ID: 1139607908

View in Genome Browser
Species Human (GRCh38)
Location 16:68033012-68033034
Sequence CTGATCATGCAGGGCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 0, 2: 36, 3: 159, 4: 567}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139607908 Original CRISPR CTGATCATGCAGGGCCTTGT GGG Intronic
901053684 1:6438587-6438609 CTGTGCATGCAGGGCCTGGCCGG - Intronic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902231123 1:15028251-15028273 ATGATCCTGCAGGGCCTGCTGGG + Intronic
902406154 1:16184731-16184753 CTGGTCATGCAGAGCCTTGGTGG - Intergenic
902408565 1:16199760-16199782 CAGACCATGAAGGGCCTTGTAGG - Intronic
902480620 1:16709744-16709766 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
902908960 1:19580936-19580958 CAGATAGTGTAGGGCCTTGTAGG - Intergenic
903234565 1:21941397-21941419 TAGATCATGCCAGGCCTTGTGGG - Intergenic
903320572 1:22540727-22540749 CAGAGTATGCAGGGCCTTCTAGG + Intergenic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904286925 1:29458959-29458981 CTGATCACTCAGGGCCCTGGGGG - Intergenic
904484368 1:30815034-30815056 CCGATCACGCAGAGCCTCGTGGG - Intergenic
904730430 1:32586788-32586810 CAGATCATATAGGGCCTTTTAGG + Intronic
905043023 1:34976168-34976190 CAAATCAGACAGGGCCTTGTAGG + Intergenic
905280624 1:36846755-36846777 CAGACCATGCAGAGCCTTTTGGG + Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905400476 1:37699040-37699062 CTGCTCAGGCAGCGCCTTGTTGG + Intronic
905546876 1:38807207-38807229 CAGATCAGGAAGGGTCTTGTGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905730647 1:40297025-40297047 TAGATTTTGCAGGGCCTTGTAGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906096556 1:43228147-43228169 TGGATCACGCAGGACCTTGTGGG - Intronic
906175767 1:43770931-43770953 CAGAATATGAAGGGCCTTGTAGG - Intronic
906579565 1:46925332-46925354 CTTAGCTTGCTGGGCCTTGTGGG + Intergenic
906604157 1:47153554-47153576 CTTAGCTTGCTGGGCCTTGTGGG - Intergenic
906706299 1:47897331-47897353 CTGATCATTTTGGGCCTTGTAGG + Intronic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
907123075 1:52024688-52024710 TAGATCATGTAGGGCCTTATAGG - Intronic
907530221 1:55088037-55088059 CAGATCAAGCAAGGCCTTGTGGG + Intronic
907638346 1:56159100-56159122 CAGATCATGCAGGGATCTGTAGG + Intergenic
907772947 1:57484221-57484243 CAGATCATCCTGGGCCTTGGGGG + Intronic
907952162 1:59194151-59194173 CAGAGCATGCATGACCTTGTTGG - Intergenic
908379984 1:63588630-63588652 CTGATCATATTGGGCCTTGTAGG - Intronic
908582553 1:65531091-65531113 ATGATCAGGTAGGGCCTTGGAGG - Intronic
909319737 1:74268924-74268946 ATAATCTTGCAGGGCCTTCTAGG - Intronic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
910392323 1:86757742-86757764 CTGATTATTCAGGGCCTGCTTGG - Intergenic
910662560 1:89689340-89689362 CAGATCACGTAGGGCCTTCTAGG + Intronic
910791395 1:91054761-91054783 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
911061334 1:93750752-93750774 CTGACCTGGGAGGGCCTTGTTGG - Intronic
911180422 1:94855350-94855372 CTGATACTGCTGGGCCTTGTAGG + Intronic
912179034 1:107195542-107195564 CAAATTATGTAGGGCCTTGTGGG - Intronic
912210407 1:107550849-107550871 TTCATCATGCAGGGCCTTGTAGG + Intergenic
912373853 1:109194369-109194391 CTGGTCAGGAAGGGCCTTGAGGG - Intronic
912698478 1:111858748-111858770 CAGATCATGGAAGGCCTTGTAGG - Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
915030413 1:152875387-152875409 TCAATAATGCAGGGCCTTGTGGG + Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915647245 1:157281683-157281705 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
916357811 1:163932990-163933012 CACGTCATGAAGGGCCTTGTAGG - Intergenic
916910997 1:169346283-169346305 CAGATCTTGGAGGGCTTTGTGGG - Intronic
917087731 1:171320419-171320441 CAGATCTTGGAAGGCCTTGTGGG + Intronic
917427280 1:174928058-174928080 CAGATCTTGAAGGGCCTTATAGG - Intronic
917948722 1:180005687-180005709 TAGATCATGCAGGGCCATCTAGG - Intronic
918119097 1:181521970-181521992 CACATCATTCAGGGCCTCGTTGG + Intronic
918316179 1:183324500-183324522 CAAACCATGCAGGGCCTTCTGGG - Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918413264 1:184282470-184282492 CAGATCCTGCAGGGCCTTTCAGG + Intergenic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919947426 1:202329851-202329873 CAGATCATGCGGGGTCTTATGGG + Intergenic
920844122 1:209579249-209579271 CAGATCGTGCAAGGCCTTGAAGG - Intergenic
921601960 1:217115426-217115448 CGGATCATATAGGGCCCTGTAGG - Intronic
922249404 1:223834143-223834165 TAGCTCAGGCAGGGCCTTGTAGG + Intronic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922518978 1:226229875-226229897 CAGATCATGCATGGCTTTATAGG + Intergenic
922945593 1:229511140-229511162 GAGACCATGAAGGGCCTTGTAGG + Intergenic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923884608 1:238140651-238140673 CAGATAATGAAGGGCCTTATAGG + Intergenic
924553255 1:245097931-245097953 CCGAGCATGAAGGGCCTTGTGGG + Intronic
924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG + Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
924908629 1:248484234-248484256 CTGAGAGTGCAGGCCCTTGTGGG - Intergenic
924915483 1:248563828-248563850 CTGAGAGTGCAGGCCCTTGTGGG + Intergenic
1063641979 10:7839050-7839072 CCGATCACACAGGGCCCTGTAGG - Intronic
1065626970 10:27639585-27639607 AAGATCATGCAGAGCCTCGTAGG + Intergenic
1067462666 10:46469148-46469170 CTGAGCTTGCAGGGCCTCTTAGG - Intergenic
1067624529 10:47915489-47915511 CTGAGCTTGCAGGGCCTCTTAGG + Intergenic
1069173363 10:65260485-65260507 CAGATCAGGCAGGGCCTTACAGG + Intergenic
1069927440 10:71860558-71860580 CAGCTCATGCAAGGCCTTCTTGG - Intergenic
1070098728 10:73364878-73364900 TTCATCATGCAGTGCATTGTTGG + Intergenic
1071310261 10:84336690-84336712 CTGATCATATATGGCATTGTAGG + Intronic
1071499518 10:86193498-86193520 CCAATCATCCAGGGGCTTGTGGG + Intronic
1071677316 10:87666833-87666855 GTGACCATGCAGGGACTTGGAGG + Intronic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072005674 10:91244462-91244484 CAGATTATGAAGGGCCATGTAGG + Intronic
1072565727 10:96615234-96615256 CAGATCACAAAGGGCCTTGTAGG + Intronic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1074377565 10:112951865-112951887 CTGTCCAAGCAGGGCTTTGTTGG + Intronic
1074726533 10:116315897-116315919 CAGATCCAGCAGGGCCTTGAAGG - Intergenic
1074918554 10:117983181-117983203 CAGATCATGCAGGGCTCTCTAGG - Intergenic
1075258041 10:120940618-120940640 CAGAGCACGCAGGGCCTTGATGG - Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1077906917 11:6541625-6541647 CAGATCATGCAAAGTCTTGTGGG + Intronic
1078157887 11:8814370-8814392 AGAATCATGCTGGGCCTTGTAGG - Intronic
1078627571 11:12971555-12971577 TAAATCATACAGGGCCTTGTAGG - Intergenic
1078729127 11:13959984-13960006 CAGATCAAGCAGAGCCTTGGAGG + Intergenic
1078944227 11:16045674-16045696 ATGAACATGCAGGCCCTTGGAGG - Intronic
1079214712 11:18498222-18498244 AGGATCATGTAGGGCCTTCTGGG + Intronic
1079346106 11:19653890-19653912 CTGATCATCCAGGGGAGTGTGGG - Intronic
1079504323 11:21136328-21136350 CAGGTCATGTAGGGCCATGTGGG + Intronic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1080068706 11:28052333-28052355 CAGATCACATAGGGCCTTGTAGG - Intronic
1080356326 11:31451145-31451167 ATGATTATGCAGGGTCTTGCAGG + Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1080931213 11:36813343-36813365 CATATCGTGTAGGGCCTTGTAGG - Intergenic
1082742583 11:56927046-56927068 CAGATCAGGCCTGGCCTTGTTGG - Intergenic
1082758854 11:57106476-57106498 CAAATCACGTAGGGCCTTGTAGG + Intergenic
1082903610 11:58283208-58283230 CTGAGCTTGCTGGGCTTTGTGGG + Intergenic
1083432500 11:62621639-62621661 AGGATCATGCGGGGCCTTGCAGG + Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085063697 11:73472456-73472478 CAAATCATGCAGGGCCTCATAGG + Intronic
1085179596 11:74522234-74522256 CTGAACATGCAGGGTATGGTAGG + Intronic
1085358017 11:75857266-75857288 CAGATCATGAAAGGCCTTCTAGG - Intronic
1086304966 11:85469977-85469999 CAGATCTTGTAGAGCCTTGTAGG - Intronic
1086576670 11:88346631-88346653 CCAATGATGCAGGGTCTTGTGGG - Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088859105 11:113783304-113783326 CAGACCTTGTAGGGCCTTGTAGG + Intergenic
1090716186 11:129433499-129433521 CCGATTACGCAGGGCCCTGTAGG - Intronic
1090772631 11:129934650-129934672 CAGATCAGGTAGGGCCTTATGGG - Intronic
1090868890 11:130725680-130725702 CTGACCATGGAGGGCCTTGCAGG + Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091508779 12:1100339-1100361 CGGATCATGTAGAGCCTTCTAGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092200369 12:6578470-6578492 CTCATCATTCAGGTCCTTGGGGG + Exonic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1093495538 12:19752817-19752839 AAAATCATACAGGGCCTTGTGGG - Intergenic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1094099328 12:26744200-26744222 CAGCTCATATAGGGCCTTGTGGG - Intronic
1094141763 12:27188852-27188874 CACATCTTGCAGGGACTTGTAGG - Intergenic
1094653106 12:32397032-32397054 CTAATCATGCAGAGCTGTGTGGG + Intergenic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1096592680 12:52671718-52671740 CCAATCAAGAAGGGCCTTGTTGG - Intergenic
1096684068 12:53276389-53276411 CAGATCACACAGGGCCTTATAGG + Intronic
1096971964 12:55673925-55673947 CAGATCACACAGGGCCTTATGGG + Intergenic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1097414380 12:59296217-59296239 CAGGTGGTGCAGGGCCTTGTAGG + Intergenic
1097574744 12:61377438-61377460 AAGATCTTGCAGGGCCTTTTCGG + Intergenic
1097962317 12:65544862-65544884 CAGATCATGAAGGGACTTCTAGG - Intergenic
1098216946 12:68230725-68230747 AAGATCATGCAGAGCCTTTTAGG + Intergenic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1098788733 12:74793157-74793179 CTAGTCATGCAGGGTTTTGTAGG - Intergenic
1099051282 12:77784272-77784294 CTGATCCTGCTGGGCCTAGCTGG + Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1101003801 12:100382167-100382189 CTGATCATCCATAGCCTGGTAGG + Intronic
1101006547 12:100406440-100406462 CAGATCATGGCAGGCCTTGTCGG + Intronic
1101168569 12:102063970-102063992 CTGATCATGCAGAGCTTTATGGG + Intergenic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1101897339 12:108766657-108766679 CAGACCATGCCAGGCCTTGTAGG - Intergenic
1101906639 12:108831645-108831667 CTGATCCTTCAGGGCCTCGCAGG - Intronic
1101995601 12:109523091-109523113 CTCCTCATGCAGGGCCTAGCAGG - Intronic
1102596584 12:113997385-113997407 CAGATCATGCAGGGACATGCAGG + Intergenic
1102599394 12:114017752-114017774 CTGATCCTGCAGGGTGCTGTGGG - Intergenic
1103143380 12:118571900-118571922 CAGATCATTCTGGGCCTTCTAGG - Intergenic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103268088 12:119647902-119647924 CTGATCATGTAGGGCTTTGCGGG - Intergenic
1103717391 12:122953041-122953063 TCAATCATGCAGGTCCTTGTGGG - Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1104072345 12:125356703-125356725 CAGACCACGCAGGGCCTTGTAGG - Intronic
1105737082 13:23282644-23282666 GTGATCATGCATGCCCTTCTAGG - Intronic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1108126939 13:47254853-47254875 CAGATCATGTTGGGCCTTGAAGG + Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108707562 13:53003426-53003448 CTGATGGTGTAGGGCATTGTTGG - Intergenic
1109278321 13:60326431-60326453 CAGATCATTTAGGGCCTTATAGG + Intergenic
1110654119 13:77976501-77976523 TGGATCATTTAGGGCCTTGTAGG - Intergenic
1110819842 13:79901546-79901568 CTGTGAATGCAGGTCCTTGTTGG + Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1116901523 14:50366457-50366479 CAGATCCTACAGGGCCTTGCAGG + Intronic
1117050132 14:51851538-51851560 TTGATCAGGCAGGGTCTTGATGG - Intronic
1117322394 14:54636373-54636395 GGAATCATGCAGGGCCTTGTAGG + Intronic
1117339942 14:54784206-54784228 TGGATCATGCGGGGCCTTATGGG + Intronic
1117344616 14:54820033-54820055 CAGGTCATGAAGGGTCTTGTGGG - Intergenic
1117769480 14:59118636-59118658 CAGATCATTTGGGGCCTTGTAGG - Intergenic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117937138 14:60919245-60919267 CAGATCACTCAGGGTCTTGTGGG + Intronic
1118097750 14:62557707-62557729 CTGATCATTCAGTGCCTCATAGG + Intergenic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1119116544 14:72027107-72027129 CTGATCCTTCAGGGCCTTGTGGG + Intronic
1119215926 14:72869010-72869032 CTGGTCATGAAGGGCCTTGATGG - Intronic
1119457050 14:74764396-74764418 CTGCTCATTCAGGGCCCTCTAGG - Intronic
1119526040 14:75323317-75323339 CTGGTCTTGCAGGGCTGTGTTGG - Intergenic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1120013670 14:79445814-79445836 CAGATCATGGAGGGCCTTTGGGG + Intronic
1120159631 14:81131481-81131503 CAGATCATGTGTGGCCTTGTAGG - Intronic
1120828346 14:88975239-88975261 CTGATCATGCCAGGCCTTTTTGG - Intergenic
1120967932 14:90184155-90184177 CTGATCTTTTACGGCCTTGTTGG + Exonic
1121099334 14:91239312-91239334 GTGATCCAGCAGGACCTTGTGGG + Intronic
1121240614 14:92427407-92427429 CAGACCGTGCAGGGCCTTGAAGG + Intronic
1121691931 14:95884255-95884277 CAGATCGTGCAGGGCCCTGAGGG - Intergenic
1121752101 14:96365506-96365528 CACATCATGTAGGGCCTCGTAGG + Intronic
1122146141 14:99689943-99689965 CAGGTCATGTAGAGCCTTGTGGG - Intronic
1122286466 14:100655379-100655401 CAGAACATGCAGGGCCTCCTTGG - Intergenic
1123429271 15:20201176-20201198 CTGTTCATGGAGGGCCTTCCAGG - Intergenic
1124324427 15:28745415-28745437 CAGACCGTGCAGGGGCTTGTGGG + Intergenic
1124456720 15:29849934-29849956 TTGGTCATGCATGGCCCTGTGGG + Intronic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125530083 15:40407334-40407356 CAGCTCCTGCAGGGCCTAGTAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125896733 15:43308781-43308803 CAGATCATGCAGAGCTTTGGGGG - Intergenic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1127387430 15:58477907-58477929 CAGATCATAGAGGGACTTGTGGG - Intronic
1128147723 15:65341675-65341697 CTGATGATGTAAGGCCCTGTGGG - Intronic
1128280928 15:66393652-66393674 CTGGTCAGGTAGGGCCTTGTAGG - Intronic
1128430342 15:67587315-67587337 CTTATCATGCGGGGCCTCGTAGG + Intronic
1128581049 15:68810175-68810197 CAGACCATGCAGCACCTTGTTGG + Intronic
1128797212 15:70474690-70474712 ATTATCATTCAGGGACTTGTTGG + Intergenic
1129085278 15:73083072-73083094 CAAATAATTCAGGGCCTTGTTGG + Intronic
1129141164 15:73599195-73599217 CTCTTCATGCAGGGGCTTGGGGG - Intronic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1131386317 15:92011063-92011085 CTGGTCATGTAGAGCCTTGAAGG - Intronic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1132290221 15:100694977-100694999 CTGTTGATGTAGGACCTTGTGGG + Intergenic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134567423 16:15263524-15263546 CTGAGCAAGCAGGACCTTGGAGG + Intergenic
1134735069 16:16493176-16493198 CTGAGCAAGCAGGACCTTGGAGG - Intergenic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1134932452 16:18219041-18219063 CTGAGCAAGCAGGACCTTGGAGG + Intergenic
1135846147 16:25920365-25920387 CAGATCATGGAGGGCCCCGTAGG - Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1136855044 16:33648556-33648578 CTGTTCATGGAGGGCCTTCCAGG + Intergenic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138356336 16:56383970-56383992 CAGAACATGCAGGGTCTTATAGG - Intronic
1138797255 16:59983940-59983962 CAGATCATAAAGGGTCTTGTAGG + Intergenic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1141125939 16:81401230-81401252 CTGAACCTGCAGGGCATTTTCGG + Intergenic
1141204126 16:81920165-81920187 CTTATCATGCAGGGGCTCATAGG + Intronic
1141300461 16:82810780-82810802 TGGACCATGCAGAGCCTTGTAGG + Intronic
1203116626 16_KI270728v1_random:1497041-1497063 CTGTTCATGGAGGGCCTTCCAGG + Intergenic
1142501702 17:336713-336735 CAGATCATGGACGGCCTTGAGGG - Intronic
1142957833 17:3533226-3533248 CAGAGTATGCAGGGCTTTGTGGG - Intronic
1143347701 17:6262136-6262158 CAGATCTTGGAGGGTCTTGTGGG - Intergenic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1144761661 17:17710737-17710759 CAAATGAGGCAGGGCCTTGTGGG - Intronic
1145061623 17:19737740-19737762 CTGAGGAGGCTGGGCCTTGTCGG - Intergenic
1145222115 17:21097891-21097913 CAGATCAGGAAGAGCCTTGTGGG + Intergenic
1146241602 17:31233918-31233940 CAGATCAGGTAGAGCCTTGTAGG - Intronic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1147218948 17:38917036-38917058 CCGATTATGCAGGGACTTGTGGG + Intronic
1147278972 17:39342113-39342135 CTGATCATGAGGGGTTTTGTAGG + Intronic
1149029219 17:52065005-52065027 CAGCTCATAGAGGGCCTTGTGGG - Intronic
1149448408 17:56731592-56731614 TGGATCACGAAGGGCCTTGTTGG - Intergenic
1150517376 17:65827670-65827692 CTGGTCATGTAGGGCCTTTGAGG - Intronic
1150577435 17:66442555-66442577 CTGATGATACAGGGCCTTGTAGG - Intronic
1152248768 17:79200591-79200613 CTGTTCAGGGAGGGCCTTGGTGG + Intronic
1152264798 17:79288031-79288053 CAGAGCAGGCAGGGCCTCGTGGG - Intronic
1152418038 17:80175720-80175742 CTGAACAGGCAGGGCCTGGCTGG + Intronic
1152872814 17:82767072-82767094 CTCATCAGGCAGGGCTTGGTGGG + Intronic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1153334154 18:3904927-3904949 CTGAATATGCATGGCTTTGTAGG + Intronic
1154469043 18:14680503-14680525 CTGAGTATGCAGAACCTTGTGGG - Intergenic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1155566605 18:27142332-27142354 CTGTACATTCAGGGCCTTTTAGG + Intronic
1155833220 18:30544220-30544242 CAGACCATGCAAGGTCTTGTAGG - Intergenic
1156294143 18:35774635-35774657 CAGATGATACAGGGCCTTCTAGG - Intergenic
1156410859 18:36827569-36827591 CAGATCTTACAGGGACTTGTGGG + Intronic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1157446213 18:47748571-47748593 CTGGCCATGCAGTGCCATGTGGG - Intergenic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160789669 19:917656-917678 CTGATGCTGCTGGGCCTGGTGGG + Exonic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1161274924 19:3410570-3410592 CGGGCCATGCAGGGCCTTGTGGG + Intronic
1161277459 19:3426640-3426662 CAGGTTGTGCAGGGCCTTGTGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161300028 19:3538044-3538066 CAGGGCGTGCAGGGCCTTGTGGG + Intronic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161361996 19:3855682-3855704 CTGGTCATGGCGGGCCTGGTGGG + Intronic
1161451769 19:4350299-4350321 CAGGTCATGCAGGGCTCTGTAGG + Intronic
1161493713 19:4576277-4576299 CCAGTCATGCAGGGCCTCGTGGG - Intergenic
1161605645 19:5213344-5213366 CTGGTCATGCAGGATCCTGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1161741104 19:6021713-6021735 CGGGTCCTGCAGGGCCTTGTGGG + Intronic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162429932 19:10622276-10622298 CAGGTCATGCAAGGCTTTGTGGG + Intronic
1162456542 19:10788421-10788443 CAGGTTGTGCAGGGCCTTGTGGG + Intronic
1162512312 19:11126859-11126881 CTGAGCATGCTGGGCATTGTGGG + Intronic
1162536433 19:11265230-11265252 TTGATCATGCTGGGCCTTGTGGG - Intergenic
1162544698 19:11321693-11321715 CAGATCATGCAGGGCCCCGGGGG + Intronic
1162762115 19:12894929-12894951 CTGGTCACACAGGGCCTTGTGGG - Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1162837869 19:13333163-13333185 CAGATCAAGCAGGGGCTTATAGG - Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1163017802 19:14467481-14467503 CAGATCTTGCAGGGCCTCGGAGG + Intronic
1164504995 19:28852550-28852572 CTGATCATGCAGTGACTTCCAGG + Intergenic
1164519646 19:28968838-28968860 CTGGTCATGCAAGGCATTGATGG + Intergenic
1165083999 19:33329985-33330007 TGGATCATGCTGGGCCTTGTAGG - Intergenic
1165217917 19:34289929-34289951 ATGATCATGAAGGGCCTTTTTGG + Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165649172 19:37470557-37470579 CAGATTATGCAGGGCCCTGCAGG - Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1166385329 19:42377378-42377400 TGGATCACCCAGGGCCTTGTGGG + Exonic
1167243427 19:48359220-48359242 CAGATCGTACTGGGCCTTGTGGG - Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167490637 19:49790999-49791021 CAGACCCTGCAGGGCCTTGTTGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1167611195 19:50508438-50508460 CAGACCACGCAGGGCCTTGTGGG - Intronic
1168148852 19:54434361-54434383 CTGACCACCCAGGCCCTTGTAGG - Intronic
1202714659 1_KI270714v1_random:35652-35674 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
925875666 2:8309309-8309331 CTGAGCATGCCGGATCTTGTTGG - Intergenic
925937121 2:8774755-8774777 CAGATCATAAAGGGCTTTGTAGG + Intronic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
926472489 2:13278527-13278549 CTGATTATGCAAGGGCTTATGGG + Intergenic
927238303 2:20898392-20898414 CATATCCTGCAGGGCCTTGCAGG - Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928067605 2:28182114-28182136 CTGATCATGTAGGGCCTTACAGG + Intronic
928405387 2:31010710-31010732 CTGATCAGGCAGGGCCTTGGGGG - Intronic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
929742817 2:44621684-44621706 CAGATCATATATGGCCTTGTAGG + Intronic
930277971 2:49335852-49335874 CAGATCATGCATGGCCATGCAGG + Intergenic
930656541 2:54012881-54012903 CAGAGCACTCAGGGCCTTGTAGG - Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
931973690 2:67619089-67619111 CAGATCATGGAGGGGTTTGTGGG + Intergenic
932480060 2:72033677-72033699 CACAGCATGCAGGGCCCTGTCGG - Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
934049587 2:88199058-88199080 CTTATCAGGCAGACCCTTGTAGG + Intergenic
934556352 2:95288985-95289007 CTGAAGCTGTAGGGCCTTGTGGG + Exonic
935473926 2:103494625-103494647 CTGAACATGCAAGGCCTTTTTGG - Intergenic
936599647 2:113883300-113883322 CAGAACATGGAGGGCTTTGTAGG + Intergenic
937208111 2:120249811-120249833 CAGATGATGCAGGGGCTTCTCGG - Intronic
938473238 2:131585575-131585597 CTGATGATGCTGGGTCTGGTAGG + Intergenic
938733306 2:134163253-134163275 CTGATTCTGGAGGGCCTTGGGGG + Intronic
939201549 2:139042216-139042238 CTGACCAAGCAGTGCCTTGGTGG + Intergenic
940224612 2:151388755-151388777 CAGATCATGATGGGCCTTCTAGG - Intergenic
940368571 2:152876178-152876200 AGGATCATGAAGGGTCTTGTTGG - Intergenic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
941721972 2:168821869-168821891 CAGATCATGCAGAGCTTTGCAGG + Intronic
941801916 2:169669325-169669347 CAGATCATACAGAGCCTTGGAGG + Intronic
942111349 2:172685391-172685413 CAGAACATGCAGAGCCTTGAAGG - Intergenic
942524469 2:176838666-176838688 TGGGTCATGCAGGGCCTTATAGG + Intergenic
942616032 2:177793147-177793169 CTAGTCATGCAGGGCCTTTCAGG + Intronic
942740589 2:179173002-179173024 CTGAGCTTGAAGGGCCTTGTAGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946851372 2:223909981-223910003 CGGGTCATGCAAGGTCTTGTAGG - Intronic
947639211 2:231696903-231696925 CTGAGCATGGACGGCCGTGTTGG - Intergenic
947716125 2:232339687-232339709 CTGAGCATGCAGGGCCGGGGTGG + Intronic
947897440 2:233688848-233688870 CTGATCATAGGGGGCCTTGCAGG + Intronic
948268784 2:236657887-236657909 CTAATCATGCAAGGTCTTTTAGG + Intergenic
948686132 2:239670801-239670823 TGGATTTTGCAGGGCCTTGTTGG + Intergenic
949030468 2:241794514-241794536 CTGATCAGGCAGGGCCATCAGGG - Intronic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1169815290 20:9650176-9650198 CAGATCATCCAGTCCCTTGTAGG - Intronic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1170478919 20:16745664-16745686 CTGATCCTACAGGAGCTTGTAGG + Intergenic
1170733237 20:18991789-18991811 CAGAATATGCAGGGCCTTCTAGG - Intergenic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1172399550 20:34638076-34638098 CAGACCAGGCAGGGCCATGTGGG - Intronic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1172836866 20:37878717-37878739 CGGATCTTACAGGGCCTTGAGGG + Intergenic
1173114006 20:40223085-40223107 CTGATCACACAGGGTCTGGTGGG + Intergenic
1173387617 20:42603531-42603553 TAGATCTTGCTGGGCCTTGTGGG + Intronic
1173427432 20:42955326-42955348 CTTTTAATGCAGGACCTTGTGGG - Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173688529 20:44940965-44940987 CAGATCATGCAGGGTCTCCTAGG - Intronic
1173759052 20:45543761-45543783 CAGACAATGAAGGGCCTTGTGGG - Intronic
1173833034 20:46104955-46104977 CAGATCTCGCAGGGCCTTGAAGG - Intergenic
1173846487 20:46191876-46191898 ATGATCATGGGGGGCCTTGTGGG - Intronic
1173946359 20:46953933-46953955 CAGCTCACACAGGGCCTTGTAGG - Intronic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174199675 20:48798484-48798506 CAGAGCATGCAGGGCCTTCCAGG - Intronic
1174263112 20:49311743-49311765 CGGGTCATGTAGGCCCTTGTAGG + Intergenic
1174406497 20:50306429-50306451 CGGATCCTGCAGGGCCACGTGGG + Intergenic
1174413823 20:50353734-50353756 CAGACCAGGCAGGGCCTTGCGGG + Intergenic
1174843341 20:53920231-53920253 CTGATCACACAGGGTCTTGCGGG + Intergenic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1176805476 21:13477157-13477179 CTGAGTATGCAGAACCTTGTGGG + Intergenic
1179158827 21:38875209-38875231 CTGTACTTTCAGGGCCTTGTGGG - Intergenic
1179794357 21:43774217-43774239 CTCATCATGCTTGGCTTTGTTGG + Exonic
1180255498 21:46624587-46624609 CTGAACACGCAGGGCCTGGCAGG - Intergenic
1181308453 22:21930458-21930480 TTCATCATGCAGTCCCTTGTGGG - Intronic
1181830265 22:25555008-25555030 CAGACCCTGCAGGGCCTTGGAGG - Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182311329 22:29410121-29410143 TAGATCATGCTGGGCCCTGTTGG - Intronic
1182642481 22:31779522-31779544 CAGTTCATGCAGGGCCTTCAAGG + Intronic
1182689644 22:32149814-32149836 CGGATCATGCTGGGCCCTGTTGG + Intronic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1184419325 22:44370391-44370413 CAGAGCCTGCAGGGCCTTGTGGG + Intergenic
1184527295 22:45032472-45032494 CTGTACCTGCTGGGCCTTGTTGG - Intergenic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
1185351286 22:50340811-50340833 CAGGTCATGTAGGGCCCTGTGGG + Intergenic
949949008 3:9213715-9213737 ATGGTCATGGAGGGCCTTGTGGG - Intronic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
950109263 3:10408104-10408126 CTGCTCAGGGAGGGCCCTGTTGG + Intronic
950201657 3:11048682-11048704 CAGATCAGACAGGGCCTTGCAGG - Intergenic
950758677 3:15201192-15201214 GAGACCATGTAGGGCCTTGTAGG - Intergenic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952077862 3:29720042-29720064 CAGATCACATAGGGCCTTGTGGG - Intronic
952134931 3:30407833-30407855 GAGATCATGCAGGGTTTTGTGGG - Intergenic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
952498343 3:33935765-33935787 CAGAGCATCCAGGGTCTTGTGGG + Intergenic
953070064 3:39511321-39511343 CAGATAATTCAGGGCCATGTAGG - Intronic
953139348 3:40213076-40213098 CTGACCCTGCAGGCCCTTCTTGG + Intronic
953670314 3:44956887-44956909 CAGATTGTGCAGGGCCTGGTAGG - Intronic
954463271 3:50639747-50639769 CTGATCATGCTGAGTCCTGTAGG + Intronic
955074928 3:55604614-55604636 CAGAGCATGCCAGGCCTTGTAGG + Intronic
955275044 3:57539306-57539328 CAGATAGTGTAGGGCCTTGTCGG - Intronic
955529527 3:59858624-59858646 CTGAACATGCAGGGCAACGTGGG + Intronic
955552711 3:60101251-60101273 CACATTATGCAGGGCCTTGCAGG - Intronic
955676322 3:61452753-61452775 CAGATCATTCAGGGTCCTGTAGG - Intergenic
955763053 3:62309992-62310014 CTGATCAAGCAGGGCCTTAGAGG + Intergenic
956529319 3:70200333-70200355 CCAATCATGCAAGGGCTTGTAGG - Intergenic
956713106 3:72055746-72055768 CTGACCATGCAGACCCATGTGGG + Intergenic
957127514 3:76180842-76180864 CAGAAAATTCAGGGCCTTGTAGG - Intronic
957225192 3:77434117-77434139 GAGATAATGCAGGGTCTTGTAGG - Intronic
957549795 3:81689608-81689630 ATGATAACGCAGGGCCTTGCGGG - Intronic
957809446 3:85200508-85200530 GTGATCATGAAGGGCTTTCTAGG + Intronic
957883811 3:86256591-86256613 TAGATCATGTAGGGCCCTGTAGG + Intergenic
958730915 3:97959187-97959209 CTGATGCTCCTGGGCCTTGTGGG - Intronic
958915388 3:100044612-100044634 CAGATTATACAGGGCCTTATAGG + Intronic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960121158 3:113949368-113949390 CTGACCACAGAGGGCCTTGTGGG + Intronic
960406160 3:117262409-117262431 CAGGTCATGGTGGGCCTTGTAGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
961317357 3:126049679-126049701 CAGATCATGTGGAGCCTTGTGGG - Intronic
961697012 3:128712412-128712434 CAGATAGTGCAGGGCCTTGAAGG + Intergenic
961951076 3:130749779-130749801 CAGATCATGCAAGGTTTTGTGGG - Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962230325 3:133659980-133660002 GAGGTCATGTAGGGCCTTGTGGG - Intronic
962731958 3:138291897-138291919 CAGACCATGAAGAGCCTTGTAGG + Intronic
963219171 3:142788060-142788082 CAGACCATGCATGGCCTTGTAGG + Intronic
963283778 3:143412999-143413021 CTGAACATCCAGGGATTTGTGGG + Intronic
964155610 3:153581599-153581621 CAGATCATCCAGTGCCTTATAGG - Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966351312 3:179035135-179035157 CAGATCGTGTAGGGCCTTATAGG - Intronic
966351319 3:179035182-179035204 CAGAACATGTAGGGCCTTATAGG - Intronic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
968292858 3:197552461-197552483 CAGAACATGGAGGGCCTTGTAGG - Intronic
969231674 4:5836235-5836257 CTGATGAGGCTGGGCCTTCTGGG - Intronic
969312902 4:6364381-6364403 CAGCTCCTGCAGGGCCTTGGAGG + Intronic
969642083 4:8405011-8405033 CTGCTCAGGCAGGGCCTGGCAGG + Intronic
970015647 4:11509758-11509780 CACTTCATGAAGGGCCTTGTAGG + Intergenic
970275180 4:14391972-14391994 CAGAGCATGCTGGGCCTTGAAGG - Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
970642701 4:18084950-18084972 TTGATCGTGCAGAGCTTTGTAGG + Intergenic
970926652 4:21460074-21460096 CAGATTTTGCAAGGCCTTGTAGG - Intronic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971270661 4:25141763-25141785 CTGATCACGTGGGGCCTTCTAGG - Intronic
971273123 4:25170316-25170338 CAGACCTTGCAGGGCCTTATAGG - Intronic
972028448 4:34418574-34418596 CAGATCATGTAGGGCTGTGTAGG - Intergenic
972154809 4:36146413-36146435 CTGATCATGTAGGGCCTTATCGG - Intronic
973104819 4:46322381-46322403 GAGATCGTGCAGGGCCTTGGAGG - Intronic
974003843 4:56536202-56536224 CAGATCAAGTGGGGCCTTGTAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974118816 4:57613115-57613137 CATATTATGCAGGGCTTTGTAGG + Intergenic
974125075 4:57686102-57686124 CAGATAGTGCAGGGCCTTGAAGG - Intergenic
974422807 4:61699485-61699507 CAGATCTTGTGGGGCCTTGTGGG + Intronic
975712081 4:77170930-77170952 CTGATCTTGCTGGGCCGGGTGGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976536899 4:86227961-86227983 CACACCATGCAGGGCCATGTGGG + Intronic
976604617 4:86970943-86970965 CAGATTGTGGAGGGCCTTGTCGG + Intronic
976683854 4:87788490-87788512 CAGATCATGAAGGGCTTTCTAGG + Intergenic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
979412645 4:120397380-120397402 CAGATCATGCAGTGGCTTCTGGG + Intergenic
979864446 4:125736333-125736355 CAGATCATGGAGGTCATTGTAGG + Intergenic
979960134 4:127009064-127009086 CAGGTCATGCATGGCCGTGTTGG + Intergenic
981065947 4:140486028-140486050 CTGATCACACAGGGCTTTGTGGG - Intronic
981198551 4:141949803-141949825 CTCAGCATGTAGGGCCTGGTGGG + Intergenic
981700790 4:147605158-147605180 CTGATTATGAAGGGGCTTGCAGG - Intergenic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
981725706 4:147844972-147844994 CAGAGCGTGCCGGGCCTTGTGGG - Intronic
982161155 4:152570807-152570829 CAGATCAAGCATGGCCTTATAGG + Intergenic
982306848 4:153941539-153941561 CTGGTCATACAGGACTTTGTAGG - Intergenic
985950296 5:3217756-3217778 CTGGTCCTGCAGCTCCTTGTTGG - Intergenic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
988490365 5:31700558-31700580 CTTAGCAGGCAGGGCCTTGCAGG - Intronic
988815995 5:34835745-34835767 CAGGTCATGGAGGGCCTTATAGG - Intergenic
989410898 5:41119390-41119412 TTGATCATGTAGAGCCTTCTAGG - Intergenic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
990911267 5:60854780-60854802 CAGGTCAAGAAGGGCCTTGTAGG - Intergenic
991515149 5:67427034-67427056 CAGATCTTGTAGGGCCTTGAAGG - Intergenic
991915045 5:71597297-71597319 CAGATCCTGTATGGCCTTGTGGG + Intronic
992195469 5:74334972-74334994 CTTACCATGCAGGGCCACGTGGG + Intergenic
992969413 5:82040831-82040853 CAGATCATCTAGGGACTTGTTGG - Intronic
993112429 5:83674758-83674780 CTGTTCCTGGAGGTCCTTGTAGG + Intronic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994139524 5:96326296-96326318 CTTGTCATGGAGGACCTTGTAGG - Intergenic
994407803 5:99367360-99367382 CAAATCATGGAGGGCCTTATAGG - Intergenic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
995305237 5:110639156-110639178 CAGCACATGCAGAGCCTTGTAGG + Intronic
995313163 5:110736783-110736805 CAGATCTTGCAAAGCCTTGTCGG - Intronic
995449749 5:112287627-112287649 CAGATCATGGAAGGCCTTATAGG - Intronic
995502642 5:112824578-112824600 TTGATCATGTAGTGCCTTCTTGG + Intronic
995618695 5:113998313-113998335 TTGCTCATACAGGGCCTTGTGGG - Intergenic
995624190 5:114058718-114058740 CAGATCCTGCAGGGCTTTGCAGG + Intergenic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996769855 5:127074204-127074226 CTGGCCATGCAGGGCCTTTCAGG + Intergenic
997337289 5:133117305-133117327 ATGCTCAGGCAGGGCCGTGTTGG + Intergenic
997624001 5:135319406-135319428 CTGATCATGTTGGGTCTTGTGGG + Intronic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997898992 5:137746369-137746391 CAGATCATGTAGGGATTTGTAGG - Intergenic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998155507 5:139784573-139784595 CAGATGATGGAGGGCGTTGTAGG - Intergenic
998189607 5:140011984-140012006 ATCATCATGTAGGGCCTTGGGGG - Intronic
998189916 5:140014873-140014895 CAGATCAAATAGGGCCTTGTGGG - Intronic
998302514 5:141038142-141038164 TTGTTTATGCAGGGCCTTGTAGG + Intergenic
998754534 5:145361706-145361728 CAGATCATGAGGAGCCTTGTGGG - Intergenic
998855390 5:146390079-146390101 CAGTCCACGCAGGGCCTTGTGGG - Intergenic
998885694 5:146691681-146691703 CAGGTCATGAAGGGCCTTTTAGG - Intronic
998971375 5:147596152-147596174 TAGACCATGCAGGGCTTTGTTGG + Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999549653 5:152672510-152672532 CACATCATGTAAGGCCTTGTAGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999625686 5:153517904-153517926 AGGTTCATGGAGGGCCTTGTAGG - Intronic
1000348271 5:160332488-160332510 CAGATCACACAGGGCCCTGTAGG - Intronic
1000435369 5:161201257-161201279 CTGATTATGCAAAGCCTTCTAGG + Intergenic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001238671 5:170051266-170051288 CAGATCATGGATGGCCTTGCAGG - Intronic
1001275099 5:170345001-170345023 CTGGTCACCCAGGGCTTTGTGGG + Intergenic
1001313267 5:170626057-170626079 CAGACCCTGCAGGGCCTTGCAGG + Intronic
1001517127 5:172363771-172363793 CAGATCAGGCAGGGCCTTTGGGG + Intronic
1001948719 5:175801066-175801088 GAGATCATGCAGGCCCTTCTAGG + Intronic
1002123158 5:177021616-177021638 CAGATTGTACAGGGCCTTGTTGG + Intronic
1002200865 5:177527319-177527341 CTGATCGTGAAGGGCCCTGCAGG + Intronic
1002777195 6:338798-338820 CTGTTCGTGCAGGGATTTGTGGG - Intronic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1004199514 6:13534709-13534731 CTGGGCATGCACAGCCTTGTTGG - Intergenic
1005897757 6:30192344-30192366 CTGATCCTGCAGGGCCTGCCCGG + Intronic
1006887044 6:37390512-37390534 CAGATTTTGTAGGGCCTTGTAGG + Intronic
1007013374 6:38439071-38439093 CTGATAATGTGGGGTCTTGTAGG + Intronic
1007219930 6:40270389-40270411 GAGATCAGGCAGGGCCTTGCAGG - Intergenic
1007528078 6:42514341-42514363 CAAATCATGCAGGGGCTTGCAGG + Intergenic
1007683178 6:43648547-43648569 ACAATCATGCAGGGCCTTGTGGG + Intronic
1007816490 6:44528869-44528891 CTGACCATGCTGGGTGTTGTGGG - Intergenic
1007974049 6:46082478-46082500 TGGATTATGCAGGGCCATGTGGG - Intergenic
1009338624 6:62526034-62526056 GTGATAATGTAGGTCCTTGTTGG - Intergenic
1009696035 6:67104351-67104373 CTGTTCCTGAAGGACCTTGTAGG - Intergenic
1010253407 6:73731557-73731579 GGGCTCATGCAGGGCCTTATTGG + Intronic
1010800000 6:80164176-80164198 ATGATCAAGCAGGGCCCTGGAGG - Intronic
1011078552 6:83464127-83464149 CTGGTAATACAGGGCCTTATAGG + Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1012967977 6:105696000-105696022 CTGATCTTGCAGTGCTTTATAGG + Intergenic
1013184885 6:107748989-107749011 TGGAGCCTGCAGGGCCTTGTCGG + Intronic
1013852101 6:114528451-114528473 CAGGTCATGCAGAGCTTTGTGGG - Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015180432 6:130356168-130356190 CTGGTCATCCAGGGCTTTGTAGG - Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015303450 6:131679974-131679996 CCAATCCTGCAGGGCCTTGCAGG + Intronic
1015809094 6:137143292-137143314 CAGATCATACAGCGCCTTGGAGG + Intergenic
1015911097 6:138168440-138168462 CAGATCATGAAAGTCCTTGTTGG + Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016548846 6:145254802-145254824 CTGATCACATGGGGCCTTGTAGG + Intergenic
1017365169 6:153627497-153627519 CAGATTATGAAGGGTCTTGTAGG + Intergenic
1017397118 6:154014267-154014289 CACATCTTGTAGGGCCTTGTAGG + Intronic
1017412808 6:154186965-154186987 CCCATCATGTAGGGCCATGTAGG - Intronic
1017615620 6:156243782-156243804 CTGATGATATAGGGCCTTCTTGG + Intergenic
1018684038 6:166289518-166289540 TAGATCATGCAGAGTCTTGTAGG - Intergenic
1019133485 6:169894067-169894089 CTGACCCTGCAGGGCAGTGTGGG + Intergenic
1019356519 7:582751-582773 CTGACTATGCAGTGCCTGGTGGG + Intronic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1020344450 7:7148038-7148060 AGAATCATGTAGGGCCTTGTAGG - Intergenic
1020397158 7:7729273-7729295 CTGGTCATGCTAGACCTTGTAGG + Intronic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1021248518 7:18294623-18294645 CAGATCGTGCTGGGCCTAGTAGG + Intronic
1021442304 7:20689978-20690000 CGGTTCATGCAGGGCCTCTTAGG + Intronic
1021545165 7:21804898-21804920 ATTATCATGTAGGGCCTTGCAGG - Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1021937575 7:25646410-25646432 CACCTCATGCAGGGCCTTTTGGG - Intergenic
1022146478 7:27547071-27547093 CACATCATGTAGGGCTTTGTAGG - Intronic
1022312573 7:29210948-29210970 CGGATCATGGAGGGCCTCGTAGG + Intronic
1022477005 7:30717577-30717599 AAGGTCATGCAGGGCCCTGTGGG + Intronic
1022491826 7:30826589-30826611 CAGATCATGGAGAGCCTTGCAGG + Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1024197951 7:47078439-47078461 CAGATCACGAAGGGCCCTGTTGG + Intergenic
1025256714 7:57388837-57388859 CAGACCAGGCAGGGCCTTGCAGG - Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1027345340 7:77253965-77253987 CTGATGAGGCAGGGCCATGTAGG + Intronic
1027645335 7:80790488-80790510 CAGATCATGCAGAGGCCTGTAGG - Intronic
1027681605 7:81229646-81229668 CAGATCATGTAGAGCTTTGTAGG + Intergenic
1028182047 7:87735673-87735695 CTGATCACACAGGGCTTTGCAGG - Intronic
1028433811 7:90778595-90778617 CAGATCACGAAGGGCCTTCTGGG - Intronic
1028981752 7:96974964-96974986 CAGATCCTGAAGGGCCTTGTAGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030729664 7:112971644-112971666 TAGACCATGCAGAGCCTTGTAGG + Intergenic
1030871211 7:114758430-114758452 CAAATTTTGCAGGGCCTTGTGGG - Intergenic
1031026599 7:116686193-116686215 CAGAGCATGTAAGGCCTTGTAGG - Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1032322182 7:130895565-130895587 CTTATCACGAAGGGCTTTGTAGG + Intergenic
1032419194 7:131764382-131764404 ATGATCAAGGAGGGCCTTGGTGG + Intergenic
1032450157 7:132023787-132023809 CTGATCAGGCAGAGGCTAGTAGG + Intergenic
1033733603 7:144201182-144201204 CAAATCATGAAAGGCCTTGTAGG + Intergenic
1033749447 7:144349790-144349812 CAAATCATGAAAGGCCTTGTAGG - Intergenic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036595111 8:10205045-10205067 CTGACCATGCAGGTGCTTGCAGG + Intronic
1036987682 8:13554893-13554915 CCAATCATGTAGGGCCTTGCAGG - Intergenic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1037561203 8:20076080-20076102 CAGATACTGCAGGGTCTTGTAGG - Intergenic
1037754840 8:21704024-21704046 CTTGTCATGCAGGGCCTTGCAGG - Intronic
1037846985 8:22292176-22292198 CTGATTACACAGGGCTTTGTAGG + Intronic
1038151738 8:24947630-24947652 CTGGTTATGCATGGGCTTGTAGG - Intergenic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1038969724 8:32619409-32619431 CTGAGCATGTAGTGCCTTGTAGG + Intronic
1039605500 8:38877095-38877117 GAGAGCATTCAGGGCCTTGTAGG + Intergenic
1039921886 8:41898719-41898741 CTGATCATTCAGGTCCTCATAGG - Intergenic
1041031614 8:53742093-53742115 CTGATCGTGTAGGGCCTTGTAGG - Intronic
1041508956 8:58633177-58633199 CGTGTCATGCGGGGCCTTGTGGG - Intronic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042481482 8:69308470-69308492 CTGACCATGCAGGCCTGTGTGGG - Intergenic
1042893760 8:73642945-73642967 CTGAAAAAGCAGGGCTTTGTAGG + Intronic
1042939810 8:74096282-74096304 CAGATCATGCAGAGCCTCATTGG - Intergenic
1043417453 8:80065711-80065733 CTGTTCATGCAGAGCCATTTTGG - Intronic
1043479682 8:80640308-80640330 CTGAACAGGTAGGGCCATGTGGG + Exonic
1043608831 8:82036202-82036224 CTGACTATGCAGGGGCTTTTGGG + Intergenic
1043764858 8:84118546-84118568 CTGATCATGCAGAGCTGTGCTGG + Intergenic
1043877610 8:85503785-85503807 CAGATCATGTAAGGCCTTGGGGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045227389 8:100262568-100262590 CAGATCATGTGGGGCCTTTTGGG + Intronic
1045624730 8:104030495-104030517 CAGGTCATGTAGGGCCTTATAGG - Intronic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045697686 8:104828856-104828878 CAGATTGTGTAGGGCCTTGTAGG - Intronic
1045928404 8:107597307-107597329 CTGATCTTGCTGGGAGTTGTAGG + Intergenic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1046930856 8:119840545-119840567 GTGATCCTGAAGGGCCTTATAGG + Intronic
1047191688 8:122684002-122684024 TTGAACAAGCAGGGACTTGTAGG - Intergenic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047484192 8:125313944-125313966 TTGCTCATGCAGGGCTTTCTAGG - Intronic
1047578315 8:126183092-126183114 CTGATCCTGTAAGGCCTTGGAGG + Intergenic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048704083 8:137130827-137130849 CAGGTCATGAAGGGCATTGTAGG + Intergenic
1049469435 8:142768878-142768900 CTGCTCATTCAGGGCCTGGGAGG + Intronic
1049564289 8:143330262-143330284 CTGCTTATGCAGGGCCATGGTGG - Intronic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1051678344 9:19581162-19581184 TTAAGCATACAGGGCCTTGTTGG + Intronic
1052972247 9:34384017-34384039 TGGATCATGGAGGGCCTTGTAGG - Intronic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1056148073 9:83754715-83754737 CTGATCCTGGAGGGCCTTGAAGG + Intronic
1056736641 9:89215429-89215451 CTGTTTATGCAGGACCTTGTGGG - Intergenic
1057147592 9:92768602-92768624 TTGAGCGTGCAGGGCCTTGGAGG - Intergenic
1057182859 9:93039207-93039229 CTCTTCCTGCAGGGCTTTGTGGG + Intergenic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1058007659 9:99935958-99935980 CAGATCATGGAGAGCCTTGCAGG + Intronic
1058026966 9:100151566-100151588 CTGATCCTGTAGGGCCTTATAGG + Intronic
1058259803 9:102814583-102814605 CTTAGCATGCAGGGCTCTGTGGG - Intergenic
1058532821 9:105924057-105924079 CAGATCCTGCAAGGCCTTGTGGG - Intergenic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059385689 9:113962507-113962529 CAGCTCATGCAGAGCCTTGCAGG - Intronic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1061616970 9:131786774-131786796 CTGTTCATGAATGGCCTTGTGGG - Intergenic
1062386487 9:136313761-136313783 GTGATCACGCAGGCTCTTGTTGG - Intergenic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1186977971 X:14928593-14928615 CTCATCATTCAGGACTTTGTAGG - Intergenic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187366025 X:18666506-18666528 CAGTTCCTGCAGGGCCTCGTGGG + Intronic
1187544120 X:20230622-20230644 CTTATTATGCAGGGCCTGGTAGG + Intronic
1188179356 X:27034816-27034838 TTGATCACGCAGGGCTTTGAAGG + Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188330446 X:28864750-28864772 GTGATCATTTAGGGCCTCGTGGG + Intronic
1188458027 X:30389444-30389466 AAGATCATGCAAGGCCTTGCAGG + Intergenic
1188799176 X:34505914-34505936 CAGACCATGCATGGCCTTATAGG - Intergenic
1189105991 X:38235819-38235841 CAGATCAAACAGGGCCTTTTTGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1189901003 X:45706248-45706270 TGGATCATGTAGAGCCTTGTTGG - Intergenic
1190019938 X:46864893-46864915 GAGATAATGAAGGGCCTTGTAGG + Intronic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1190311757 X:49122017-49122039 TAGACCAGGCAGGGCCTTGTAGG - Intronic
1190461528 X:50681331-50681353 ATAATCACACAGGGCCTTGTAGG - Intronic
1190522466 X:51294303-51294325 CAGATGTTGTAGGGCCTTGTAGG + Intergenic
1191024947 X:55904208-55904230 TAGATCATACAAGGCCTTGTAGG + Intergenic
1192143245 X:68662469-68662491 CAGATCACGAAGGGCCTTATAGG - Intronic
1192197330 X:69037172-69037194 CTGCTCCTGCAGGGGCTGGTGGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1192596001 X:72408850-72408872 CAGATCATGTAGGGTGTTGTAGG + Intronic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1194790684 X:98145735-98145757 CAGATCCTGCATGGACTTGTAGG - Intergenic
1195077764 X:101343788-101343810 CTGATTATGTGGGGCCTTGTAGG - Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195677004 X:107514234-107514256 GAGATCACGCAGGGCCTTATGGG + Intergenic
1195691047 X:107625970-107625992 CTGATCATGCAGAACCTTATAGG - Intergenic
1195700832 X:107704426-107704448 CAGATCACGCAGGCACTTGTAGG + Intergenic
1195879571 X:109578320-109578342 CACATTACGCAGGGCCTTGTAGG - Intergenic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196004040 X:110816648-110816670 CAGATCATGCTAGGCCTTGCAGG + Intergenic
1196487527 X:116230433-116230455 CTGAGAATGTAGGGCTTTGTAGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1197173684 X:123462333-123462355 CAGATCTTGTAGGGCCCTGTAGG - Intronic
1197415909 X:126172532-126172554 CATATCATGCTGGGCCTGGTAGG - Intergenic
1197631803 X:128869460-128869482 CCAATCATGTTGGGCCTTGTAGG + Intergenic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198163009 X:134026129-134026151 CAGATCTTATAGGGCCTTGTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198411346 X:136372561-136372583 CAGACCCTGCAGGGCCTCGTAGG - Intronic
1198426962 X:136530027-136530049 CGGGTCAGGGAGGGCCTTGTAGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198778558 X:140208263-140208285 CAGATCAGGTAGGGGCTTGTGGG + Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1198802002 X:140457672-140457694 CAGGTCATGCAGGGCCCTGCAGG - Intergenic
1198832835 X:140769276-140769298 CAGATCATGGAGGGCCTCATAGG + Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic
1199339047 X:146654450-146654472 CAGATTATGTTGGGCCTTGTAGG + Intergenic
1200118902 X:153781280-153781302 CAGATGCTGCAGGGCCTTCTGGG + Exonic
1200250118 X:154548272-154548294 CCGATGGTACAGGGCCTTGTAGG + Intronic
1200757379 Y:7002540-7002562 CAGACCCTGCAGTGCCTTGTAGG + Intronic
1201503152 Y:14667949-14667971 CAGATCATTCAGGTCCCTGTTGG + Intronic