ID: 1139613085

View in Genome Browser
Species Human (GRCh38)
Location 16:68072787-68072809
Sequence CTGGGACACCCAGTGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139613085_1139613094 24 Left 1139613085 16:68072787-68072809 CCGACTTCCACTGGGTGTCCCAG 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1139613094 16:68072834-68072856 AGCCTTCATTTCACGGTCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 108
1139613085_1139613091 17 Left 1139613085 16:68072787-68072809 CCGACTTCCACTGGGTGTCCCAG 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1139613091 16:68072827-68072849 CTCCCTGAGCCTTCATTTCACGG 0: 1
1: 0
2: 4
3: 17
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139613085 Original CRISPR CTGGGACACCCAGTGGAAGT CGG (reversed) Intronic
901820669 1:11827260-11827282 AAGGGACACCCAGTGTAATTCGG - Intronic
902867180 1:19287456-19287478 CTCAGACACTCAGTGGAAGGAGG + Intronic
902986463 1:20157327-20157349 CTGGGACACCTCATGGCAGTTGG + Intergenic
903719200 1:25391882-25391904 TTCAGACACCCAGGGGAAGTTGG + Intronic
903929572 1:26854510-26854532 CTGGGCAGCACAGTGGAAGTGGG + Exonic
904035963 1:27558652-27558674 CTGGGCCACCCCCAGGAAGTGGG - Intronic
904052191 1:27646404-27646426 GTGGGACTCCCAGATGAAGTAGG + Intergenic
908339268 1:63159746-63159768 CTGGCACCACCAGTGGATGTAGG + Intergenic
911373682 1:97024742-97024764 CAGGGAATCCCAGTGGGAGTGGG - Intergenic
911973522 1:104464851-104464873 CTGGGACACCCCACGGCAGTTGG - Intergenic
912501636 1:110126563-110126585 CTGGGACACAGAGTGGTAGGAGG + Intergenic
915487911 1:156234903-156234925 CTGGTACACCAAGTGCAAGGTGG + Intronic
916059811 1:161090522-161090544 CTGGGATAGCCAGAGGAAGAGGG + Intergenic
916831503 1:168496744-168496766 CTGAGACAACCAGTGGATGTGGG - Intergenic
917509415 1:175657996-175658018 CTGGGAACCCAAGTGGAGGTAGG - Intronic
917638340 1:176958486-176958508 CAGGGACACCCAGTGCCAGGTGG + Intronic
921065104 1:211617015-211617037 GTGGCACATCCAGTGGGAGTAGG + Intergenic
921101153 1:211930597-211930619 CTGGAAGACCCTGTGGAAGGTGG - Intergenic
921532956 1:216307669-216307691 GTAGGACTGCCAGTGGAAGTGGG - Intronic
921747109 1:218751765-218751787 CTGGGACACCCCATGGCAATCGG - Intergenic
922462365 1:225823595-225823617 CTGGCCCACCCGGTGGATGTAGG + Intronic
922614087 1:226950970-226950992 CTGGGACATCCAGAGGCTGTGGG + Intronic
924632601 1:245754899-245754921 CTGGGGCGCCCAGAGGAAGGAGG + Intronic
1062843192 10:686727-686749 CAGGGACAGGCAGTGGAAGAAGG + Intronic
1064397405 10:14992800-14992822 CTGGGACACCCCACGGCAGTCGG - Intergenic
1064400291 10:15015260-15015282 CTGGGACACCCCACGGCAGTCGG - Intergenic
1065181209 10:23128239-23128261 GTGGTGCACACAGTGGAAGTGGG - Intergenic
1065284066 10:24170301-24170323 GTGGGACTCCCAGGGGAAGCTGG + Intronic
1065739975 10:28788439-28788461 CTGGGACAGCCCCTGAAAGTAGG - Intergenic
1068937704 10:62652085-62652107 CAGGGACCCCAGGTGGAAGTGGG + Intronic
1069597355 10:69681113-69681135 ATGGGACCCCCAGTGGAAAAGGG + Intergenic
1070286707 10:75088605-75088627 CTGAGCCACCCTGTAGAAGTCGG - Intergenic
1070488982 10:76958115-76958137 CAGGGAGACCCAGAGGAATTGGG + Intronic
1070713576 10:78701134-78701156 CTGTGACATCCAGTGAAACTTGG - Intergenic
1072430407 10:95366222-95366244 CTGGGGCACCCAGTGAATTTAGG - Intronic
1075740282 10:124691777-124691799 CTGGGTCCCCCACTGCAAGTGGG + Intronic
1080315182 11:30939254-30939276 CTGGGACACCCAGAGAGAGCGGG + Intronic
1081289904 11:41311870-41311892 TTGTGACAATCAGTGGAAGTAGG + Intronic
1082760447 11:57122004-57122026 CTAGGACACCCAGTTGGTGTTGG + Intergenic
1082994743 11:59244291-59244313 CTTGGACAACCATTGGTAGTAGG - Intergenic
1083446423 11:62710612-62710634 CAGGGACACCCAGTGAACTTGGG + Intronic
1084227891 11:67728776-67728798 CTGGGACACCCCACGGCAGTCGG - Intergenic
1084244885 11:67850271-67850293 CTGGGACACCCCACGGCAGTCGG - Intergenic
1084261292 11:67980459-67980481 CTGGGACACCTCATGGCAGTCGG - Intergenic
1084366775 11:68706548-68706570 CTGGGGCACCGAGTGGAGGGAGG - Intergenic
1084811356 11:71613637-71613659 CTGGGACACCCCACGGCAGTCGG + Intergenic
1084827803 11:71744286-71744308 CTGGGACACCCCATGGCAGTCGG + Intergenic
1084844420 11:71888098-71888120 CTGGGACACCCCACGGCAGTTGG + Intronic
1085289692 11:75389022-75389044 CTGGAATACCCAGAGGCAGTAGG - Intergenic
1085939965 11:81197281-81197303 CTGGGACACCCGGAGAGAGTGGG - Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1092024064 12:5226072-5226094 CTGGGAAAGCTAGTGGAAGTTGG + Intergenic
1092415456 12:8287419-8287441 CTGGGACACCCCATGGCAGTCGG - Intergenic
1092432570 12:8421027-8421049 CTGGGACACCCCACGGCAGTCGG - Intergenic
1094624753 12:32113161-32113183 GTGGGACAGACAGTGGCAGTAGG + Intronic
1097052146 12:56230086-56230108 CAAGGACACCCAGAGGAAGGGGG - Intronic
1101496414 12:105258788-105258810 CTGGGGCACACGGTGGAAGGAGG - Intronic
1107217969 13:37944746-37944768 CTGGAAAACTCAGTGGAACTAGG - Intergenic
1109051712 13:57491814-57491836 CTGAAAAACACAGTGGAAGTTGG - Intergenic
1111062702 13:83044309-83044331 GTGTGACACACAGTGGCAGTAGG - Intergenic
1111292956 13:86191124-86191146 CTGGGAAAGGCAGTGGAGGTTGG + Intergenic
1111993190 13:95137143-95137165 CTGCAACAAGCAGTGGAAGTAGG + Intronic
1113811895 13:113147715-113147737 CCTGGACACCCAGTGGGAGAAGG - Intronic
1117521955 14:56559985-56560007 GTGGGACTCCCAGTGGACGAGGG - Intronic
1117763101 14:59053148-59053170 CTTTGACACACAGTGGAGGTGGG + Intergenic
1118371907 14:65144489-65144511 CTGGGGCACCCAGCAGAGGTGGG + Intergenic
1119116585 14:72027496-72027518 ATGGGACTCCCAGTGGAAGAGGG - Intronic
1119443757 14:74647207-74647229 CTGGGAGATCCAGTGGACTTGGG + Intergenic
1121454191 14:94027851-94027873 CTTGGGCACCAAGTGGAAGCAGG - Intronic
1122139547 14:99654333-99654355 TGGGGACACCCAGTGGAAGCTGG + Intronic
1122372821 14:101238104-101238126 CCAGGCCACCCAGTGAAAGTGGG + Intergenic
1122540649 14:102496092-102496114 GTGGGCCACCCAGTGGAAACTGG - Intronic
1122793739 14:104195392-104195414 CGGGGACACCCAATGGCTGTGGG - Intergenic
1129832498 15:78679820-78679842 AGGGGACACCCTGGGGAAGTGGG + Intronic
1130333408 15:82938780-82938802 CTGAGACTCCCTGTGGGAGTGGG - Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131119097 15:89812239-89812261 CAGGGACACTGAGTGGGAGTGGG - Intronic
1133302041 16:4788271-4788293 CTGTGACACCTGGTGGACGTGGG + Exonic
1134101666 16:11456862-11456884 TCGGGCCACCCTGTGGAAGTGGG - Exonic
1137023510 16:35452509-35452531 GTGGGGCACCCAGTGGCAGATGG + Intergenic
1138516326 16:57536981-57537003 CTCTGCCACCGAGTGGAAGTGGG + Intergenic
1139613085 16:68072787-68072809 CTGGGACACCCAGTGGAAGTCGG - Intronic
1143373415 17:6454237-6454259 CTAGGACACCCAGTTTGAGTGGG + Exonic
1143423449 17:6814168-6814190 CTGGGGCACCCAGTTGAACAGGG + Intronic
1144392721 17:14810942-14810964 CTGGAACACCCAGTGAAAGAGGG + Intergenic
1145865018 17:28235624-28235646 CTGGGACACCCCACGGCAGTCGG - Intergenic
1147611231 17:41803019-41803041 CCTGGACACCCATTGGGAGTGGG - Intronic
1148212911 17:45818996-45819018 CTGGGTCACCCAGAGGGAGCAGG - Intronic
1148821818 17:50364328-50364350 CTGGGACACGGAATGGCAGTAGG - Intergenic
1149075971 17:52596390-52596412 CTGGGACACCCCATGGCAGTCGG + Intergenic
1149764515 17:59263872-59263894 TTGGGGCACACAGTGGTAGTGGG + Intronic
1150569862 17:66376282-66376304 CTGGCACAGGCAGTGGAAGGTGG + Intronic
1152717721 17:81907858-81907880 CTGGGGGACACAGTGGGAGTGGG + Intronic
1160537915 18:79604771-79604793 CTGGGACCCCCAGGGGAACCTGG + Intergenic
1160889834 19:1371398-1371420 CTGGGAAACCCACTGCGAGTTGG + Intronic
1162019351 19:7861642-7861664 CTAGGACACCCTGTGAGAGTAGG + Intronic
1163136517 19:15315443-15315465 CAGGCACACCAAGTGGAACTCGG - Intronic
1163326096 19:16604176-16604198 CTGGGACACACTGTGGAGGGAGG + Intronic
1163501664 19:17680018-17680040 CTGGGGCTCCCAGTGGGAGAGGG + Intronic
1163943376 19:20514950-20514972 CTGGGACACTCCATGGCAGTTGG - Intergenic
1163966532 19:20751917-20751939 CTGGGACACCCCACGGCAGTCGG - Intronic
1165461350 19:35945901-35945923 CTGGGAGCCCCAGGGGAAGCTGG + Intergenic
1165649297 19:37471460-37471482 CTGCGACACCCAGTGGTAATGGG - Intronic
925661157 2:6204418-6204440 CTGTGACACCTCCTGGAAGTGGG + Intergenic
926967213 2:18428347-18428369 CTGGCACACCCAGAAGAATTAGG + Intergenic
927335534 2:21919262-21919284 CTGGGAAAGCCAGTGGGTGTGGG - Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
929564989 2:42978632-42978654 CTGGGCCTCCCAGTGGATGGAGG + Intergenic
932331846 2:70902122-70902144 CTGGGACACCCTGGGCCAGTTGG + Intronic
932349759 2:71022474-71022496 CTGGGACACCCCACGGCAGTCGG + Intergenic
932353265 2:71048601-71048623 CTGGGACACCCCATGGCAGTCGG + Intergenic
932460175 2:71876938-71876960 CAGGGACAAGGAGTGGAAGTTGG + Intergenic
933436932 2:82260551-82260573 TTGAGACACCCAGAGGAACTGGG + Intergenic
934517512 2:94998172-94998194 CTGGGGCGCCCACTGGAAGCAGG + Intergenic
935344543 2:102093821-102093843 CTCGGACACTCAGAGGAGGTGGG - Intronic
939979104 2:148757492-148757514 CAGTGACACCCAGTAGAAATGGG + Intronic
940874238 2:158884252-158884274 CTGGGACACCCCACGGCAGTCGG + Intergenic
942419406 2:175792701-175792723 CTGCGCCACCCAGTTGAAATTGG - Intergenic
947187050 2:227464817-227464839 CTGTGAAACCCAGTGGAACCTGG + Intergenic
947594823 2:231404401-231404423 CTGGGACACCCCACGGCAGTCGG + Intergenic
947864296 2:233385328-233385350 CTGGGCTCCCCAGAGGAAGTTGG - Intronic
948809296 2:240466675-240466697 CTGGGAGTCCCAGTGGGAGGAGG - Exonic
1171309245 20:24133023-24133045 CTGGAACACCTAATGGAAGTTGG + Intergenic
1171408381 20:24929118-24929140 CTGGGACACCCCACGGCAGTCGG + Intergenic
1173210272 20:41026966-41026988 CTTGGTCAGCCAGTGGAAGCAGG + Intergenic
1173607385 20:44341231-44341253 CTGGGCCACCCAGTGCATCTGGG + Exonic
1176299904 21:5094699-5094721 CTGGGGCACCCAGTGGAGGCCGG - Intergenic
1176877966 21:14153106-14153128 CTGGAACAGCCAGTGAAATTAGG - Intronic
1179857118 21:44167212-44167234 CTGGGGCACCCAGTGGAGGCCGG + Intergenic
1179950922 21:44708459-44708481 CTGGGAGCACCAGTGGAAGTAGG + Intronic
1180836234 22:18930926-18930948 CTGGAGCACCCAGTGGGAGCAGG - Intronic
1181846313 22:25712095-25712117 CTGGGGAACCCAGTGGCAGCTGG + Intronic
1203286326 22_KI270734v1_random:156225-156247 CTGGAGCACCCAGTGGGAGCAGG - Intergenic
949233041 3:1773976-1773998 CTGGGGCAGCCATTGGAAGTTGG - Intergenic
949882874 3:8675430-8675452 CTGGGACACCCCATTGCAGTCGG + Intronic
950479809 3:13237287-13237309 CAGGGACACCCTGTGGAAGGTGG + Intergenic
951166160 3:19487010-19487032 CTGGGACACTCCTTGGCAGTCGG - Intronic
951285580 3:20809154-20809176 GTGGGTCACCCATTGGAAGCTGG + Intergenic
952328849 3:32345219-32345241 CTGGGACTACAAGTGTAAGTAGG - Intronic
954335110 3:49911756-49911778 CTGGAACCCCCAGGGGCAGTTGG - Exonic
957022347 3:75139835-75139857 CTGGGACACCCCACGGCAGTCGG + Intergenic
958147415 3:89643820-89643842 CTGGGAAAGGTAGTGGAAGTGGG + Intergenic
961272077 3:125696919-125696941 CTGGGACACCCCACGGCAGTCGG + Intergenic
961274938 3:125719152-125719174 CTGGGACACCCCACGGCAGTCGG + Intergenic
961277855 3:125741783-125741805 CTGGGACACCCCACGGCAGTCGG + Intergenic
961333094 3:126154418-126154440 AGGGGGCACCCAGTGGGAGTAGG + Intronic
961876566 3:130027879-130027901 CTGGGACACCCCACGGCAGTCGG - Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
966863377 3:184242783-184242805 CTGGGACAACCTGGGGGAGTGGG - Intronic
968988833 4:3895083-3895105 CTGGGACACCCCACGGCAGTCGG - Intergenic
969019812 4:4132324-4132346 CTGGGACACCCCACGGCAGTCGG - Intergenic
969024520 4:4162726-4162748 CTGGGACACCCCACGGCAGTCGG - Intergenic
969025426 4:4168674-4168696 CTGGGACACCCCACGGCAGTCGG - Intergenic
969734045 4:8975089-8975111 CTGGGACACCCCACGGCAGTCGG + Intergenic
969749758 4:9101110-9101132 CTGGGACACCCCACGGGAGTCGG + Intergenic
969785475 4:9453971-9453993 CTGGGACACCCCACGGCAGTCGG + Intergenic
969788885 4:9478378-9478400 CTGGGACACCCCACGGCAGTCGG + Intergenic
969793625 4:9509146-9509168 CTGGGACATCCCACGGAAGTCGG + Intergenic
969826525 4:9762511-9762533 CTGGGACACCCCACGGCAGTCGG + Intergenic
972381184 4:38521936-38521958 CTGGGAAGCCCTGTGTAAGTGGG - Intergenic
973789514 4:54365229-54365251 CTGGGAGTCCCAGAGGAATTTGG - Intergenic
976694713 4:87907027-87907049 CTGGGACACCCACTGGCACAGGG + Intergenic
981604827 4:146529544-146529566 CTGGGACACCCCACGGCAGTCGG + Intergenic
982380773 4:154744874-154744896 GTGTGACTCCCAGGGGAAGTGGG + Intronic
987440174 5:17945938-17945960 TTTGGGCACCCAGGGGAAGTGGG - Intergenic
987757393 5:22114053-22114075 CTGGGTCACCCAGTGAGAGCTGG - Intronic
990001546 5:50899130-50899152 CTCAGACACCCAGTGGTAGAAGG + Intergenic
991580343 5:68148338-68148360 CTGGGAAACCCGGGGTAAGTTGG - Intergenic
991963784 5:72071395-72071417 CTGAGGCACCCAGAGGAAGATGG + Intergenic
992365257 5:76083787-76083809 CTGGGATTCCCAGAGGAGGTGGG + Intronic
992483363 5:77172791-77172813 CTGGGACAGGCAGTGGGTGTCGG + Intergenic
992774453 5:80077377-80077399 CTGGGACTCCCAGTGGAAGGTGG - Intronic
994881757 5:105506872-105506894 ATGGGACACCTAGTGGCTGTGGG - Intergenic
997530702 5:134579641-134579663 CTGTGTCACCCAGTGGCAGTGGG - Exonic
997743037 5:136274530-136274552 CTGAGATACCCGGTGAAAGTAGG - Intronic
997890288 5:137670400-137670422 CTGGGACAACCAATGAAAGGTGG + Intronic
998410024 5:141902825-141902847 CTGGGGGAGCCAGGGGAAGTAGG + Intergenic
1000504374 5:162096643-162096665 CAGTGACACCCAGTGGGAGGTGG + Intronic
1000799066 5:165701721-165701743 CTTGAACACCCAGTGGTATTCGG - Intergenic
1006454216 6:34122762-34122784 CTGGGCCAGGCACTGGAAGTAGG + Intronic
1011267152 6:85534115-85534137 CTGGGAAACACAGAGCAAGTAGG + Intronic
1011565193 6:88665818-88665840 CTGGGACGCCCCATGGCAGTCGG + Intronic
1011842952 6:91525038-91525060 CTTGGCCACCCAGTGAAATTGGG - Intergenic
1013311902 6:108902421-108902443 CTGGGCCACTCATTGGCAGTGGG - Intronic
1016505337 6:144772818-144772840 CTGGACCAACCAGAGGAAGTAGG - Intronic
1019888058 7:3922454-3922476 ATGTGACACCCAGTGGTATTCGG - Intronic
1020307212 7:6844361-6844383 CTGGGACACCCCACGGCAGTCGG - Intergenic
1020311690 7:6873197-6873219 CTGGGACACCCCACGGCAGTCGG - Intergenic
1020323233 7:6955531-6955553 CTGGGACACCCCACGGCAGTTGG - Intergenic
1022712300 7:32863480-32863502 TTGGAACACTCAGTGGGAGTGGG + Intergenic
1023105217 7:36757127-36757149 CTGGGACACCATGCAGAAGTGGG + Intergenic
1023266014 7:38406655-38406677 CTGGAACACCAAGTAGAAGAGGG + Intronic
1026336085 7:69395116-69395138 TTGGAAAACCAAGTGGAAGTGGG + Intergenic
1028409231 7:90509753-90509775 CTGGGACTCACAGGGCAAGTGGG + Intronic
1031528937 7:122853342-122853364 CTGGGCCACCCAGGGGTAATTGG - Intronic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1034561008 7:151879009-151879031 CTGGGTCACCCAGTGGAATGAGG - Intergenic
1035851963 8:2929370-2929392 CTGGGACACCAGGTGGAAACAGG + Intergenic
1036239654 8:7071207-7071229 CTGGGACACCCCATGGCAGTCGG + Intergenic
1036262223 8:7249943-7249965 CTGGGACACCCCACGGCAGTCGG - Intergenic
1036304365 8:7589615-7589637 CTGGGACACCCCACGGCAGTCGG + Intergenic
1036314262 8:7708482-7708504 CTGGGACACCCCACGGCAGTCGG - Intergenic
1036355217 8:8037607-8037629 CTGGGACACCCCACGGCAGTCGG + Intergenic
1036372837 8:8175452-8175474 CTGGGACACCCCACGGCAGTCGG + Intergenic
1036833515 8:12039942-12039964 CTGGGACACCCCACGGCAGTCGG - Intergenic
1036855361 8:12286507-12286529 CTGGGACACCCCACGGCAGTCGG - Intergenic
1036878069 8:12490189-12490211 CTGGGACACCCCACGGCAGTCGG - Intergenic
1036903676 8:12690359-12690381 CTGGGACACCCCACGGCAGTCGG - Intergenic
1036906161 8:12709992-12710014 CTGGGACACCCCACGGCAGTTGG - Intergenic
1037950385 8:23015633-23015655 CTGGTACGCACAGTGGAACTGGG - Exonic
1038699840 8:29839840-29839862 CTGGTACATCCGGTGGCAGTAGG - Intergenic
1038723728 8:30060656-30060678 CTGGGACCCCTAGAGGCAGTGGG - Intergenic
1038798952 8:30732256-30732278 CTGGGACACCCCACGGCAGTCGG + Intronic
1041716097 8:60933707-60933729 CTGGCACACACAATGGAAGATGG + Intergenic
1042237035 8:66623612-66623634 CTGGGACACTAATTAGAAGTTGG - Intergenic
1043048996 8:75361523-75361545 CTGGGACACCCAGACAGAGTGGG - Intergenic
1044781746 8:95750555-95750577 CTAAGAGACACAGTGGAAGTAGG - Intergenic
1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG + Intronic
1045886891 8:107108703-107108725 CAGGGAGACCCAGCGGAAGGTGG - Intergenic
1047207496 8:122814795-122814817 TTGGGGTACCCAGTAGAAGTGGG + Intronic
1048161636 8:132026917-132026939 CTGGAACAGAAAGTGGAAGTGGG - Intronic
1048917839 8:139201588-139201610 CTGAGACACCCAGGGGTAGTAGG - Intergenic
1049110547 8:140639823-140639845 CTGGCAGACCCAGTGGAGGATGG - Intergenic
1049325506 8:142019516-142019538 CTGGGACACCAAGGGCAAGGGGG - Intergenic
1049457854 8:142702949-142702971 CTGGGGCACCAAGGGGGAGTCGG - Intronic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1051151240 9:14081404-14081426 CGGGGACACCCTGTGGCTGTGGG - Intergenic
1053447846 9:38166593-38166615 CAGAGACACCCAGTGGTACTGGG - Intergenic
1053480941 9:38415803-38415825 CTGGGACACCCAGGGGCTATGGG - Intronic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054837600 9:69694901-69694923 CTTGGAAACCCAGAGGAAATGGG - Intergenic
1056245513 9:84691279-84691301 CTGAGAAAGCCAGTGAAAGTTGG + Intronic
1056865656 9:90225708-90225730 CTGGGACACCCCATGGCAGTCGG + Intergenic
1057028509 9:91755649-91755671 TTGGGCCACCCCGTGGCAGTGGG - Intronic
1057871801 9:98723613-98723635 CAGGGCCACTCAGTGGGAGTTGG + Intergenic
1059784346 9:117564281-117564303 CTGTGACACCATGTGGAAGCGGG + Intergenic
1059859091 9:118437613-118437635 CTGTAACACCCAGTGGATGGTGG - Intergenic
1061011862 9:127960637-127960659 TTGAAACACCCAGTGGAATTGGG + Intronic
1062224340 9:135440931-135440953 CTGGGACACCCCATGGCAGTTGG - Intergenic
1187422904 X:19151832-19151854 CTTGGACTCCGAGTGGAACTTGG + Intergenic
1188242964 X:27811010-27811032 CTGGGATATCAAGTGGAAGAGGG + Intronic
1189283988 X:39839057-39839079 CTGTCACAGCCAGTGGAAGTAGG - Intergenic
1190977113 X:55416624-55416646 CTGGGAGGCTTAGTGGAAGTGGG - Intergenic
1192065099 X:67875535-67875557 CTGGAAAACCTAGAGGAAGTGGG - Intergenic
1192268472 X:69556468-69556490 CAGAGAAACCCAGGGGAAGTGGG + Intergenic
1194151114 X:90325961-90325983 CTGTGAGTCACAGTGGAAGTGGG - Intergenic
1196352476 X:114747777-114747799 CTGGGACCCACATTGGATGTGGG - Intronic
1197522786 X:127520304-127520326 CTGGGAGACCCATTGCAGGTTGG - Intergenic
1198399700 X:136256915-136256937 TTGGGAGGCCCAGTGGAAGGCGG - Intergenic
1199170413 X:144728408-144728430 CTGGGACACTCATTGCAAGAAGG + Intergenic
1200219521 X:154384228-154384250 CTGGGGCACCCAGTGCACTTCGG - Intergenic
1200394241 X:155974032-155974054 CTGGGACACTCCATGGCAGTTGG - Intergenic
1200497482 Y:3902715-3902737 CTGTGAGTCACAGTGGAAGTGGG - Intergenic
1200948056 Y:8865625-8865647 CTGGGACACCCCATGACAGTCGG + Intergenic
1202264791 Y:23006772-23006794 CTGGAATCCCCAGTGGAAGGAGG - Intergenic
1202417782 Y:24640514-24640536 CTGGAATCCCCAGTGGAAGGAGG - Intergenic
1202453004 Y:25029572-25029594 CTGGAATCCCCAGTGGAAGGAGG + Intergenic