ID: 1139615386 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:68085458-68085480 |
| Sequence | GCACCGGTGGCGGGCGGCTG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 355 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 20, 4: 330} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139615380_1139615386 | -5 | Left | 1139615380 | 16:68085440-68085462 | CCGACAGTGGAGGCTTAGGCACC | 0: 1 1: 0 2: 1 3: 6 4: 115 |
||
| Right | 1139615386 | 16:68085458-68085480 | GCACCGGTGGCGGGCGGCTGCGG | 0: 1 1: 0 2: 4 3: 20 4: 330 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139615386 | Original CRISPR | GCACCGGTGGCGGGCGGCTG CGG | Intronic | ||