ID: 1139615387

View in Genome Browser
Species Human (GRCh38)
Location 16:68085461-68085483
Sequence GAACCGCAGCCGCCCGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139615387_1139615389 -9 Left 1139615387 16:68085461-68085483 CCGGTGGCGGGCGGCTGCGGTTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1139615389 16:68085475-68085497 CTGCGGTTCCTGGTGCTGCTCGG 0: 1
1: 0
2: 2
3: 30
4: 393
1139615387_1139615393 14 Left 1139615387 16:68085461-68085483 CCGGTGGCGGGCGGCTGCGGTTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1139615393 16:68085498-68085520 CGCGCGGCCAGCTTTCGGAACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1139615387_1139615390 -2 Left 1139615387 16:68085461-68085483 CCGGTGGCGGGCGGCTGCGGTTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1139615390 16:68085482-68085504 TCCTGGTGCTGCTCGGCGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1139615387_1139615392 9 Left 1139615387 16:68085461-68085483 CCGGTGGCGGGCGGCTGCGGTTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1139615392 16:68085493-68085515 CTCGGCGCGCGGCCAGCTTTCGG 0: 1
1: 0
2: 0
3: 4
4: 66
1139615387_1139615395 23 Left 1139615387 16:68085461-68085483 CCGGTGGCGGGCGGCTGCGGTTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1139615395 16:68085507-68085529 AGCTTTCGGAACGGAACGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139615387 Original CRISPR GAACCGCAGCCGCCCGCCAC CGG (reversed) Intronic