ID: 1139604646

View in Genome Browser
Species Human (GRCh38)
Location 16:68009470-68009492
Sequence CAGCTGGGACAGCTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 450}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139604646_1139604651 -1 Left 1139604646 16:68009470-68009492 CCCAGCACCAGCTGTCCCAGCTG 0: 1
1: 0
2: 4
3: 47
4: 450
Right 1139604651 16:68009492-68009514 GCAGAGAGAGACAGTCCCCCTGG 0: 1
1: 0
2: 2
3: 29
4: 239
1139604646_1139604656 25 Left 1139604646 16:68009470-68009492 CCCAGCACCAGCTGTCCCAGCTG 0: 1
1: 0
2: 4
3: 47
4: 450
Right 1139604656 16:68009518-68009540 CAGCCAGCACCTCACTACCATGG 0: 1
1: 0
2: 2
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139604646 Original CRISPR CAGCTGGGACAGCTGGTGCT GGG (reversed) Intronic
900001497 1:17225-17247 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900021216 1:187747-187769 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900103566 1:972905-972927 CAGCTGGGACTCGGGGTGCTTGG + Exonic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900513670 1:3071500-3071522 CAGCTGGGACCGCTTGTCCCAGG + Intronic
901438575 1:9264069-9264091 CAGCCGGAGCAGCTGGTGCCAGG + Exonic
901861637 1:12078431-12078453 TAGCTGGGACTGCAGGCGCTTGG - Intronic
902475929 1:16687437-16687459 CAGCTGGGAGCGCAGGTGCTGGG + Intergenic
902597768 1:17520840-17520862 CAGCTGGGAAAACTGAGGCTTGG + Intergenic
903957766 1:27036839-27036861 CAGCTGGGATACCTGGTGGGAGG - Intergenic
904577763 1:31516241-31516263 TAGCTGGGACAACAGGTGCAAGG + Intergenic
905409054 1:37755805-37755827 CAGCTGGGCCAGTTGGTTCCTGG + Intronic
906678109 1:47708030-47708052 CACCTGGGACAGCGGGATCTGGG - Intergenic
907237699 1:53062967-53062989 CAGCCGGGACAGCTGGAGGGAGG + Intronic
907243292 1:53092409-53092431 ATGCGGGGACGGCTGGTGCTGGG - Intronic
907306250 1:53514651-53514673 CAGAGGGGACAGATGGTGGTGGG + Exonic
908641356 1:66227585-66227607 TAGCTGGGAGAGCTGATGTTAGG - Intronic
911150671 1:94594530-94594552 CAGCCTGGCCAGCAGGTGCTTGG + Intergenic
912032536 1:105266890-105266912 CAGATGGGAGAACTGGTGCTTGG - Intergenic
912451390 1:109769793-109769815 CACCTGGGCCAGGTGCTGCTGGG + Intronic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
913078953 1:115364223-115364245 CAGCTGGGCCAGCTGCTGCTGGG + Intergenic
913130494 1:115834286-115834308 CCGCTGGGCCAGCTGGGGCTAGG + Intergenic
913612188 1:120519324-120519346 CAGCTGGGAGCGCAGGTGCTGGG + Intergenic
914361055 1:146936779-146936801 CAGCTGGGACTACAGGTGTTTGG + Intergenic
914491532 1:148153853-148153875 CAGCTGGGACTACAGGTGTTTGG - Intergenic
914579001 1:149002914-149002936 CAGCTGGGAGCGCAGGTGCTGGG - Exonic
915348947 1:155212822-155212844 CAGATGGAGCAGCTGGAGCTGGG + Intronic
915352134 1:155233448-155233470 CAGATGGAGCAGCTGGAGCTGGG + Intergenic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
916661532 1:166926318-166926340 CAGCTGACACAGCTGATTCTTGG - Intronic
918990917 1:191696175-191696197 CAGCTGGGTCAGCCCATGCTCGG - Intergenic
919851952 1:201678935-201678957 CAGCTGGGACACAGGATGCTAGG + Intronic
920259393 1:204678674-204678696 CAGAGGGGACAGCAGGTGCAAGG - Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
922012145 1:221599573-221599595 CAACTGGCACAGCTGGCACTGGG - Intergenic
1066006759 10:31153007-31153029 GAGCTGGGTCAACTGGGGCTAGG + Intergenic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1066476563 10:35752677-35752699 CACGTGGGCCAGCTGGGGCTGGG + Intergenic
1067563855 10:47322694-47322716 CAGCAGGGACAGCAGGGGCAGGG - Exonic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069798864 10:71070126-71070148 CAGCTGGGCCTGTTGGAGCTGGG + Intergenic
1069880956 10:71592904-71592926 CAGCTGGGACAGCAGCTGAAAGG - Intronic
1070126048 10:73622808-73622830 GAGCTGGGACTACAGGTGCTTGG - Intronic
1070831584 10:79421196-79421218 CAGCTGGGATGGGTGTTGCTGGG - Intronic
1071064457 10:81614358-81614380 CAGCTGTGACAGCTGGAGTGAGG + Intergenic
1072236000 10:93454210-93454232 CCACTGGGATTGCTGGTGCTGGG - Intronic
1072379985 10:94858179-94858201 CAGCTGGGAAAGCTTGAACTGGG - Intergenic
1072637339 10:97186343-97186365 CAGCTGGGGCCGCGGGTGCCGGG - Intronic
1073443168 10:103564767-103564789 CAGAGGGGACAGCTGGAGGTGGG - Intronic
1073651393 10:105363160-105363182 CAGCTGGGACTACAGGTGCACGG + Intergenic
1075316488 10:121457647-121457669 CAGGTGGGAAAGCTGTTACTAGG + Intergenic
1075861324 10:125679226-125679248 CAGCTGCAGCTGCTGGTGCTGGG - Intronic
1076945062 10:133640843-133640865 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
1077408612 11:2393411-2393433 CACCTGGGACAGCTGGACCAGGG - Intronic
1077492981 11:2870633-2870655 CAGAAGGGCGAGCTGGTGCTGGG - Intergenic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1078729256 11:13961175-13961197 CAGCTGGATCAGGTGCTGCTAGG + Intergenic
1079252243 11:18794753-18794775 CACATGTGACAGCTGGGGCTGGG - Intergenic
1079331469 11:19536427-19536449 GAGCTGGTACAGCTGGTCCCTGG - Intronic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1081543920 11:44056291-44056313 CAGTTGACACAGCTTGTGCTGGG - Exonic
1081621963 11:44624062-44624084 CAGATGGGACAGCTGGGGGCCGG - Intergenic
1082026631 11:47577469-47577491 CAGCTGGGCCAGGTGGGTCTTGG + Exonic
1082116761 11:48337447-48337469 CAGCTGGAACAGATGGTGGCTGG - Intergenic
1082257036 11:50042863-50042885 CAGCTGGAACAGATGGTGGCTGG + Intergenic
1082725999 11:56737426-56737448 GACCTGGGATTGCTGGTGCTGGG + Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083639369 11:64136917-64136939 CAGCGGGGAGGGCTGGTGCGGGG + Intronic
1083681600 11:64354159-64354181 CAGATGGGACAGGTGGGTCTGGG + Exonic
1083856023 11:65393588-65393610 CAGCTTGTAGGGCTGGTGCTTGG - Exonic
1083925076 11:65801199-65801221 CAGCTGGGGCATGGGGTGCTTGG - Intergenic
1084315232 11:68341934-68341956 TGGGTGGGCCAGCTGGTGCTGGG + Intronic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1085663417 11:78391162-78391184 CAGCTGGGACCACAGGTGCATGG - Intronic
1086150721 11:83607439-83607461 CAGCGGGGACAGTGGGTACTGGG - Intronic
1088511490 11:110580133-110580155 AAGCTGGAATAGCTGGTCCTTGG + Exonic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1088823332 11:113474798-113474820 CAGCTGCGCCCGCTCGTGCTCGG + Intronic
1089561704 11:119346406-119346428 CAGCAGTGACCACTGGTGCTGGG + Intronic
1089729856 11:120512745-120512767 CAGCTGGGACAGGGGGTTCAAGG + Intronic
1090094536 11:123730081-123730103 CAGGTGGGACAGGTGGAGATGGG - Intronic
1090441406 11:126728262-126728284 CAGATGGGAAAGCTGAGGCTTGG - Intronic
1091238024 11:134034518-134034540 CCACTGGGACACCTGGTACTTGG - Intergenic
1091374582 12:17340-17362 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1091541813 12:1469322-1469344 TAGCTGGGGCAGCTGTTGATTGG + Intronic
1091753515 12:3037301-3037323 AGGGAGGGACAGCTGGTGCTGGG + Intronic
1092071835 12:5637557-5637579 CAGCTGATGCAGCTGGTCCTTGG - Intronic
1092831690 12:12450189-12450211 CAGCTGGGACTGATGGGGCCAGG - Intronic
1092865530 12:12757385-12757407 CAGCTGGGACAGCAGGCTCAGGG + Intronic
1095243439 12:39888353-39888375 CAGCTGGGACTACAGGTGCATGG + Intronic
1095290418 12:40473192-40473214 CAGCTGGAACATCAGGTACTGGG + Exonic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096560205 12:52430691-52430713 CAACTGGGACAGCTCCTGCAGGG + Exonic
1096570093 12:52517740-52517762 CATCTGGGACAGCTCCTGCAGGG + Exonic
1096612090 12:52808836-52808858 CATCTGGGACAGCTCCTGCAGGG + Exonic
1096629446 12:52916429-52916451 TAGCTGGAACAGAAGGTGCTAGG - Intronic
1096820650 12:54231434-54231456 CATCTGGTACTGCTAGTGCTGGG + Exonic
1097168463 12:57098707-57098729 CAGCTGGGAGAGCTGGCACTGGG - Intronic
1097177596 12:57152308-57152330 TAGCTGCGCCAGCTGGTGCTGGG + Intronic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1100613846 12:96215438-96215460 CAGCTGGGACACCTGAAGCTGGG + Intronic
1101721636 12:107355369-107355391 CACGTGGAACAGCTGGTGCCTGG + Intronic
1102419696 12:112793991-112794013 CAGCTGGGATAGCTAATACTTGG + Intronic
1103366132 12:120384788-120384810 CAGCTGGGACAGCTGCAGGCAGG - Intergenic
1103443116 12:120978346-120978368 CAGCTGGGATGGAAGGTGCTGGG - Intergenic
1104015683 12:124960215-124960237 GAGCTGGGTCTGCTGGTGCCTGG - Intronic
1104282632 12:127391860-127391882 CTGCTGGCAAAGCTGATGCTTGG + Intergenic
1104349869 12:128035825-128035847 GAGCTGGGACAGGTTGTTCTGGG - Intergenic
1104441435 12:128796696-128796718 CAGCAGTGACAGCTAGTGCCAGG - Intronic
1104717815 12:131028032-131028054 CAGCATGAACAGCTGGTGCCCGG + Intronic
1105294601 13:19076701-19076723 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1105881123 13:24607254-24607276 GGGCTGTGGCAGCTGGTGCTGGG + Intergenic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1107743913 13:43485252-43485274 GTACTGGGACAGCTGGTGGTGGG - Intronic
1111798138 13:92949550-92949572 GAGCTGGGACAGCTGGGGCCAGG - Intergenic
1112508122 13:99987727-99987749 CAGCTGGGAGAGCTGGAGGGGGG - Intergenic
1113812703 13:113152065-113152087 CAGCCAGGACAGCTGGTGGACGG + Intergenic
1113887268 13:113667496-113667518 CAGCGGGGGCAGCTTGAGCTTGG - Exonic
1115312410 14:31992858-31992880 CAGAGGGTACAGCTGTTGCTGGG + Intergenic
1115537204 14:34384571-34384593 CAGCTGGGAAACCTGCTGTTTGG + Intronic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117164852 14:53023019-53023041 GAGCTGAGGCAGCTGGTGCTTGG + Intergenic
1118627632 14:67674214-67674236 CAGCAGGGAGACCTGGGGCTGGG + Intronic
1118697394 14:68398131-68398153 CAGCTGGGACAGCTAAAGCTGGG + Intronic
1121085382 14:91142176-91142198 CAGGTGGTAGAGCTGGAGCTTGG + Intronic
1121127840 14:91418839-91418861 CAGCTGGGCCAACTGGTACAGGG + Intergenic
1121327142 14:93027803-93027825 CAGCTGGGTCAGGTGGCCCTGGG - Intronic
1121865538 14:97359259-97359281 CAGCTGGGACAGCTGAAGCCTGG - Intergenic
1122631896 14:103111136-103111158 CAGCTGAGACAGGTGGTGACAGG + Intergenic
1122920599 14:104878358-104878380 GAGCTGGCACACCTGTTGCTGGG + Intronic
1122931975 14:104937441-104937463 CAGCTGGGCCAGCAGAAGCTAGG - Exonic
1122968585 14:105143349-105143371 CGGCTGGGGCAGCAGGTGCCAGG + Intronic
1202926214 14_KI270724v1_random:28410-28432 CCGCTGGGTCAGCTCGGGCTCGG + Intergenic
1123687373 15:22808471-22808493 CAGGTGGCACAACTGATGCTGGG + Intronic
1124490405 15:30151663-30151685 CAGCTGGGCCAGCAGGCACTGGG + Intergenic
1124753127 15:32386666-32386688 CAGCTGGGCCAGCAGGCACTGGG - Intergenic
1125712155 15:41795735-41795757 CAGCTGGGACTACAGGTGCACGG + Intronic
1126098529 15:45106013-45106035 CAACTATGACAGCTGATGCTGGG - Intronic
1126936185 15:53711110-53711132 TAACTTGTACAGCTGGTGCTGGG - Intronic
1127773261 15:62247009-62247031 CAGGTGGGTAAGCTGGGGCTGGG - Intergenic
1127774576 15:62255021-62255043 CAGATGGGTAAGCTGGGGCTGGG - Intergenic
1128229954 15:66027521-66027543 CAGAGGGGAAAGCTGGGGCTTGG - Intronic
1129224153 15:74156700-74156722 AAGCTGGGAGAGCTGGTGTCTGG + Intergenic
1129679387 15:77649629-77649651 GAGCTGGGTCAGCTGGGGCTAGG + Intronic
1131282840 15:91034664-91034686 CAGATGGGTGAGCTGGGGCTGGG - Intergenic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1132330931 15:101012336-101012358 CAGCTGTGTCAGGTGGTGGTGGG + Intronic
1132389563 15:101428379-101428401 CAGCAGGGACACCTGCTGCCTGG + Intronic
1132452013 15:101973713-101973735 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1132454882 16:16908-16930 CAGCTGGAACAGCAGGTGGGAGG - Exonic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132471248 16:104647-104669 CAGGTGGGTGAGCTGATGCTTGG - Intronic
1132487890 16:205718-205740 CAGCTGGGACTACAGGTGCCTGG + Intronic
1132761467 16:1510506-1510528 CAGCTGGGACACCCGGGCCTTGG - Exonic
1132806510 16:1777539-1777561 CAGCTGGCACAGCTGAGGCAAGG + Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1133138407 16:3728208-3728230 CAGATGGGGCAGCCGGGGCTGGG - Exonic
1134062862 16:11209596-11209618 CAGATGGGACAGCTGGGGTCTGG + Intergenic
1134127632 16:11627296-11627318 CTGCTGGCAAAGATGGTGCTGGG - Intronic
1134174917 16:11997923-11997945 CAGATGGGAAAGCTGAAGCTCGG - Intronic
1135981707 16:27152778-27152800 CAGTTGGGCCAGGTGTTGCTAGG - Intergenic
1137651990 16:50128509-50128531 TAGCTGGGACAACAGGTGCATGG - Intergenic
1137693025 16:50442326-50442348 CAGCTTATACTGCTGGTGCTGGG - Intergenic
1137967753 16:52953453-52953475 AACCTGTGACAGATGGTGCTAGG - Intergenic
1138112597 16:54336855-54336877 CTGCTGTGGCAGCTGCTGCTGGG - Intergenic
1138340780 16:56287704-56287726 CAGAAGGGACAGCTGATTCTGGG - Intronic
1138511428 16:57510655-57510677 CACCAGGGACACCTGGTGCTGGG - Intergenic
1138689755 16:58756314-58756336 CAGCTTGGACATCTTGTGCAGGG + Intergenic
1139583800 16:67888313-67888335 CTGCTGGGAAGGATGGTGCTGGG + Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139807834 16:69584457-69584479 CAGCTGGGACTACAGGTGCATGG + Intronic
1140083072 16:71768782-71768804 TAGCTGGGACTGCAGGTGCCTGG - Intronic
1140188528 16:72795260-72795282 CAGCTGGGGGAGCTTCTGCTGGG + Exonic
1140457936 16:75115478-75115500 CAGCTGAGAGAGAGGGTGCTGGG - Intronic
1140573002 16:76130552-76130574 TAGCTGGGACTACAGGTGCTGGG + Intergenic
1142013237 16:87727866-87727888 CAGATGTGGCAGCTGGTGCTGGG - Intronic
1142289029 16:89184291-89184313 CCCCCGGGACAGCTGGAGCTAGG - Intronic
1142526677 17:547415-547437 CATGTGGGACATCTTGTGCTTGG - Intronic
1143254885 17:5548754-5548776 CAGCAGGGACTACTGCTGCTGGG - Intronic
1143290706 17:5825895-5825917 CAGCTGGCTGAGCTTGTGCTTGG - Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1145088736 17:19968068-19968090 CAGCTGGGACTACAGGTGCACGG - Intronic
1145248953 17:21287045-21287067 CAGCTGTGACAGGCGGAGCTAGG + Intronic
1145272192 17:21410654-21410676 CACCTGGGACTGCAGGGGCTTGG + Intronic
1145277347 17:21440514-21440536 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145315185 17:21726409-21726431 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145713616 17:26998345-26998367 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145734559 17:27218304-27218326 CAACTGGGCCAGCTGTGGCTGGG + Intergenic
1146225409 17:31061957-31061979 CAGCTGGGCCAGCTGTGGCTGGG - Intergenic
1146464696 17:33077055-33077077 CAGCTGGGACAGCTGTTGAGGGG - Intronic
1148000621 17:44385190-44385212 CAGGCCGGAGAGCTGGTGCTTGG - Exonic
1148621245 17:49036061-49036083 CAGCTGGGCCAACTGGTGCGGGG + Intronic
1148921193 17:51036382-51036404 CAGCAGGGTCAGCTGGTGTGGGG - Intronic
1149663167 17:58346846-58346868 TAGCTGGGACTACAGGTGCTTGG - Intronic
1150206492 17:63412500-63412522 CAGCTGGGACAGCGGCAGCAGGG - Intronic
1150939476 17:69674824-69674846 CACCTGGGACAGAGGGTGCCAGG + Intergenic
1150983427 17:70169267-70169289 CAGCTGGGACAGCAGCAGGTGGG - Intronic
1151389468 17:73776120-73776142 GAGCGGGGACAGGTGGTCCTGGG + Intergenic
1152391778 17:80007840-80007862 CAGCAGGGCCAGATGGTGATGGG + Intronic
1152413791 17:80146200-80146222 CAGAAGGAACAGCTGGTGCCAGG - Intronic
1152439058 17:80294225-80294247 CAGCTGGCACAGATGGCCCTTGG - Intronic
1152558494 17:81066482-81066504 CACCTGGGAGAGCTGGGGCCTGG + Intronic
1152608627 17:81305063-81305085 AGGCTGGGACAGATGGTGCCTGG - Intergenic
1152892992 17:82892998-82893020 CAGCTGGCCCAGCCGGTTCTTGG - Intronic
1153244053 18:3056362-3056384 CAGCTGGGACTACAGGTGCCAGG + Intergenic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1156994216 18:43447178-43447200 GAGCTACGGCAGCTGGTGCTGGG - Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1157495312 18:48153009-48153031 CAGCTGGGGCTTCTGGTGCCTGG + Intronic
1158100153 18:53821142-53821164 AAGCTGGGACAGATGGTACCTGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159704935 18:71674953-71674975 CAGCTGGGTCTGTGGGTGCTTGG - Intergenic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1161026740 19:2040443-2040465 CAGCCGGGAGAGATGGGGCTTGG - Intronic
1161091805 19:2364049-2364071 TAGCTGGGACTACAGGTGCTGGG - Intergenic
1161478907 19:4501039-4501061 CAGACTGGACAGCAGGTGCTGGG + Intronic
1161507549 19:4652074-4652096 AAGCTGGGACTGCTGCTGCGTGG + Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162740856 19:12772809-12772831 AAGCTGCTTCAGCTGGTGCTGGG - Exonic
1162745264 19:12794128-12794150 CAGCTGGGACACGTGGAGGTGGG + Intronic
1163582645 19:18147602-18147624 CTGCTGGGACATCAGGGGCTGGG - Exonic
1163714430 19:18865759-18865781 CACCTGGGACAGCTCCGGCTGGG - Exonic
1165074822 19:33274952-33274974 AACCTGGGACAGCTAGTGCCTGG - Intergenic
1165117090 19:33535130-33535152 CAACAGGGACAGTAGGTGCTGGG + Intergenic
1166340419 19:42133682-42133704 CAGCAGGGAGGGCTGGTGTTGGG - Intronic
1166388544 19:42396022-42396044 GAGCTGGGACTCCTGGGGCTGGG - Intergenic
1166651980 19:44581648-44581670 CAGGTGGGACAGGAAGTGCTAGG - Intergenic
1167117642 19:47497466-47497488 CACCTGGGACAGCTGGCTCCTGG + Intronic
1167213093 19:48145889-48145911 CAGCTGAGAGAGGTGGAGCTGGG + Intronic
1167491350 19:49794343-49794365 TAGCTGGGACTGCAGGTGCCTGG + Intronic
1167534557 19:50041484-50041506 AAGCTGTGACAGCTGGGGCTGGG - Intronic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
1168582326 19:57565978-57566000 CAGCTGGAGGAGCTGATGCTTGG + Intergenic
1202709943 1_KI270714v1_random:13291-13313 CAGCTGGGAGCGCGGGTGCTGGG + Intergenic
925056710 2:862235-862257 CAGCCGAGACAGCGGGTGCACGG + Intergenic
925379367 2:3414543-3414565 CAGCGGGGACAGCTGGGGGATGG - Intronic
925590161 2:5501520-5501542 CAGCTGGGAGAGCTGCTCCCAGG + Intergenic
925899744 2:8500276-8500298 GGGCTGGGACAGAGGGTGCTGGG - Intergenic
926151487 2:10428023-10428045 CAGCTGGGCCTTCTGCTGCTGGG - Intergenic
926326419 2:11788162-11788184 CTGCTGGCACGGCTGCTGCTGGG + Intronic
926842961 2:17103834-17103856 CAGCTGAGACAGTAGGTGCATGG - Intergenic
928367381 2:30713292-30713314 TAGCTGGGACTACAGGTGCTGGG - Intergenic
930045955 2:47173190-47173212 CAGTTGGGAAAGTTAGTGCTAGG - Intronic
930136102 2:47905592-47905614 CTGCTGGGGCGGCTGCTGCTGGG + Exonic
931377283 2:61718719-61718741 CAGATGGGACAGCTAGTTGTAGG + Intergenic
932276131 2:70453588-70453610 CAGCTGGGGAAGCTGGAGCCAGG - Intronic
932308250 2:70719144-70719166 CAGTGGTGACAGCTGGTGGTGGG + Intronic
932586930 2:73036312-73036334 CATTTGTGAGAGCTGGTGCTGGG + Intronic
933802915 2:85977263-85977285 TAGCTGGGACTACTGGTGCCTGG - Intergenic
934216829 2:90038821-90038843 CAGCTGGGGGGGCGGGTGCTGGG - Intergenic
934542697 2:95189197-95189219 CAGCTGGGAGTGCAGGGGCTGGG - Intergenic
936092474 2:109510349-109510371 AAGCTGGCACAGCAGATGCTGGG + Intergenic
936568228 2:113596189-113596211 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
936597408 2:113861926-113861948 CAGCTGGGACCACAGGTGCATGG - Intergenic
937066817 2:119023804-119023826 CAGCTGGGACTGCAGGTGGTGGG - Intergenic
937309512 2:120893399-120893421 CAGCAGGGCCAGCGGGGGCTGGG - Intronic
937356798 2:121202852-121202874 CACCTGGGCCAGCTGGTGCAAGG - Intergenic
937869831 2:126778883-126778905 CACCTGGGACAGCTGGTTCAAGG + Intergenic
937913931 2:127089739-127089761 CTGCTGGGGCAGAAGGTGCTGGG + Intronic
941445684 2:165595925-165595947 TAGCTGGGACTGCAGGTGCATGG + Intronic
942213231 2:173692775-173692797 CAACAGGGACAGCTGATGCCAGG + Intergenic
943431659 2:187810315-187810337 AAGAAGGGACAGCTGGTGTTGGG + Intergenic
944226732 2:197355745-197355767 TAGCTGGGACAACAGGTGCCCGG - Intergenic
945791389 2:214309871-214309893 CAGCTGGGACAGCAGGTTGTGGG + Intronic
947872227 2:233445626-233445648 CAGCTGGGAGTGCTGCCGCTCGG + Exonic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947945964 2:234102564-234102586 CAACAGGGAGAGCTGATGCTGGG - Intergenic
948387063 2:237587331-237587353 CATCAGGGGCAGCTGGTCCTGGG + Intronic
948486534 2:238284955-238284977 CAGCTGGACCAGCTGTTCCTGGG + Intronic
948694934 2:239728458-239728480 CAGCCGGGAGAGCGCGTGCTGGG - Intergenic
948809905 2:240469148-240469170 CAGCTGGGCAAGGTGGTGCCTGG - Intergenic
1168960277 20:1864311-1864333 CAGCTGGGACAGGTGGGTCATGG + Intergenic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1171782392 20:29430831-29430853 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
1171879181 20:30604045-30604067 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1172178627 20:32987407-32987429 CAGCAGGGGCTGCTGGGGCTAGG - Intronic
1172407690 20:34701827-34701849 CAGCTGGGACTACAGGTGCATGG + Intronic
1172621647 20:36321444-36321466 TAGCTGGGGCAGCTGGTCATTGG + Intronic
1173511306 20:43630983-43631005 CAGCTGGGATAGCTGAGGCTAGG + Intronic
1173884449 20:46445308-46445330 CAGCTTCCACAGCTGGTACTGGG + Intergenic
1174160366 20:48546165-48546187 CAGCTGGCAGAGCGGGTGCATGG + Intergenic
1174366130 20:50057626-50057648 CCTCTGGGACAGCTGGGGCCAGG - Intergenic
1174414214 20:50356554-50356576 CAGCTGGCAGAGGTGGAGCTGGG + Intergenic
1174416088 20:50368182-50368204 CAGCAGGGAGAGCGGGGGCTTGG - Intergenic
1174471317 20:50763195-50763217 CAGCTGGGATAGCTGAGGCCTGG - Intergenic
1174979587 20:55378484-55378506 GAGCTGGGTCAGCAGGTGCCTGG - Intergenic
1175317221 20:58057117-58057139 CACCTGGGCCAGCTGGTGACAGG + Intergenic
1175753523 20:61515185-61515207 CAGCAGGGCCTGCCGGTGCTGGG - Intronic
1176034715 20:63030607-63030629 CAGCTGGGACCCCTGGCTCTGGG - Intergenic
1178576549 21:33797562-33797584 CAGCTGGCTTAGCTGGTTCTTGG - Exonic
1178671267 21:34593704-34593726 CTGCTGGGCCAGCTGATGCATGG + Intronic
1179154200 21:38835748-38835770 CAGTTGGGAGGGCTGGGGCTGGG - Intergenic
1179249983 21:39664445-39664467 CAGAGGGGACAGCAGGTGGTAGG - Exonic
1180001478 21:44997311-44997333 CAGCTGGGAACGGGGGTGCTCGG + Intergenic
1182438425 22:30346312-30346334 CTTCTGGGGCAGCTGCTGCTGGG + Exonic
1182510131 22:30813751-30813773 GTGTGGGGACAGCTGGTGCTGGG + Intronic
1182839941 22:33381143-33381165 CAGATGGGACAGCTGGTGACTGG - Intronic
1183293646 22:37017831-37017853 CATGTGGGGCAGCTGGTGCCTGG + Intronic
1183541025 22:38429533-38429555 CTACGGGGACAGCAGGTGCTGGG + Intronic
1184029136 22:41880960-41880982 CAGCTGGTGCAGCCGGTGATAGG - Exonic
1184474321 22:44712344-44712366 CAGGTTCCACAGCTGGTGCTTGG - Intronic
949584427 3:5424026-5424048 CAGCAGTGAAAGCAGGTGCTGGG - Intergenic
949651703 3:6167354-6167376 CTTCTGGTACAGCTGGTTCTAGG + Intergenic
950493637 3:13320930-13320952 TACCTTGGAGAGCTGGTGCTTGG - Intronic
950576345 3:13834358-13834380 AAGCTGGGGCTGCTGATGCTGGG + Intronic
950589912 3:13929701-13929723 CAGCAGGGGCAGCTGGCCCTAGG - Intergenic
950604249 3:14064381-14064403 CTGCTGGGGCTGCTGCTGCTGGG - Exonic
950604315 3:14064825-14064847 CTGCTGGGACTGCTGCTGCTGGG - Exonic
950604317 3:14064840-14064862 CTGCTGGGGCTGCTGCTGCTGGG - Exonic
950681134 3:14585858-14585880 CAGAGGGGACAGCAGGTGCAAGG + Intergenic
952769989 3:36991130-36991152 CAGTTTGGACGGCTGGTACTTGG + Exonic
952777314 3:37059117-37059139 CTACTGGGACACCTGGTCCTGGG - Intronic
952892280 3:38051355-38051377 CAGCAGGGACAGGTGGGGTTGGG - Intronic
953007593 3:38992769-38992791 CAGCTGGGAGATATGATGCTTGG - Intergenic
953084846 3:39655882-39655904 CAGACGGGGCAGCTGCTGCTGGG - Intergenic
953457787 3:43056315-43056337 CAGCGAGGACAGGTGCTGCTGGG + Exonic
953910365 3:46889723-46889745 GATATGGGACAGCTGGTGCAGGG + Intronic
954372402 3:50175693-50175715 GGGCTGGGAGAGCTGGGGCTGGG + Intronic
954752853 3:52823449-52823471 CAGAGGGGAAAGCTGGAGCTGGG + Intronic
954914973 3:54140895-54140917 CAGCTGAGAAAACTGGGGCTTGG + Intronic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
957593186 3:82226067-82226089 GATCTGTGGCAGCTGGTGCTGGG + Intergenic
957940203 3:86993585-86993607 TAGCTGGGACAACTGGTAGTGGG - Intergenic
960758659 3:121048814-121048836 TAGCTGGGACTACAGGTGCTGGG + Intronic
960997556 3:123349993-123350015 CTGCTGGGACAGCAGGTGGAAGG - Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
961811280 3:129523259-129523281 CAGCTGGGCCTGGAGGTGCTGGG - Intergenic
962353991 3:134678073-134678095 CACCTGGGCCACCTGGTGCTGGG + Intronic
962428638 3:135298567-135298589 CAGCTGGCATGGCTGGTGATGGG + Intergenic
963248479 3:143083989-143084011 CAGGTGGGACAGCCAGGGCTGGG + Intergenic
963289994 3:143477770-143477792 CAGCTGAGGAAGCAGGTGCTGGG + Intronic
964077537 3:152709831-152709853 CAGCAGGGAAAGGTGGAGCTGGG - Intergenic
967007394 3:185397396-185397418 CAGCTGGGACTCCTGGTTCATGG + Intronic
967093024 3:186151588-186151610 CAGGTGGGGCAGCTGGTGTGGGG + Intronic
967237195 3:187396946-187396968 CAGCTGGGGCAGTGTGTGCTTGG - Intergenic
968217266 3:196903918-196903940 TAGCTGGGACAACAGGTGCGAGG - Intronic
968234009 3:197021231-197021253 CAGCTGGGAGTGCTGAGGCTCGG + Intronic
968666595 4:1825708-1825730 CATCTGGGACAGTTGCTGGTGGG + Intronic
968691494 4:1992538-1992560 CAGCTGGGCTGGCTGGCGCTGGG + Intronic
968768789 4:2489863-2489885 CAGCTGAGACTTCTGTTGCTGGG - Intronic
969567162 4:7985348-7985370 CACCTGGGACAGCAGGTTCTAGG - Intronic
969614875 4:8246491-8246513 CTGCAGGGGCAGCTGGTTCTAGG + Intergenic
971620308 4:28847766-28847788 CAGATGGGCCAGAAGGTGCTGGG + Intergenic
972822434 4:42717023-42717045 GTGCTGGCCCAGCTGGTGCTGGG + Intergenic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
973605101 4:52579066-52579088 CTGCTGGTGCTGCTGGTGCTGGG + Intergenic
974140293 4:57878149-57878171 CAGCTGGGAAAACTGAAGCTTGG - Intergenic
975729879 4:77327501-77327523 AAGCTGTGACAGATGGTACTTGG - Intronic
975986191 4:80202990-80203012 CAGCTGTCCCCGCTGGTGCTGGG + Exonic
978197162 4:105984946-105984968 CAGCTGTGACAGATGGTACCTGG - Intronic
978573823 4:110168774-110168796 AAGGTGGGACACCTGGTGATTGG - Intronic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
980452506 4:132993054-132993076 CAGTTGGGACTGCTGGTCCTTGG + Intergenic
981363581 4:143875452-143875474 CAGCAGGTGCAGCTGGTTCTAGG + Intronic
981383416 4:144099511-144099533 CAGCAGGTGCAGCTGGTTCTAGG + Intergenic
982552560 4:156821358-156821380 CAGCTGGGACTACAGGTGCGAGG + Intronic
985448445 4:190041353-190041375 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
985929367 5:3044617-3044639 CAGCTGTGCCAGCTGCTGTTTGG - Intergenic
986707552 5:10464072-10464094 CGGCTGGGACAGGTGGGGCAGGG - Intronic
987169090 5:15234549-15234571 TAGCTGGGTCAGCAGGAGCTGGG - Intergenic
991159675 5:63483484-63483506 TATCTGGGAGACCTGGTGCTTGG - Intergenic
992878372 5:81080491-81080513 CATGTGTGACACCTGGTGCTGGG + Intronic
993236044 5:85311651-85311673 CAGCTTTGACAGCTGGCACTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995597516 5:113763903-113763925 CAGCTGGGTCAGCCAGGGCTTGG - Intergenic
995855023 5:116582055-116582077 TTGCTGGGAGAGCTGGTCCTTGG - Intergenic
996862823 5:128084262-128084284 CAGCGGCGGCGGCTGGTGCTGGG + Exonic
997935073 5:138103366-138103388 CAGCTGGGACTGCTCTGGCTGGG + Intergenic
999198975 5:149802681-149802703 CAGATGGGGCAGCTGGGGCTGGG + Intronic
1001065065 5:168529558-168529580 CGGCTGGGGCAGCTGGGGCGGGG + Exonic
1001449125 5:171810545-171810567 CAGCTGTAAGAGCTGGTGTTTGG - Intergenic
1001563198 5:172683550-172683572 AAGCTGGGCCACCTGGCGCTGGG + Exonic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002312633 5:178323911-178323933 CAGCTGGAACAGCTGGTATGTGG + Intronic
1003581041 6:7341193-7341215 CAGTTGACACAGCTTGTGCTAGG + Intronic
1004424956 6:15501030-15501052 CAGCTTGGCCAGCCGGTCCTGGG - Exonic
1006127373 6:31848169-31848191 TAGCTGGGACTACAGGTGCTTGG - Intergenic
1006227598 6:32553467-32553489 CAGGTGGGAGATCTGGGGCTGGG - Intronic
1006230255 6:32580338-32580360 CAGGTGGGAGATCTGGGGCTGGG - Intronic
1006301125 6:33193899-33193921 AAGCTGGGAAGGCTAGTGCTTGG + Exonic
1007983226 6:46180406-46180428 CAGCTAGGCCAGCTGCTTCTGGG - Intergenic
1009440955 6:63677459-63677481 CAGCTGTGTCAGATGCTGCTAGG + Intronic
1009846350 6:69140490-69140512 GAGCTGGGAGAGGTGGTGGTGGG + Intronic
1011718055 6:90127691-90127713 CAGGTGGGACAGCTAGTATTTGG + Intronic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1015757068 6:136618356-136618378 TAGCTTGAACAGCTGGTGCAGGG - Intronic
1017123081 6:151042119-151042141 GAGCTGGGAATGCTTGTGCTGGG - Intronic
1017453089 6:154572915-154572937 CAAGAGGGACAGCTGTTGCTAGG + Intergenic
1019450313 7:1094257-1094279 CATCAGGGACAGCTGCTGCCAGG - Intronic
1019541907 7:1555391-1555413 CAGCTGGCACAGCCGGTGGGGGG + Exonic
1019729503 7:2622518-2622540 CAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1020049756 7:5073513-5073535 CAGCTGGGGCTGCAGGTGATAGG - Intergenic
1020137216 7:5594090-5594112 GAGCTGGGACAGCTGATCCGAGG - Intronic
1020236645 7:6361045-6361067 CAGCTGGGCCAGCAGGGCCTGGG - Intergenic
1021616322 7:22506504-22506526 GAGCTGTGACAGCTGGTGGCGGG - Intronic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022301308 7:29105244-29105266 CAGCTGAGACTGAAGGTGCTGGG - Intronic
1022926116 7:35057716-35057738 CAGCTGTGACAGCTGGTGGCGGG - Intergenic
1023976189 7:45031968-45031990 TAGGAGGGACAGCCGGTGCTGGG - Intronic
1025256268 7:57385658-57385680 CAGCTGGCAGAGGTGGAGCTGGG - Intergenic
1025502685 7:61324509-61324531 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1025517555 7:61670731-61670753 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1025541878 7:62099381-62099403 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1026469871 7:70686009-70686031 GAGCTGGGGGAGATGGTGCTGGG - Intronic
1026765559 7:73157313-73157335 CAGCTGGGTCACCTGGGCCTGGG - Intergenic
1026841243 7:73671017-73671039 CAGATGGAGCAGCTGCTGCTCGG + Exonic
1026859143 7:73773770-73773792 CAGAGGGCCCAGCTGGTGCTGGG + Intergenic
1027042032 7:74967006-74967028 CAGCTGGGTCACCTGGGCCTGGG - Intronic
1027081609 7:75235348-75235370 CAGCTGGGTCACCTGGGCCTGGG + Intergenic
1027161627 7:75806835-75806857 CAGCCTGGAGAGCCGGTGCTTGG - Intergenic
1027249137 7:76387952-76387974 CAGCTGGGACTACAGGTGCATGG - Intergenic
1027978203 7:85185590-85185612 CAGCTGGGGCCGCTGGTGTCCGG - Intronic
1028129756 7:87155910-87155932 CAGCTTTGACCACTGGTGCTTGG - Intronic
1028243900 7:88452911-88452933 CTGCAGGGAGAGTTGGTGCTGGG + Intergenic
1028376138 7:90147833-90147855 GAGCTGTGACAGCTGGTGGCGGG + Intergenic
1028475507 7:91249113-91249135 CAGCCGGGAGAGCTGCTGGTGGG + Intergenic
1029390194 7:100269929-100269951 CAGCTGGGTCACCTGGGCCTGGG + Intronic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1029824125 7:103172403-103172425 GAGCTGTGACAGCTGGTGGCGGG - Intergenic
1030010321 7:105159353-105159375 CAGCTGGGACTATAGGTGCTTGG - Intronic
1031462152 7:122064665-122064687 TAGCTGGGACAACAGGTGCGCGG + Intergenic
1031824558 7:126546914-126546936 CACCTGGCACAGTTGGTACTGGG + Intronic
1031923569 7:127618645-127618667 CTCTGGGGACAGCTGGTGCTAGG - Intergenic
1032000648 7:128263018-128263040 CAGCTGGGATGGCTGGGGCTGGG - Intergenic
1032700548 7:134374892-134374914 CAGCTGTGGTAGCTGGGGCTTGG + Intergenic
1033806256 7:144957361-144957383 CAGCTGTGGCATCTGGTGCTGGG + Intergenic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1035147268 7:156831666-156831688 CAGCTGGCACAGCACGTGCGAGG - Intronic
1035454821 7:159001205-159001227 CAGCCAGGAAAGCCGGTGCTTGG + Intergenic
1036696363 8:10977576-10977598 CAGCCAGGACAGCTGAGGCTGGG + Intronic
1036703553 8:11030099-11030121 GAGCTGGGACAGCTGCAGCTAGG - Intronic
1037917243 8:22780077-22780099 TAGCTGGGACCACAGGTGCTGGG + Intronic
1038642082 8:29337030-29337052 CAGCTGGGAGAGGTGGTGATGGG + Exonic
1038805591 8:30788391-30788413 CAGCTGAGACTACAGGTGCTTGG + Intronic
1039421366 8:37444690-37444712 CATCTGGGTCATCTGGTGGTTGG - Intergenic
1039479779 8:37863924-37863946 CAGCTGTGACAGCAAGTGCAGGG + Intronic
1039557922 8:38490027-38490049 CATATGGGGGAGCTGGTGCTTGG + Intergenic
1039587616 8:38719978-38720000 CACCTGGGCCAGCAGCTGCTGGG + Intergenic
1040712741 8:50208989-50209011 AAGCTGTGACAGATGGTGCCTGG + Intronic
1042194343 8:66219802-66219824 CAGACAGGCCAGCTGGTGCTGGG + Intergenic
1042515057 8:69650510-69650532 TAACTGGGACAACAGGTGCTGGG - Intronic
1043870407 8:85425533-85425555 CAGCTGAGACATCTGGAGATGGG - Intronic
1045413194 8:101940594-101940616 CAGCTGGCACAGCAGGTTTTGGG + Intronic
1046747219 8:117889098-117889120 CAGTTGTGATAGCTGGAGCTGGG + Intronic
1048295682 8:133211911-133211933 CAGATGGGACAGCAGGTGACTGG + Intronic
1049238044 8:141522493-141522515 CACAAGGGCCAGCTGGTGCTGGG - Intergenic
1049315462 8:141964651-141964673 CAGCTGGGAGAGATGAGGCTGGG + Intergenic
1049425097 8:142534410-142534432 CAGCTGGCACAGCTGAAGATGGG + Intronic
1049659474 8:143813333-143813355 AAGCTGGAACAGCTGGATCTGGG - Exonic
1049681166 8:143919009-143919031 CAGCTGGGCCCGCTGCTCCTCGG + Exonic
1049799460 8:144511024-144511046 CTGCTGGGGAAGCTGCTGCTGGG + Exonic
1049884303 9:17336-17358 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1050055473 9:1648537-1648559 CAGCTGGGACTACTGGAGGTGGG - Intergenic
1051620960 9:19049210-19049232 CAGCTGGGTTTGCTGTTGCTAGG - Intronic
1052039578 9:23722956-23722978 CACCTGGGAAAAGTGGTGCTAGG - Intronic
1052910543 9:33877310-33877332 TAGCTGGGACTACTGGTGCCCGG + Intronic
1053142192 9:35689269-35689291 CAGCTGGGACAGAGGGGACTTGG + Exonic
1053684443 9:40508246-40508268 GAGCTGGGAATGCTTGTGCTGGG - Intergenic
1053934412 9:43136532-43136554 GAGCTGGGAATGCTTGTGCTGGG - Intergenic
1054279282 9:63116706-63116728 GAGCTGGGAATGCTTGTGCTGGG + Intergenic
1054297538 9:63343713-63343735 GAGCTGGGAATGCTTGTGCTGGG - Intergenic
1054395554 9:64648219-64648241 GAGCTGGGAATGCTTGTGCTGGG - Intergenic
1054430201 9:65153419-65153441 GAGCTGGGAATGCTTGTGCTGGG - Intergenic
1054500182 9:65868113-65868135 GAGCTGGGAATGCTTGTGCTGGG + Intergenic
1054796911 9:69310925-69310947 CAGCTGGAACAGCTGGAACCAGG + Intergenic
1056156378 9:83842594-83842616 CAGCTGGGACTACAGGTGCCTGG + Intronic
1056601811 9:88052766-88052788 CAGCTGTGGCAGCTGGGGGTGGG - Intergenic
1056740622 9:89251318-89251340 CAGCTCTGCCAGATGGTGCTGGG - Intergenic
1057305101 9:93907697-93907719 CAGCTGGGACTGCTGCTCCGCGG + Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1059453811 9:114387383-114387405 GAGCTGGGTCTGCTGGTCCTCGG + Intronic
1060183558 9:121550591-121550613 CAGCTGGAGGTGCTGGTGCTGGG - Intergenic
1060795092 9:126507805-126507827 CAGATAGAACAGCTGATGCTGGG + Intergenic
1061043617 9:128152968-128152990 CAGCTGGGCCAGGTGGGGCAGGG + Intronic
1061063210 9:128261156-128261178 CAGATGGGTAAGCTGGGGCTGGG - Exonic
1061082007 9:128376853-128376875 CAGCTGGGACTACAGGTGCATGG - Intronic
1061086803 9:128404422-128404444 CAGATGGCACAGCTGGTGGGTGG + Intergenic
1061208533 9:129177711-129177733 GAGCTGGTGCAGCTGGTGCCGGG + Exonic
1061239130 9:129358980-129359002 CAGCAGGGACAGCATGTGCAAGG - Intergenic
1061487450 9:130927507-130927529 CAGCTGGCACAGATGGGGCCTGG + Intronic
1061726984 9:132587419-132587441 CAGCTGCGCCAGCTGATGGTCGG - Exonic
1061955481 9:133959247-133959269 CACCTGGGGCAGCTGCTGCACGG + Intronic
1062082083 9:134629558-134629580 CAGCTGGGGCAGTTGGGTCTGGG + Intergenic
1062110235 9:134778267-134778289 CAGCTGGGCCAGCTGCTGAGAGG - Intronic
1062514575 9:136926167-136926189 CAGCAAGGGCAGCTTGTGCTGGG - Exonic
1062534359 9:137015024-137015046 GAACTGGGACACCTGGAGCTCGG + Exonic
1062722768 9:138053196-138053218 CAGCTGCACCAGCAGGTGCTGGG - Intronic
1189974018 X:46444766-46444788 CATCTAGGACAGGTGGTGCTTGG + Intergenic
1191881190 X:65845147-65845169 CAGCTGGGGAAGTTGGTCCTCGG - Intergenic
1192259846 X:69498832-69498854 GAGCTGGGATAGATGGGGCTGGG - Intergenic
1192581915 X:72290543-72290565 CAGCTGGGACTTCTAGTACTAGG + Intronic
1199779031 X:151041329-151041351 AAGCTGGGACAGATGGTACCCGG - Intergenic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic
1200401502 X:156022820-156022842 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1200768390 Y:7101172-7101194 CAGCTGGTACAGCTTCTACTAGG + Intergenic