ID: 1139615380

View in Genome Browser
Species Human (GRCh38)
Location 16:68085440-68085462
Sequence GGTGCCTAAGCCTCCACTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139615380_1139615392 30 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615392 16:68085493-68085515 CTCGGCGCGCGGCCAGCTTTCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1139615380_1139615386 -5 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615386 16:68085458-68085480 GCACCGGTGGCGGGCGGCTGCGG 0: 1
1: 0
2: 4
3: 20
4: 330
1139615380_1139615388 2 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615388 16:68085465-68085487 TGGCGGGCGGCTGCGGTTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 374
1139615380_1139615389 12 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615389 16:68085475-68085497 CTGCGGTTCCTGGTGCTGCTCGG 0: 1
1: 0
2: 2
3: 30
4: 393
1139615380_1139615390 19 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615390 16:68085482-68085504 TCCTGGTGCTGCTCGGCGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139615380 Original CRISPR GGTGCCTAAGCCTCCACTGT CGG (reversed) Intronic
900244744 1:1631821-1631843 GGTCCCCAAGCCCCCACTGCTGG - Intergenic
902866048 1:19280353-19280375 GGTGCCTCAGCCACCACAGTAGG + Intergenic
903426114 1:23255662-23255684 TGTGCCTCAGCCTCCAGAGTAGG + Intergenic
903605777 1:24574095-24574117 GGTGCTTAAGCCTTCAGTCTGGG + Intronic
904114329 1:28150515-28150537 GTTGCCTGAGCCAGCACTGTCGG + Exonic
905024536 1:34840631-34840653 GCTTGCTGAGCCTCCACTGTTGG + Intronic
908064734 1:60390449-60390471 GGTGCTTAAGTGTCCACTGGTGG + Intergenic
914743326 1:150483040-150483062 CCTGCCTCAGCCTCCAGTGTTGG + Intergenic
916522810 1:165580445-165580467 AGTGCCTAAGCATCCTCTGAGGG - Intergenic
916795682 1:168165130-168165152 GGGGCCTCTGCCTGCACTGTAGG + Intergenic
917355393 1:174121819-174121841 TGTGCATAAGCATGCACTGTGGG + Intergenic
918298778 1:183183433-183183455 CCTGCCTAAGCCTCAACTTTTGG + Intergenic
920068125 1:203283413-203283435 GGTGCCTAAACCCACACTGTAGG - Intergenic
921639514 1:217535459-217535481 CCTGCCTCAGCCTCCACAGTAGG + Intronic
1068060776 10:52064687-52064709 GCTGCCTAAGCCACGACTGTGGG - Intronic
1072080380 10:92023911-92023933 GGTGTATAAGCCCCCACTGCCGG + Intronic
1076149252 10:128149776-128149798 GGCGCCCGAGCCTCCTCTGTGGG - Intergenic
1076514212 10:131033985-131034007 GGTTCCTGGGCCTGCACTGTGGG + Intergenic
1078858519 11:15226204-15226226 GGTGCCTAGACCTCCTCTGAAGG + Intronic
1079279194 11:19072686-19072708 GCTGCCCAACCCTCCACCGTGGG - Intergenic
1080815258 11:35749571-35749593 GGTGCCTCAGCCTCCTGAGTAGG - Intronic
1082210552 11:49496199-49496221 GGTGCATATCCCTCCACAGTCGG + Intergenic
1087750882 11:102005650-102005672 GGTGGTGAAGCCTCCCCTGTGGG - Intergenic
1089291307 11:117439291-117439313 GGTGTCAAAGCCACCAGTGTTGG + Exonic
1091212469 11:133873916-133873938 GGTGCCACAGCGTCCACTTTTGG - Intergenic
1094713179 12:32985868-32985890 GGTGTCCAGGCCACCACTGTAGG - Intergenic
1101233512 12:102765788-102765810 GTTACCAAAGCCTCCTCTGTAGG + Intergenic
1106342041 13:28839112-28839134 GGTGTCTATGCCTCCACATTTGG + Intronic
1112606540 13:100912204-100912226 GGAGCCTTAGCCTTCACTGAGGG + Intergenic
1113496650 13:110735715-110735737 CCTGCCTCAGCCTCCCCTGTAGG + Intergenic
1113497946 13:110748033-110748055 GGTTCAAAAGGCTCCACTGTGGG + Intergenic
1113832595 13:113308124-113308146 CGTGCCTCAGCCTCCTCAGTAGG + Intronic
1114644243 14:24245396-24245418 GGTGCCTCAGCCTCCCAAGTAGG + Intergenic
1125465816 15:39951354-39951376 CGTGCTTAAGAATCCACTGTGGG - Intronic
1127371890 15:58349240-58349262 CCTGCCTAAGCCTCCCCAGTAGG + Intronic
1127899338 15:63329692-63329714 AGGGCCTCAGCCACCACTGTGGG - Intronic
1129231059 15:74197453-74197475 GGTGCCCAGGCCTCCCCTGAGGG + Intronic
1139615380 16:68085440-68085462 GGTGCCTAAGCCTCCACTGTCGG - Intronic
1140947597 16:79784491-79784513 GGTGACAAAACCTCCACTGTTGG - Intergenic
1143389817 17:6553689-6553711 GGTGCCACAGCCTCCACTCCTGG + Intronic
1145806724 17:27739360-27739382 GGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1147271195 17:39272588-39272610 CGTGCCTCAGCCTCCAGAGTAGG - Intronic
1149975657 17:61263195-61263217 GGTGCCTCACCTTCCCCTGTTGG - Intronic
1152091478 17:78249979-78250001 GCTGCCTAAGCCTCCATGCTGGG + Intergenic
1160273120 18:77405633-77405655 TGTGCCTAAGCATCTAATGTTGG + Intergenic
1164215404 19:23140838-23140860 CCTGCCTCAGCCTCCCCTGTAGG - Intronic
1168131363 19:54321820-54321842 GCTGCCCAGGACTCCACTGTGGG - Intergenic
926044996 2:9703771-9703793 GCTGCCCCAGCCTCCACTGCTGG - Intergenic
928316543 2:30250810-30250832 GGTCCAACAGCCTCCACTGTTGG + Intronic
932037724 2:68264160-68264182 CGTGCCTCAGCCTCCCCAGTAGG + Intergenic
933649770 2:84841158-84841180 GGTGCCTTCGCCTCCTCTCTAGG - Intronic
936711934 2:115141883-115141905 TGTGCCTCAGCCTCCCGTGTAGG + Intronic
938578125 2:132622280-132622302 CGTGCCTCAGCCTCCACAGTAGG - Intronic
939925108 2:148163256-148163278 GGAGCCTAAGCCTGGACTTTAGG + Intronic
940819888 2:158341416-158341438 CGTGCCTAAGCCTCCCGAGTAGG + Intronic
941963163 2:171273977-171273999 CCTGCCTAAGCCTCCAGAGTAGG + Intergenic
942137909 2:172946804-172946826 GATGCCCATGCCTCCTCTGTTGG - Intronic
948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG + Intergenic
1169274564 20:4224789-4224811 GGTGCCTCTGCCTCCTCAGTAGG - Intronic
1173183142 20:40819685-40819707 AGTGCGTAAGACTCCATTGTGGG - Intergenic
1173423360 20:42922571-42922593 GGTGCCTCAGCATCCCTTGTAGG + Intronic
1173837523 20:46135712-46135734 GGTGCATAGGATTCCACTGTAGG + Intergenic
1175840451 20:62023317-62023339 CGTGCCTCAGCCTCCACTACAGG - Intronic
1178254200 21:31036396-31036418 TGTGTCTAAGCCTCAACTTTAGG - Intergenic
1180288035 22:10769462-10769484 TCTGCCTCAGCCTCCCCTGTAGG + Intergenic
1181031575 22:20150763-20150785 GGAGCCTCGCCCTCCACTGTGGG + Exonic
1181458890 22:23074649-23074671 GGCTCCTGGGCCTCCACTGTGGG + Intronic
1181698468 22:24607079-24607101 GGTGGCCAAGCCTGCACTGCTGG + Intronic
1184711605 22:46253611-46253633 GGTGCCTCAGCCTCCCGAGTAGG - Intergenic
1184711613 22:46253651-46253673 GGTGCCTCAGCCTCCCAGGTAGG - Intergenic
949903560 3:8839573-8839595 GGTGCCCTAGCCACCACTGGGGG - Intronic
954310349 3:49761832-49761854 GGTGCCTCAGCCTCCAAACTGGG - Intronic
968609188 4:1549400-1549422 GGTGACAAAGCCTCGACTGAAGG - Intergenic
974345867 4:60680222-60680244 GGTACCCCAGCCTCCACTGCAGG + Intergenic
974346122 4:60683487-60683509 GGTCCCCCAGCCTCCACTGCAGG + Intergenic
975100792 4:70510756-70510778 GGTGCTTAAGCGTCAATTGTTGG - Intergenic
976712279 4:88085236-88085258 GGTGCCTCAGTTTCCACTGAGGG + Intergenic
977576655 4:98681980-98682002 CCTGCCTCAGCCTCCAGTGTAGG - Intergenic
985421772 4:189791633-189791655 CCTGCCTCAGCCTCCCCTGTAGG + Intergenic
986925360 5:12741918-12741940 TGTGCCTCAGCCTCCTCAGTAGG - Intergenic
988051940 5:26042169-26042191 GGTGCCTCAGCCTGCTCTCTTGG + Intergenic
988187145 5:27880574-27880596 ATTGCCTATGCCTCCACTTTAGG - Intergenic
994072006 5:95613176-95613198 GGGGCCTGAGCCTCAAGTGTGGG - Intergenic
995224131 5:109685251-109685273 CCTGCCTCAGCCTCCACAGTAGG + Intergenic
998261257 5:140633432-140633454 GGAGCCTAAGCCTTCTCTGGTGG + Exonic
1000107373 5:158073014-158073036 GTTAGCTAAGCCTCCAGTGTTGG - Intergenic
1005821283 6:29601743-29601765 AGTGCCTAAGCATCCCCTCTAGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007952696 6:45886323-45886345 CCTGCCTAATCCTCCACCGTCGG + Intergenic
1009616143 6:66009834-66009856 GGTGACTATGCCTTCACTGGTGG - Intergenic
1013668395 6:112371786-112371808 GATGTTAAAGCCTCCACTGTTGG + Intergenic
1013834474 6:114317624-114317646 GGTGCCTAACCTACCACTATAGG - Intronic
1015540103 6:134305245-134305267 TGTGCCTCAGCCTCCAGAGTAGG - Intronic
1015657992 6:135541357-135541379 GATGCCTCAGCCGCCACTCTTGG - Intergenic
1016873392 6:148840576-148840598 GGTCCCTCAGAGTCCACTGTGGG - Intronic
1020237614 7:6368604-6368626 CCTGCCTCAGCCTCCACAGTAGG + Intergenic
1021861021 7:24906182-24906204 GATGCCTAGGCCTCCAGTGATGG - Intronic
1022014398 7:26336591-26336613 CGTGCCTCAGCCTCCCCGGTAGG - Intronic
1025952568 7:66157049-66157071 CGTGCCTCAGCCTCCAGAGTAGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1028182018 7:87735334-87735356 GTTGCCTAAGGCTCACCTGTTGG + Intronic
1032368710 7:131325583-131325605 GCTGCCTCAGCCTCCCATGTAGG - Intronic
1040633155 8:49239537-49239559 GGGTCCTAAGCCTTCACTGATGG - Intergenic
1040806995 8:51406070-51406092 GCTGTGTTAGCCTCCACTGTCGG - Intronic
1041185856 8:55300030-55300052 GGTGTCAAAGCCCCCGCTGTAGG + Intronic
1044574928 8:93757870-93757892 GGTGCCTCAGCCTCCCAAGTAGG + Intronic
1050646588 9:7726045-7726067 GGTGCCTCAGCTTCCCTTGTTGG + Intergenic
1054774864 9:69116731-69116753 CGTGCCTCAGCCTCCACACTTGG + Intergenic
1055019764 9:71657269-71657291 GGTGCCTCAGCCTCCCGAGTAGG + Intergenic
1057620874 9:96633589-96633611 CCTGCCTCAGCCTCCACAGTAGG - Intergenic
1060995590 9:127873526-127873548 GGTTGCTAAGCCCCCACTGCCGG - Intronic
1061416975 9:130452257-130452279 GGTGTCCAGGCCGCCACTGTAGG - Exonic
1061789354 9:133050885-133050907 GGTGCCCAAGCAGCCACTGGAGG + Exonic
1185838432 X:3367177-3367199 GGTGTCCAGGCCACCACTGTGGG - Intergenic
1189214218 X:39309463-39309485 GGTTCCTTGGCCTCCACCGTGGG + Intergenic
1189355106 X:40304542-40304564 GGTGCCTAAGCATACACCCTAGG - Intergenic
1192550192 X:72047470-72047492 GTTGCCTAAACTTCCACTATTGG - Intergenic
1192734190 X:73832991-73833013 GCTGCCTCAGCCTCCAGAGTAGG + Intergenic
1195368651 X:104151267-104151289 GGTGCTTAAGCCTCTGCTTTGGG + Intronic
1196434771 X:115664923-115664945 GGTGTCCAGGCCGCCACTGTAGG - Intergenic
1198807914 X:140507776-140507798 GGTGGCTAAGCCTGCGCTGCAGG - Intergenic
1199812686 X:151366276-151366298 AGTCCCCAAGCCTCCACTTTTGG - Intergenic
1201237328 Y:11923719-11923741 GGTGTCCAGGCCACCACTGTGGG + Intergenic