Intronic
1160672979 19:375042-375064 CACGGAAACCACGGTGAGAAGGG + Intronic
1161948433 19:7453573-7453595 CAGGGAGATCGCAGGGAAGATGG + Exonic
1166270735 19:41711899-41711921 CACAGAAATCACAGGCAATAGGG + Intronic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
927653462 2:24926691-24926713 CGCGGAAACCAAAGGGAAGAAGG - Intergenic
929933039 2:46273414-46273436 GACGGAAATCTCTGGGCAGACGG + Intergenic
930586661 2:53275506-53275528 AATGGAAATCAAGTGGAAGAAGG - Intergenic
933422514 2:82068529-82068551 CACAGATATCAAGGGGTAGATGG + Intergenic
933899372 2:86838054-86838076 CATGGAAATCACGGTGAGGCAGG - Intronic
935781190 2:106511174-106511196 CATGGAAATCACGGTGAGGCAGG + Intergenic
938410211 2:131057465-131057487 GACGGAAATCAGAGGGGAGAGGG + Intronic
943591636 2:189804848-189804870 CAAGGAAAGCATTGGGAAGAAGG - Intronic
948850717 2:240704099-240704121 CATGGAAGGAACGGGGAAGATGG - Intergenic
1171073440 20:22098545-22098567 CATAGAAAGGACGGGGAAGATGG - Intergenic
1174042263 20:47708384-47708406 AAATGACATCACGGGGAAGAGGG + Intronic
1174172835 20:48627860-48627882 CACGGACATCATGCGGAAGCAGG - Exonic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1177320520 21:19513915-19513937 CACGGAATTCAGGTGGAAGCAGG - Intergenic
1179171441 21:38975933-38975955 CATGGAAATCACTTGGAAGCAGG + Intergenic
1180700060 22:17776360-17776382 CAGGGAAATTCCGGGGATGATGG + Intergenic
1182194856 22:28505887-28505909 AACGGAGTTCCCGGGGAAGAAGG + Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
953246078 3:41194706-41194728 AATGGAAACAACGGGGAAGAGGG - Intergenic
958747802 3:98158425-98158447 CACTGAAATCACAGTGAAGTTGG + Intergenic
958753099 3:98216193-98216215 CACTGAAATCACAGTGAAGTTGG + Intergenic
960762178 3:121084401-121084423 CAATGAAAACACGTGGAAGAAGG - Intronic
960902515 3:122566334-122566356 CAGGGCAAGCAAGGGGAAGATGG + Intronic
962253083 3:133850933-133850955 CAAGGAAATAACAGGGATGACGG + Intronic
968287047 3:197514854-197514876 CAGGGAAATCACAGGGGAGGTGG + Intronic
968289513 3:197527723-197527745 CACAGAAATCCAGGGGAAGAGGG - Intronic
968935726 4:3609179-3609201 CACGGCACTGACAGGGAAGAGGG + Intergenic
971588318 4:28433201-28433223 CAGGGAAATGACAGGGAACATGG - Intergenic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
977161894 4:93645182-93645204 CACAGAAATCAACGGAAAGAGGG + Intronic
977287359 4:95125390-95125412 TATGGAAAACACAGGGAAGATGG - Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
986224074 5:5796828-5796850 GACGGCCATCACGGGGAAGAGGG + Intergenic
989948646 5:50270857-50270879 CAGGGAAATCAGGCAGAAGAAGG + Intergenic
990025926 5:51188653-51188675 CAAGGAAATCAGTGGAAAGAGGG - Intergenic
995276198 5:110280647-110280669 CAGGGAAATCAGGCAGAAGAAGG - Intergenic
1001670104 5:173466777-173466799 CACTAAAACCATGGGGAAGATGG - Intergenic
1002796535 6:475393-475415 CATGGAAAGAACGGGGCAGACGG + Intergenic
1010399432 6:75431457-75431479 AACAGAAAACAAGGGGAAGAAGG - Intronic
1011157412 6:84348424-84348446 CACAGAAATCACAGGAAAAAAGG + Intergenic
1011621803 6:89250435-89250457 CACGGAAATCAGGGGTGGGAGGG - Intergenic
1014565279 6:122941348-122941370 CACGGCAATCATGCAGAAGAAGG - Intergenic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1024901185 7:54320140-54320162 CAGGGAAATCACGCAGGAGAAGG - Intergenic
1037844132 8:22267733-22267755 CACGAAAGTCTCAGGGAAGAAGG - Intergenic
1043019047 8:74977841-74977863 CAGGGAAAACACGGGAAATATGG - Intergenic
1043044083 8:75299235-75299257 CACAGAAATTGCAGGGAAGAAGG + Intergenic
1043158801 8:76819694-76819716 CACGGGTATCACAGGAAAGATGG + Intronic
1045505889 8:102778252-102778274 CACGGTAGTCACTAGGAAGATGG - Intergenic
1049388186 8:142354774-142354796 CACGAAAAGCAGGGGGAAGAGGG + Intronic
1051677025 9:19568940-19568962 CACGGAAAGAAAGGGGGAGAAGG - Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1191786863 X:64925535-64925557 AACTGAAATCAGGGGTAAGAGGG + Intronic
1196717190 X:118823456-118823478 TAGGGAAAAGACGGGGAAGAGGG - Intergenic
1196800368 X:119537856-119537878 CAGGAAAATAACTGGGAAGAAGG + Intergenic
1197291718 X:124666584-124666606 TAGGGAAATCATGGGAAAGAAGG - Intronic