ID: 1139606633

View in Genome Browser
Species Human (GRCh38)
Location 16:68023383-68023405
Sequence TCCCCAAGGCTGGCCGGGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 258}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139606633_1139606649 30 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606649 16:68023436-68023458 TGGCGATACGAGGCGGCAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1139606633_1139606643 3 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606643 16:68023409-68023431 GCGCGTCGTGGAGGCAGGACTGG 0: 1
1: 0
2: 0
3: 1
4: 118
1139606633_1139606644 6 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606644 16:68023412-68023434 CGTCGTGGAGGCAGGACTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 186
1139606633_1139606647 23 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606647 16:68023429-68023451 TGGAGGCTGGCGATACGAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 96
1139606633_1139606645 10 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606645 16:68023416-68023438 GTGGAGGCAGGACTGGAGGCTGG 0: 1
1: 16
2: 28
3: 120
4: 1068
1139606633_1139606640 -9 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606640 16:68023397-68023419 CCTTGGGGAAGGGCGCGTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 82
1139606633_1139606648 29 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606648 16:68023435-68023457 CTGGCGATACGAGGCGGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 56
1139606633_1139606646 20 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606646 16:68023426-68023448 GACTGGAGGCTGGCGATACGAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1139606633_1139606641 -6 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606641 16:68023400-68023422 TGGGGAAGGGCGCGTCGTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 196
1139606633_1139606642 -2 Left 1139606633 16:68023383-68023405 CCAGACCCGGCCAGCCTTGGGGA 0: 1
1: 0
2: 3
3: 22
4: 258
Right 1139606642 16:68023404-68023426 GAAGGGCGCGTCGTGGAGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139606633 Original CRISPR TCCCCAAGGCTGGCCGGGTC TGG (reversed) Exonic
900413280 1:2523352-2523374 CCCCCAGTGCTGGCCGGGCCCGG + Intronic
902169673 1:14599451-14599473 TCGCTCAGGCTGGCCGGGGCCGG - Intronic
902305277 1:15533205-15533227 TCTCCAAAGCTGGCCGGGTGTGG + Intronic
902698943 1:18158528-18158550 TCCCCGACGCTGCCCTGGTCAGG - Intronic
903014556 1:20353645-20353667 TCCCCCAGGCAGGCAGGGTGGGG + Intronic
904252912 1:29237618-29237640 CCCCCTGGGCTGCCCGGGTCGGG + Intronic
904599431 1:31665501-31665523 TACCCCAGCCTGGCCTGGTCAGG + Intronic
905090859 1:35430236-35430258 TCCCCAAAGATGGCCGGGCGCGG - Intergenic
905726722 1:40258424-40258446 ACTCCAGGGCTGGCCGGGTATGG - Intronic
905801921 1:40849748-40849770 TCCCCATGGCTGTGCGGGTCTGG + Intergenic
906344042 1:45004219-45004241 TCCCCAAGGCAGGGCAGGGCAGG - Intronic
907688033 1:56633236-56633258 TCGCCAAGGCTAGCATGGTCTGG + Intronic
912044501 1:105437370-105437392 TGCCCAAGTCTGGCTGAGTCTGG - Intergenic
912452733 1:109777214-109777236 ACCCCAGGGCTGTCCAGGTCGGG - Intergenic
915461942 1:156075677-156075699 TCCCCAAAGCTGGGCTGGTAGGG + Exonic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
915621587 1:157089273-157089295 TCTCCAAGGCGGGCCGGGCACGG + Intergenic
916378422 1:164181988-164182010 CCCCCAAGGCTGGTGGGGTAGGG - Intergenic
916500526 1:165383307-165383329 TCACCAAGGCTGGCCGAGCCAGG - Intergenic
920088555 1:203435719-203435741 TTCCCCAGGCTGGCCTGGCCTGG + Intergenic
920231361 1:204472451-204472473 TCCCCCAGTCGGGCCGGGTGCGG - Intronic
920313546 1:205062240-205062262 TCCCCAAAGCTGGAAGGGTGAGG - Intronic
920674459 1:208029536-208029558 TTCCCAGGGCTGGCCTGGCCTGG + Intronic
920789729 1:209078383-209078405 TTCCCAATGATGGCAGGGTCTGG - Intergenic
920916392 1:210261457-210261479 CCCCAAGGGCTGGCTGGGTCAGG - Intergenic
921207996 1:212865770-212865792 TCCCTATTGCTGGCCGGGCCTGG - Intronic
922762329 1:228140734-228140756 ACCCCAAGGCTTGCAGGGTGAGG - Intronic
922948099 1:229534433-229534455 TTGCCAATGCTGGCCGGGTGCGG + Intronic
923673816 1:236064161-236064183 TCCCCGTGACTGGCCGGGCCTGG - Intronic
1063425764 10:5948856-5948878 TCACCAAGGATGGCCGGGCAGGG - Intronic
1063592644 10:7408554-7408576 TCCCCGGGGCTGGCGGGGGCAGG - Intronic
1064030534 10:11880161-11880183 TCCCCGAGGCTGGGCAGGCCTGG + Intergenic
1064645095 10:17453235-17453257 TCTCCAAAGGTGGCGGGGTCGGG + Intronic
1065494361 10:26313669-26313691 TCTCCACGGCTGGCTGGGCCGGG + Intergenic
1067282858 10:44886030-44886052 CCCCCAAGCCTGGCAGGGACAGG + Intergenic
1067832284 10:49617074-49617096 ACCCGAAGGCTGGCTGGGGCGGG - Intronic
1069794048 10:71041177-71041199 TCCCCTATGCTGGCCAGCTCGGG - Intergenic
1070401366 10:76056226-76056248 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
1073131100 10:101189756-101189778 CCCCCAAGGCTGGCAGAGGCTGG + Intergenic
1073136953 10:101225485-101225507 GCCCCAAGGCCGGCTGGGGCGGG - Intergenic
1074035729 10:109736360-109736382 TCCTGAAGGCTGGCAGGGTGGGG - Intergenic
1076028294 10:127135248-127135270 TCCCCAAGCCAGGCCAGCTCTGG + Intronic
1076885193 10:133258915-133258937 TCCCAAAGACTGGCCTGGTCAGG - Intergenic
1077155539 11:1089345-1089367 TCCCCAAGGTTGGCCCTGCCGGG + Intergenic
1077299797 11:1841673-1841695 TCCCCATGGCTGGTCTGGTCTGG + Exonic
1077418289 11:2436199-2436221 ACCCAAAGGCTGGCAGGGTTTGG - Intergenic
1077459436 11:2701196-2701218 TCTCCAAGGGTGACCGGGTTGGG + Intronic
1077518048 11:3014100-3014122 TCCCCAAGGCTTGTCTGGGCTGG - Intronic
1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG + Intergenic
1078361434 11:10671419-10671441 ACCCAACGGCTGGCCGGGTGTGG + Intronic
1078932243 11:15921504-15921526 TCCAAAAGGCTGGCCAGGTGGGG + Intergenic
1080434122 11:32224169-32224191 ACCCTAAGGCTGGCCGGGCACGG + Intergenic
1080851960 11:36078102-36078124 TCCTCAAGTCTGGCTGAGTCCGG + Intronic
1082010413 11:47446613-47446635 TACCCAGGGTTGGCCGGGTGCGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083033573 11:59615776-59615798 TCCCCGCGGCTGGCCGGGCGGGG - Exonic
1083439916 11:62669270-62669292 ACCCCAAGACTGGCCGGCTTGGG + Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1084423330 11:69071431-69071453 TCCCCAATGCTGGCTGTGCCTGG + Intronic
1085756895 11:79209289-79209311 TTCCCAAGGCCGGCCGGGTTGGG - Intronic
1087244164 11:95814648-95814670 TACACAAGGCTGGCCGGGCGTGG - Intronic
1088595033 11:111435055-111435077 TCCCCAGGGCTGCCCGGTTCTGG + Intronic
1089343070 11:117772798-117772820 TCTCCAAGGCTGGCAGGGTTGGG - Intronic
1091757228 12:3061972-3061994 TCCCCATGGCTGGCCTGTGCGGG + Intergenic
1092046235 12:5433222-5433244 TCCCCTGGGATGGCCGGGCCCGG - Intronic
1095349178 12:41188862-41188884 CACCCAGGGCTGGCCGGGGCGGG + Exonic
1095970820 12:47901058-47901080 ACCCCAAGGCTGGCTGGGAGAGG - Intronic
1097013700 12:55970801-55970823 TCCCCAAGGCTGGGTGGGTCTGG - Intronic
1097285457 12:57873707-57873729 TTCCCAAGACTGGCCGGGCGCGG - Intergenic
1098189725 12:67935409-67935431 GTCCCAAGGTTGGCCGGGTGTGG + Intergenic
1099682353 12:85844478-85844500 TCCCCAATTCTGGCTGAGTCTGG - Intergenic
1100883739 12:99046507-99046529 GACCCAAGTCTGGCCGGGTGCGG + Intronic
1101522004 12:105492673-105492695 TCCCCAAGGCTTGGCTGGGCAGG + Intergenic
1104831911 12:131758152-131758174 ACCCCATAGCTGGCTGGGTCAGG - Intronic
1104995999 12:132657102-132657124 GCCCCAAGGCTGGGCTGGGCGGG - Intronic
1106181203 13:27371370-27371392 TCCCCATGGATGGCTTGGTCTGG - Intergenic
1106789082 13:33136665-33136687 TCCCCTAGTGTGGCTGGGTCTGG - Intronic
1107402966 13:40087118-40087140 TCTCCAATGCTGGCCCTGTCAGG + Intergenic
1107560575 13:41553691-41553713 TCTCTAAGACTGGCCAGGTCTGG + Intergenic
1112438536 13:99408612-99408634 TCCGCACGGCTGGCCGCGCCAGG - Intergenic
1114612379 14:24051565-24051587 TCCCCGAGGCAGGGCGAGTCGGG + Intergenic
1115853237 14:37603711-37603733 TCCCTAGGGCTGGCAGGCTCAGG + Intronic
1117555151 14:56876387-56876409 TACTCAAGGCTGGCTGGGTGTGG - Intergenic
1119230060 14:72972588-72972610 TACGCAAGGCTGGCCAGGCCTGG - Intronic
1119481995 14:74963644-74963666 TCCCCCAGGCTCCCCGGATCAGG - Intergenic
1120058095 14:79948917-79948939 TCCCCAAGTGAGGCCAGGTCAGG - Intergenic
1121319298 14:92981712-92981734 TCCTCAAGGCTGTCACGGTCAGG + Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1122305893 14:100766234-100766256 TCCCCCAGGGTGGCCGACTCTGG - Intergenic
1122817472 14:104320741-104320763 TCCTCCGGGCTGGCCGAGTCTGG + Intergenic
1124385866 15:29207806-29207828 TCCCCAGGCCTGGCAGGGACTGG - Intronic
1125479222 15:40069196-40069218 ACTCCAGGGCTGGCCGGGCCAGG - Intergenic
1126990831 15:54374105-54374127 TCCCCAAGTCTGTCTGAGTCTGG + Intronic
1128734974 15:70048370-70048392 TCTCCAAGGCTGGGCGCGTGGGG - Exonic
1129720286 15:77874267-77874289 TCAACAAGGCTGGCCTGGGCTGG - Intergenic
1130949389 15:88573529-88573551 GAGCCAAGGCTGGCCGGGTGTGG - Intergenic
1131059910 15:89398266-89398288 TCCCAGAGGCTGGCCTGGTGTGG + Intergenic
1131273569 15:90961466-90961488 TCCCCAAGGTTGCCTGGCTCTGG + Intronic
1132571507 16:646406-646428 GCCCCAGGGCTGGCAGGGTCTGG - Intronic
1132669073 16:1095338-1095360 CCCCCAAGGCTGGCCTGGGGTGG + Intronic
1133018693 16:2956416-2956438 ACCCCAAGGCTGGCAGGGCCCGG - Intergenic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1133310993 16:4846988-4847010 TCCCCGAGGCCGGCCGGGTGGGG - Intronic
1133940482 16:10305121-10305143 TCAACATGGCTGGCCGGGCCTGG - Intergenic
1134766064 16:16759105-16759127 TCCCAAAGGCTAGCTGGGGCTGG - Intergenic
1134882442 16:17757474-17757496 TCCCAAAGGCTGGCCAGGCGAGG - Intergenic
1134979982 16:18600109-18600131 TCCCAAAGGCTAGCTGGGGCTGG + Intergenic
1135591459 16:23707936-23707958 TCCCCAAAGCTGGACTTGTCTGG + Intronic
1137319939 16:47370388-47370410 TCCCCACGTGTGGCTGGGTCTGG - Intronic
1137700343 16:50493386-50493408 TACACATGGCTGGCCGGGTGTGG - Intergenic
1138558811 16:57788054-57788076 TGCCCAGGGCTGGCTGGTTCTGG - Intronic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1140103521 16:71938654-71938676 TGCCCAAGTCTGGCTGAGTCTGG - Intronic
1141083764 16:81076978-81077000 TCCCCAGAGCGGGCGGGGTCTGG - Intronic
1141910179 16:87053344-87053366 CCCCCAAGGCTGGCGGGGGACGG + Intergenic
1142760539 17:2039665-2039687 TCCACAGGGCTGGCCGGGCGCGG - Intronic
1142866417 17:2794281-2794303 TCCCCTTGGCTGGCCAGGCCTGG + Intronic
1144317840 17:14080501-14080523 TCCCAAATGCTGGCCGGGTGCGG - Intronic
1144826705 17:18109245-18109267 TCCCCAAGGCTGGCTGGCAAAGG + Intronic
1144846311 17:18221462-18221484 TCTCCCAGGCTGGGAGGGTCTGG - Intergenic
1145778864 17:27548796-27548818 TCACCAAGGCTGGCAGGCTGGGG - Intronic
1148812069 17:50299672-50299694 TATCCAAGGCTGGCCAGGTGTGG - Intergenic
1149634123 17:58152893-58152915 TCCCCAAGGCTGGCCTGCAGTGG - Intergenic
1151963499 17:77419541-77419563 TCCCCAGGGCTGGCTGGGAATGG + Intronic
1152073105 17:78143848-78143870 TCCCCAAGGCTGGGGGTGGCTGG - Intergenic
1152205697 17:78973400-78973422 TCCCCAGGGCTGGAAGGGGCGGG - Intronic
1152873521 17:82772395-82772417 TCCCCAAGGCTGGCGTGTGCAGG + Intronic
1153428773 18:4992888-4992910 TGCCCAAGTCTGGCTGAGTCTGG + Intergenic
1154462331 18:14605332-14605354 TACCCAAGACTGGACGGGTGCGG + Intergenic
1160835620 19:1123222-1123244 TGGTCAGGGCTGGCCGGGTCGGG + Intronic
1161116664 19:2500907-2500929 TCCCCCTGGGTGGCCGCGTCGGG - Intergenic
1161439080 19:4280226-4280248 TCCCCAGGGCCCGCGGGGTCCGG - Exonic
1162398310 19:10430676-10430698 CCCCCAGGGCGGGGCGGGTCTGG - Intronic
1163369408 19:16893651-16893673 CCCCCAAGGCAGGCAGGTTCTGG + Intronic
1163495332 19:17643300-17643322 TGCCCATGGCTGGCCGGGCGCGG - Intronic
1165130640 19:33629735-33629757 TCCCCGAGTCTGGCCCAGTCAGG - Intronic
1165645287 19:37430997-37431019 TCCCCTAGACTGGCTGGGGCTGG - Intronic
1165833646 19:38742033-38742055 TCCATATGGCTGGCCGGGTGCGG + Intronic
1167376548 19:49115067-49115089 ACCCCAAGGCGGGCCGCCTCGGG - Intronic
925026325 2:610114-610136 GCCCCAGGCCTGGCTGGGTCTGG + Intergenic
925399018 2:3558505-3558527 TCCCGAAGGCGGGCGAGGTCTGG + Exonic
925435958 2:3837780-3837802 TCCACACGGCTGGCCGGCTGAGG - Intronic
925930743 2:8706007-8706029 TCCCCACGGAACGCCGGGTCAGG + Intergenic
926500074 2:13642823-13642845 TCCCCCAGGATGGCTGAGTCTGG + Intergenic
927927558 2:27024380-27024402 TCCTCCAGGCTGGCAGGGCCGGG - Intronic
929814671 2:45221445-45221467 CCACCATGGCTGGCCAGGTCTGG + Intergenic
930716207 2:54596220-54596242 TCCCCAAGCCTTGCTGGGTGGGG + Intronic
931092552 2:58901422-58901444 TCTCCGAGGCTGGCCAGTTCTGG + Intergenic
932471520 2:71962503-71962525 ACACCAAGGCTGGCTGGGCCTGG + Intergenic
934537425 2:95146953-95146975 TCCACAAGGTTGGCCAGGGCAGG - Intronic
934652710 2:96101615-96101637 TCCCCTAGGCTGGAGGGGGCTGG - Intergenic
934729840 2:96649571-96649593 TGTCCAAGGATGGCAGGGTCTGG + Intergenic
935026191 2:99279182-99279204 TCCCCAAGGCTGGATGAGTCAGG + Intronic
937319269 2:120951301-120951323 TCCCCAGGGCCAGCCGGGTGCGG - Exonic
938124571 2:128662681-128662703 TCCCCAAGGCTTGCGTGGCCTGG + Intergenic
938307501 2:130265531-130265553 TCCCCAAGGCTGGGCAGATGAGG + Intergenic
938447831 2:131391311-131391333 TCCCCAAGGCTGGGCAGATGAGG - Intergenic
942004883 2:171687961-171687983 TCCCCAAAGCTGGGCCGGGCGGG - Intronic
945327458 2:208499197-208499219 TCCCGAAGACTGTCAGGGTCAGG + Intronic
945770375 2:214035165-214035187 TCCTCAAGTCTGGCTGAGTCTGG + Intronic
946349747 2:219142393-219142415 TCCCTGAGCCTGGCCGCGTCTGG + Intronic
946941440 2:224773917-224773939 TTCTAAAGGCTGGCCGGGTGCGG - Intronic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948888609 2:240896328-240896350 ACCCCAAGCCTGGCTGGGACAGG - Intronic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
949031604 2:241799795-241799817 TCACCCAGGCTGGCCAGGCCTGG + Intronic
949036275 2:241816995-241817017 TCCCCAAGGTTGGGCGGTTTGGG - Exonic
1169299893 20:4432838-4432860 TCCCCAAGGATGGCAAGGACAGG + Intergenic
1169880526 20:10341796-10341818 TACCCAAGTCTGGCTGTGTCTGG - Intergenic
1171233285 20:23504849-23504871 TCCCCAAAGCTGGGGAGGTCAGG + Intergenic
1172118173 20:32583825-32583847 TCCCCCGGGCCGGCCCGGTCCGG - Intronic
1172764956 20:37346285-37346307 TCCCCCGCGCTGGCCGGGGCGGG - Intronic
1176812180 21:13553037-13553059 TACCCAAGACTGGCCGGGTGCGG - Intergenic
1179099429 21:38343783-38343805 AGCCCAGGGCTGGCTGGGTCAGG - Intergenic
1179724348 21:43333502-43333524 TCCTCAGGGCAGGCCGGGGCTGG + Intergenic
1180025896 21:45161850-45161872 TGCCCAAGTCTGGCTGAGTCCGG - Intronic
1180132582 21:45835898-45835920 GCCCCAGGCCTGGCGGGGTCTGG + Intronic
1181741981 22:24928509-24928531 TCCCCAGGTCTGGCCGTGCCAGG - Intergenic
1182225584 22:28795647-28795669 TCCTCCAGGCTGGCAGGCTCTGG + Exonic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182623623 22:31630850-31630872 GCCCCAAGGCTTCCCGGCTCCGG - Intronic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1184818820 22:46893375-46893397 TCCACAAGGCTGGGCAGGTGGGG - Intronic
949928046 3:9057594-9057616 ACCCAGAGGCTGGCTGGGTCTGG + Intronic
952793356 3:37217724-37217746 TCCCCAAGTCTGCCTGAGTCTGG - Intergenic
953753975 3:45630911-45630933 TCCCCAAGTCTGGCTAGGTGCGG + Intronic
953759063 3:45672686-45672708 TCCCCAGGGCTTGCAGGATCTGG - Exonic
955209151 3:56924962-56924984 TCCCCAAAGCTAGCCAGGTAGGG - Intronic
955228428 3:57079298-57079320 TCCCCTGGGCTGGGCGGGGCCGG + Exonic
958584591 3:96069592-96069614 TCCACAGAGCTGGCAGGGTCAGG - Intergenic
961035293 3:123637788-123637810 TCCCCAAGGCTGGCCAGCCTGGG - Intronic
961680855 3:128599018-128599040 GCCCCAAGGCAGGCCGAGCCTGG + Intergenic
964819761 3:160756246-160756268 CCCCGAAGGCTCGCCGGGTCCGG - Exonic
965813389 3:172614205-172614227 TCCCCAAGTCTGGCTGAGTCTGG + Intergenic
967276872 3:187784626-187784648 ACCCCAAGCCTGGCCGGGCGCGG - Intergenic
968838321 4:2981596-2981618 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
969431934 4:7160486-7160508 GCCCCAAGGCGGGCCTGGCCGGG - Intergenic
969676760 4:8618648-8618670 CTCCCCAGGCTGGCTGGGTCGGG + Intronic
972567071 4:40279302-40279324 ACCCCAATGCTGGCCGGGCACGG + Intergenic
975321346 4:73012232-73012254 TCCTCAAGCCTGGCTGAGTCTGG - Intergenic
976097800 4:81527942-81527964 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
976217808 4:82731307-82731329 TCCCCAAGGCTGTCCTAGCCAGG - Intronic
982181369 4:152751358-152751380 TCCCCTAGTCTGCCAGGGTCTGG - Intronic
984169417 4:176343174-176343196 TACCCAAGCCTGGCTGAGTCTGG + Intergenic
985512112 5:318784-318806 TCCCACAGGCAGGCCAGGTCAGG - Intronic
987951933 5:24687257-24687279 TGCCCAAGTCTGGCTGAGTCTGG + Intergenic
988609972 5:32714154-32714176 TTCCCAAGGCCGGCTGGGACTGG + Intronic
989279163 5:39621776-39621798 TGCTCAAGGCTGGCTGAGTCCGG + Intergenic
989520683 5:42396675-42396697 TCCCCAAGTCTGGCTGAGTCTGG - Intergenic
994670361 5:102755482-102755504 TCTCCCGGGCTGCCCGGGTCGGG + Intronic
999266119 5:150268069-150268091 TCCACCATGCTGGCCTGGTCAGG + Intronic
999322559 5:150624604-150624626 CCCCCAGGGCTGGGCGGGGCGGG + Intronic
1000637356 5:163659455-163659477 TCCCCAAGGCTGGAAGGCACTGG + Intergenic
1001474756 5:172042600-172042622 TTCCCAACGCTGGCCTGGCCTGG + Exonic
1001653155 5:173329434-173329456 TCCCCAAGAACCGCCGGGTCGGG + Exonic
1002185400 5:177452410-177452432 TTGCCAAGTCTGGCCTGGTCAGG + Intronic
1002350112 5:178577378-178577400 TCCCCAAGGGCGGCCGCATCCGG + Intronic
1003360758 6:5423078-5423100 TCCACAAAGCTGGTCGGGTGGGG - Intronic
1004059319 6:12176520-12176542 TACCCAAGACTGGCCGGGCACGG - Intergenic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1007384423 6:41511085-41511107 TCCCCAAGGCTGGCAGCTTTCGG + Intergenic
1014418725 6:121215107-121215129 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
1015647163 6:135405567-135405589 TACTCAAGTCTGGCCGGGTACGG + Intronic
1016330131 6:142946057-142946079 TCGCCAAGGCTGAGCGTGTCTGG + Intergenic
1016428845 6:143962163-143962185 AGCCCAAGGCAGGCCTGGTCTGG + Intronic
1018940993 6:168308770-168308792 TCCTCGAGGCTGGCCCGGCCAGG - Exonic
1019562139 7:1664548-1664570 GCCCCGAGGATGGCCGGGCCGGG - Intergenic
1019685887 7:2382033-2382055 TCCCCACGGCTGGCGGGCTCAGG + Intergenic
1021565457 7:22012154-22012176 TCCCCCAGGCCGGCCGGGCGCGG - Intergenic
1022505574 7:30907122-30907144 TACCCCAGGCTGGCCGTGCCTGG - Intergenic
1022954282 7:35366982-35367004 TACCCAAGACTGGGTGGGTCTGG - Intergenic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1026889718 7:73974837-73974859 TCCCCAAGGCCGGCCTGCCCTGG + Intergenic
1029460967 7:100693857-100693879 TCCCCGAGGCTGGCCGGCTCTGG + Intergenic
1029528754 7:101111556-101111578 TGCTCAAGGCTAGCCTGGTCTGG + Intergenic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1032591170 7:133193767-133193789 TGCCCAAGTCTGGCTGAGTCTGG + Intergenic
1034094623 7:148395729-148395751 TCCACAGGCCTGGCCGTGTCAGG + Intronic
1034723487 7:153315229-153315251 TCCGGGAGGCTGGCCGGGTGGGG + Intergenic
1035117098 7:156533694-156533716 TCCCCAGGGCTGGCCTGGCATGG - Intergenic
1035338547 7:158145607-158145629 ACGCCAAGCCTGGCCGCGTCTGG - Intronic
1036915422 8:12799602-12799624 TTCCCAAGTCTGGCTGAGTCTGG + Intergenic
1037325784 8:17688919-17688941 TACCCAAGCCAGGCCGGGTGCGG + Intronic
1037741699 8:21613791-21613813 TCACCCAGGCTGCCCTGGTCTGG - Intergenic
1038212999 8:25537221-25537243 TCCCCAGAGCTGGCAGGGTTGGG + Intergenic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1040289654 8:46117786-46117808 TCCCCAAGGCTGTCCCAGGCAGG - Intergenic
1040295829 8:46148591-46148613 TCCCCAGGGCTGTCCTGGTCGGG - Intergenic
1040305571 8:46210071-46210093 CCCTCAAGGCTGTCCTGGTCAGG + Intergenic
1040310259 8:46233204-46233226 CCCCCATGGCTGTCCGGGGCGGG + Intergenic
1040312935 8:46246127-46246149 TCCCCAGGGCTGTCCTGGGCAGG + Intergenic
1040326051 8:46342136-46342158 TCCCCAGTGCTGTCCTGGTCAGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1040342117 8:46446347-46446369 CCCCCAAGGCTGTCCGGGGTGGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1041673773 8:60517454-60517476 GCTGCAAGACTGGCCGGGTCGGG - Intronic
1042194658 8:66221900-66221922 TCCACAAGGCTGGCTGCTTCTGG + Intergenic
1043082520 8:75784457-75784479 TCCCCGAGTCTGGCTGAGTCTGG + Intergenic
1046195733 8:110860646-110860668 TGCCCAAGTCTGGCTGAGTCTGG - Intergenic
1049223176 8:141437043-141437065 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223191 8:141437080-141437102 TCCCCATGGCGGGCAGGGCCAGG - Intergenic
1049223206 8:141437117-141437139 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223221 8:141437154-141437176 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223236 8:141437191-141437213 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223251 8:141437228-141437250 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223266 8:141437265-141437287 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223280 8:141437302-141437324 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1057132762 9:92666204-92666226 TCCCCAAGGCTGAGGTGGTCCGG + Intronic
1057858141 9:98618124-98618146 TCCCCATGGCTGTCAGGCTCAGG + Intronic
1058914987 9:109557036-109557058 TCCCCAATGCTGTCCAGGTATGG - Intergenic
1060201037 9:121651880-121651902 TACCCCTGGCAGGCCGGGTCCGG - Intronic
1060251958 9:121994010-121994032 TCCCTGAGGCTGGCAGGGGCTGG - Intronic
1060503472 9:124180702-124180724 TCCCCAGGGCTGGCTGGCTCTGG + Intergenic
1060821435 9:126663845-126663867 GCCCCATGGGTGGCCTGGTCTGG - Intronic
1060831835 9:126722376-126722398 TCCCCGAGGCCGGCCCGGGCTGG - Intergenic
1061836149 9:133331565-133331587 TCCCCGAGGTTTGCAGGGTCAGG - Exonic
1189722061 X:43930258-43930280 TCCCCAATGCTGACCAGGGCTGG + Intergenic
1190273362 X:48884279-48884301 TTGCCAAGGTTGGCCGGGTGAGG + Intergenic
1190950893 X:55141486-55141508 TACCCAAGACTGGCCGGGCACGG - Intronic
1194765567 X:97843475-97843497 GCCCCGCGGCTGGCCGGCTCCGG + Intergenic
1196800478 X:119538724-119538746 AACCCAAGGGTGGCCGGGTACGG - Exonic
1197262323 X:124332630-124332652 GCCGCAAGGCTGGCTGGGACCGG - Intronic
1198171838 X:134114521-134114543 TCCCAAAGGCTAGCAGAGTCTGG - Intergenic