ID: 1139613033

View in Genome Browser
Species Human (GRCh38)
Location 16:68072582-68072604
Sequence GTCAAGGACTTGCCACCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139613027_1139613033 9 Left 1139613027 16:68072550-68072572 CCAGCCAGGTGCCTTCTTCCCAG 0: 1
1: 0
2: 3
3: 31
4: 358
Right 1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1139613029_1139613033 -2 Left 1139613029 16:68072561-68072583 CCTTCTTCCCAGACAAGCTGAGT 0: 1
1: 0
2: 3
3: 28
4: 262
Right 1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1139613032_1139613033 -10 Left 1139613032 16:68072569-68072591 CCAGACAAGCTGAGTCAAGGACT 0: 1
1: 0
2: 0
3: 11
4: 89
Right 1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1139613031_1139613033 -9 Left 1139613031 16:68072568-68072590 CCCAGACAAGCTGAGTCAAGGAC 0: 1
1: 0
2: 1
3: 9
4: 198
Right 1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1139613028_1139613033 5 Left 1139613028 16:68072554-68072576 CCAGGTGCCTTCTTCCCAGACAA 0: 1
1: 0
2: 2
3: 17
4: 214
Right 1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139613033 Original CRISPR GTCAAGGACTTGCCACCAGC CGG Intronic
901029925 1:6301104-6301126 GTCCAGTGCTGGCCACCAGCTGG + Intronic
901129070 1:6950876-6950898 GTCATGGGCTGGCCACCAGCAGG + Intronic
901230914 1:7641339-7641361 GGCAAGGACCTGCCATCAGCAGG + Intronic
904915357 1:33966308-33966330 TTCAAGGATTTGCAACCATCAGG - Intronic
905891049 1:41518597-41518619 GTCAAGGCCCTGCCAGCTGCAGG + Intronic
906680589 1:47723308-47723330 GGCAAGGTCATGCCACCCGCAGG - Intergenic
914786019 1:150831817-150831839 ATCAAGGCCTGGCCCCCAGCAGG - Exonic
920099532 1:203508327-203508349 GTCCAGGGCCTGCCCCCAGCAGG + Intronic
924633487 1:245763639-245763661 GTCAAGGGCTTGCCACGCGAGGG + Intronic
1067174526 10:43934200-43934222 CTCAAGGAGTGGCCAACAGCTGG + Intergenic
1067793652 10:49305654-49305676 CCCATGGACCTGCCACCAGCGGG + Intronic
1068252561 10:54462740-54462762 GTCAGGAACTTGAGACCAGCCGG - Intronic
1068645656 10:59463966-59463988 GTCGCGGACTTTCCACCACCTGG - Intergenic
1069865790 10:71501979-71502001 GCCAAGGAGTTGCAAACAGCAGG - Intronic
1070270785 10:74952494-74952516 GTGAAGGGCTTGGCATCAGCAGG + Intronic
1070675541 10:78409135-78409157 GTCAAGCACTTCTCAGCAGCAGG + Intergenic
1070676826 10:78417674-78417696 GACAAGGACTTGCCACCACTGGG - Intergenic
1070796502 10:79220006-79220028 GTGAAGGACCTGCCAGGAGCAGG + Intronic
1074235496 10:111580753-111580775 TGCAAGGAATTGCCACTAGCCGG + Intergenic
1077344131 11:2038632-2038654 GTCAAGGGGCTGCCACCAGCTGG - Intergenic
1077388470 11:2287376-2287398 GTGAAGGACGTGAAACCAGCCGG + Intergenic
1078938450 11:15973839-15973861 GTCCAGGCCTTGCCACCCTCTGG - Intronic
1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG + Exonic
1087360173 11:97148395-97148417 GTCACAGACTTCCCAACAGCAGG + Intergenic
1202827117 11_KI270721v1_random:93821-93843 GTCAAGGGGCTGCCACCAGCTGG - Intergenic
1094713109 12:32985417-32985439 TTCAAGGACTTCTCATCAGCAGG - Intergenic
1096541808 12:52312251-52312273 GTCATGGACGTGCCACCTGGGGG - Intergenic
1102434158 12:112907613-112907635 CTCAAGGTCTTGCAGCCAGCAGG - Intronic
1104830746 12:131749687-131749709 GTCCAGGCCGTGCCACCAGCTGG + Intronic
1105759126 13:23497278-23497300 GTCAGGGACTTGCAACCCTCTGG + Intergenic
1113651125 13:112034992-112035014 GAGAAGGACATTCCACCAGCAGG - Intergenic
1122906921 14:104805851-104805873 GTCCTGGATTTGCCACCAACTGG - Intergenic
1123587614 15:21773273-21773295 GTCAGGGAGTTGTCACCGGCGGG - Intergenic
1123624252 15:22215838-22215860 GTCAGGGAGTTGTCACCGGCGGG - Intergenic
1126372626 15:47963405-47963427 GTCAATGGCTTGCTGCCAGCAGG - Intergenic
1127688096 15:61368152-61368174 GTCAACAACCTGCCACCAGGTGG - Intergenic
1129518569 15:76171548-76171570 GTCAAGGCCTTGCTCCCTGCAGG + Intronic
1129798629 15:78396870-78396892 GTCACTTACTTGCCACAAGCAGG + Intergenic
1130054938 15:80514384-80514406 ATCAAGGCCTGGCCACCAGCAGG + Exonic
1133134858 16:3703577-3703599 CTAATGGACTTGCCACCAGGAGG + Intronic
1134229877 16:12420499-12420521 GTCAAACACTTGCCAACACCAGG - Intronic
1134397643 16:13879826-13879848 TCCGAGGAATTGCCACCAGCTGG - Intergenic
1134717600 16:16364650-16364672 GCCAGGCACATGCCACCAGCCGG - Intergenic
1134784956 16:16933950-16933972 TTCAGGGTCTTGCCACCAGAAGG + Intergenic
1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG + Intergenic
1139203542 16:65003992-65004014 GTCAGGGAAATGCCTCCAGCTGG + Intronic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1140555460 16:75916161-75916183 TTCAAGGAGTTATCACCAGCAGG - Intergenic
1142602228 17:1059256-1059278 GGAAAGGGCTTGGCACCAGCTGG - Intronic
1143002066 17:3800783-3800805 GTCAAGGACCTGCCCCAAGTGGG + Intronic
1146734426 17:35225727-35225749 GCAAGGGCCTTGCCACCAGCTGG + Intergenic
1147230871 17:39016817-39016839 ACCAAGGACTGGACACCAGCTGG - Intergenic
1152799807 17:82325570-82325592 GTCAAGTCCTTGACACAAGCCGG + Intronic
1153715915 18:7847821-7847843 GACAAGCAGATGCCACCAGCTGG - Intronic
1154049098 18:10936477-10936499 ACCAAGGACTTGCCACAGGCTGG - Intronic
1155595048 18:27476193-27476215 ATCAACAACTTGCCATCAGCTGG + Intergenic
1156638737 18:39063836-39063858 GTCAAGGACTTGCAAGGAACAGG - Intergenic
1156968082 18:43120583-43120605 TTCAATGACTTGCCACATGCTGG - Intergenic
1157613679 18:48975037-48975059 GTCACAGCCCTGCCACCAGCTGG - Intergenic
1159769921 18:72537733-72537755 GTCAAGGACTGTCCAGCAGGTGG + Exonic
1160811066 19:1013127-1013149 GTCCAGGACATGCAGCCAGCAGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163861044 19:19743008-19743030 GTCAAGTACTAGCCTCCAGGTGG - Intergenic
1164511794 19:28903682-28903704 GGCAAGTACCTGCCTCCAGCTGG - Intergenic
1168049229 19:53816279-53816301 TTCATGGACTAGCAACCAGCAGG - Intronic
931403939 2:61957668-61957690 GAAAAGGACATGCCACCCGCTGG + Intronic
932130748 2:69185242-69185264 GTTAAGAAGTTGTCACCAGCTGG + Intronic
937428076 2:121816402-121816424 GTCAAAGCCTGGCCACCATCAGG + Intergenic
938256282 2:129862118-129862140 TTCCAGGGCTGGCCACCAGCAGG - Intergenic
940325471 2:152420818-152420840 GTCAAGGTTTTTCCACCAGTAGG - Intronic
945424814 2:209687764-209687786 GCCATGAACCTGCCACCAGCGGG + Intronic
1169425875 20:5497057-5497079 GTCAGGGTCTTGGCAGCAGCCGG - Intergenic
1171492575 20:25531838-25531860 GTGCAGGACTTGCCCACAGCCGG - Intronic
1173421378 20:42904422-42904444 GCCAAGGTCATGCAACCAGCTGG - Intronic
1177357088 21:20022269-20022291 GTCAAGGACTTACCAACGCCAGG + Intergenic
1178479781 21:32969621-32969643 TCCCAGGACTGGCCACCAGCTGG - Intergenic
1183051592 22:35266323-35266345 GCTAATGACTTTCCACCAGCTGG + Intronic
1183551366 22:38488170-38488192 GTAAAGGACATGCCAACAACAGG + Intronic
951492381 3:23285905-23285927 GTCAAGAATTTGAGACCAGCTGG - Intronic
961636899 3:128338874-128338896 GTCATGGTCCTGCCACGAGCAGG - Intronic
962916284 3:139906800-139906822 GTCAAAGACTTGCCAGAAGGAGG - Intergenic
964435170 3:156643667-156643689 GTAAAGGAGATGCCTCCAGCCGG - Intergenic
970477306 4:16436692-16436714 GGCAAGGACTTGTCAACACCTGG - Intergenic
976630934 4:87235809-87235831 TTCAATGACTTGGCACCAGAAGG + Intronic
986488211 5:8261990-8262012 GTCAAGAATTTGTCACCAGCTGG + Intergenic
993424266 5:87742940-87742962 GTCAAGGACTTTTCACCAAAGGG - Intergenic
997029547 5:130109783-130109805 ATCAAGGACTTGCCCAGAGCTGG + Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1003361511 6:5430767-5430789 GTCAAATCCCTGCCACCAGCTGG - Intronic
1006912871 6:37575440-37575462 GTCAAGGCCTTGCCACAGGCAGG + Intergenic
1007623046 6:43226415-43226437 GTCAAGGACATGCCTCATGCTGG + Intronic
1009353339 6:62708968-62708990 CTCAAGGACTTGCAATGAGCAGG + Intergenic
1011722696 6:90175790-90175812 GTCAAAGGCATGCTACCAGCCGG - Intronic
1018071209 6:160166271-160166293 GTCCAGGAGTTGAGACCAGCCGG - Intergenic
1021053646 7:16020185-16020207 GTCCAGGACTTCCCACCTGAAGG - Intergenic
1024691119 7:51804638-51804660 ATCAATGAATTCCCACCAGCTGG - Intergenic
1028461021 7:91092730-91092752 GGCAAGGACTTGCAACTAGAAGG + Intronic
1028925804 7:96355809-96355831 GAGTAGGAGTTGCCACCAGCAGG - Intergenic
1029970092 7:104780289-104780311 GTCAGGGACTTGCTGGCAGCGGG - Intronic
1037257592 8:16972808-16972830 GTCAAGGGCTGGTCTCCAGCAGG - Intergenic
1045951473 8:107856117-107856139 GTCAAGAACTGGTGACCAGCAGG + Intergenic
1049418607 8:142506831-142506853 GTCAAGGACTGGCCTTTAGCAGG - Intronic
1050130197 9:2403955-2403977 TGCCAGGACTTGCCACCAGCTGG + Intergenic
1060066195 9:120503419-120503441 CTCATGCACTTGCCACCAGTGGG + Intronic