ID: 1139615392 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:68085493-68085515 |
| Sequence | CTCGGCGCGCGGCCAGCTTT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 71 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 66} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139615387_1139615392 | 9 | Left | 1139615387 | 16:68085461-68085483 | CCGGTGGCGGGCGGCTGCGGTTC | 0: 1 1: 0 2: 0 3: 5 4: 102 |
||
| Right | 1139615392 | 16:68085493-68085515 | CTCGGCGCGCGGCCAGCTTTCGG | 0: 1 1: 0 2: 0 3: 4 4: 66 |
||||
| 1139615380_1139615392 | 30 | Left | 1139615380 | 16:68085440-68085462 | CCGACAGTGGAGGCTTAGGCACC | 0: 1 1: 0 2: 1 3: 6 4: 115 |
||
| Right | 1139615392 | 16:68085493-68085515 | CTCGGCGCGCGGCCAGCTTTCGG | 0: 1 1: 0 2: 0 3: 4 4: 66 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139615392 | Original CRISPR | CTCGGCGCGCGGCCAGCTTT CGG | Intronic | ||