ID: 1139615380

View in Genome Browser
Species Human (GRCh38)
Location 16:68085440-68085462
Sequence GGTGCCTAAGCCTCCACTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139615380_1139615386 -5 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615386 16:68085458-68085480 GCACCGGTGGCGGGCGGCTGCGG 0: 1
1: 0
2: 4
3: 20
4: 330
1139615380_1139615392 30 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615392 16:68085493-68085515 CTCGGCGCGCGGCCAGCTTTCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1139615380_1139615388 2 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615388 16:68085465-68085487 TGGCGGGCGGCTGCGGTTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 374
1139615380_1139615389 12 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615389 16:68085475-68085497 CTGCGGTTCCTGGTGCTGCTCGG 0: 1
1: 0
2: 2
3: 30
4: 393
1139615380_1139615390 19 Left 1139615380 16:68085440-68085462 CCGACAGTGGAGGCTTAGGCACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1139615390 16:68085482-68085504 TCCTGGTGCTGCTCGGCGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139615380 Original CRISPR GGTGCCTAAGCCTCCACTGT CGG (reversed) Intronic